This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
using System; | |
using System.Collections.Generic; | |
using System.Text; | |
using System.Windows.Forms; | |
using Microsoft.Win32; | |
namespace RunOnStartup | |
{ | |
/// <summary> | |
/// It attempts to write to HKEY_LOCAL_MACHINE first, which will run on startup on all user accounts. |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import org.powerbot.game.bot.Context; | |
import java.awt.event.MouseListener; | |
/** | |
* @author HelBorn | |
*/ | |
public class MouseBlock { | |
private static MouseListener mouseListener; | |
private static boolean enabled; |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
final def KAPREKARS_CONSTANT = "6174" | |
final def MAX_ITERATIONS = 7 | |
def startingDigits = "1123" | |
def iterations = 0 | |
def solved = false | |
println "Attempting to solve ${startingDigits}:" | |
for(res = startingDigits; iterations < MAX_ITERATIONS && !solved; iterations++) { |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import re | |
# Your protein input sequence. This should be replaced with something like raw_input(""), | |
# but for this demo I just typed the string in. | |
sequence = "AUGCAAGGUACUUUCAGUUGACAAUAG" # Valid protein | |
#sequence = "AUGCAAGGUACUUUCAGUUGACAACAA" # Invalid protein | |
# Performs the search. The first argument is the regular expression (regex) | |
# and the second argument is the sequence (as seen above). | |
m = re.search(r'^(AUG([ACGU]{3,})(UAA|UAG|UGA))$', sequence) |