We should seek out unfamiliar summaries of observational material, and establish their useful properties. - John Tukey.
If data analysis is to be helpful and useful it must be practiced. - John Tukey.
We should seek out unfamiliar summaries of observational material, and establish their useful properties. - John Tukey.
If data analysis is to be helpful and useful it must be practiced. - John Tukey.
| <!DOCTYPE html> | |
| <html> | |
| <head> | |
| <meta charset="utf-8" /> | |
| <title>test-3</title> | |
| <script src="https://cdnjs.cloudflare.com/ajax/libs/require.js/2.1.10/require.min.js"></script> | |
| <script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/2.0.3/jquery.min.js"></script> |
| // | |
| // main.m | |
| // badonkas | |
| // | |
| // Created by Yoshiki Vázquez Baeza on 21/07/13. | |
| // Copyright (c) 2013 Yoshiki Vázquez Baeza. All rights reserved. | |
| // | |
| // Based on the source code as written by Norio Nomura for the project | |
| // usernotification https://github.com/norio-nomura/usernotification | |
| // gcc -framework Foundation main.m |
| worker_processes 2; | |
| error_log /tmp/error.log; | |
| pid /tmp/nginx.pid; | |
| events { | |
| worker_connections 1024; | |
| } | |
| >gi|459567|dbj|D28543.1|HPCNS5PC Hepatitis C virus gene for NS5 protein, partial cds, isolate: B4/92 | |
| GAGCACGACATCTACCAATGTTGCCAACTGAACCCAGAGGCCAAGAAAGCCATAACATCCTTGACAGAGA | |
| GGCTTTACCTTGGTGGTCCCATGTTTAACTCGCGAGGTCAGCTCTGCGGGACACGCAGATGCCGGGCGAG | |
| CGGGGTTCTTCCAACCAGCATGGGCAATACCCTCACATGTTACCTGAAAGCACAGGCAGCTTGCCGTGCA | |
| GCAGGCCTCACCAATTCTGACATGTTGGTTTGCGGAGATGATTTGGTAGTCATCACTGAGAGTGCCGGAG | |
| TC | |