Skip to content

Instantly share code, notes, and snippets.

View ayoubkhan558's full-sized avatar
🏠
Working from home

Muhammad Ayoub Khan ayoubkhan558

🏠
Working from home
View GitHub Profile
@ayoubkhan558
ayoubkhan558 / Build Android Binary.md
Created April 22, 2022 14:19 — forked from nvanselow/Build Android Binary.md
Generate Android Signed APK File for Google Play with Ionic
  1. Navigate to the project folder

  2. In the command line run ionic build android --release

  3. Then in the command line run jarsigner -verbose -sigalg SHA1withRSA -digestalg SHA1 -keystore my-release-key.keystore platforms/android/build/outputs/apk/android-release-unsigned.apk alias_name

    Change "my-release-key.keystore" and "alias_name" to match your app. You may also need to change the name of the apk file.

    Also, after the build process in step 2, you should see the path to your release apk at the bottom of the output.

  4. The zipalign -v 4 platforms/android/build/outputs/apk/android-release-unsigned.apk MyApp.apk

You may need to change the name of the apk file. The signed apk will be in the main folder unless you specify a different folder.

{
"personalinfo": {
"name": "muhammad ayoub",
"title-short": "Javascript Engineer",
"title": "Hobbyist. Programmer. Dreamer. JavaScript and TypeScript lover.",
"short-about": "Hi, I'm Muhammad Ayoub and I'm a Javascript Engineer. Welcome to my personal website!",
"about": "Hi, Em <strong>Muhammad Ayoub</strong> self-learned <i>programmer</i> from <strong>Faisalabad</strong>. I'm a <strong>professional web developer</strong> specialised in <strong>frontend development</strong> for complex scalable web apps. <br> I am having the expertise and high bug solving skills and could easily get on board with an ongoing project. I have experience in web development <i>languages</i> and <i>frameworks</i>. <br> <br> Want to know how I may help your project? Check out my project <a class='ink-on-bg' href='projects.html'>portfolio</a> and <a class='link-on-bg' href='resume.html'>online </a>. ",
"marital_status": "single",
"zip_code": "57000",
"address": "Mamunkanjan, Faisalabad, Punjab, Pakistan.",
# Freelancing Reviews Samples
=======================================================================
****
=======================================================================
## Buyer Reviews to Sellers
=======================================================================
@ayoubkhan558
ayoubkhan558 / DNA.fasta
Created March 13, 2022 11:58
DNA.fasta
>by09f16.y1|BF73659
CGCGCCGGGGAATTTTTGGGTATACTCACCGCCACTACGAATGCAGCAGCGAC
CGCGCCGGGGAATTTTTGGGTATACTCACCGCCACTACGAATGCAGCAGCGAC
CGCGCCGGGGAATTTTTGGGTATACTCACCGCCACTACGAATGCAGCAGCGAC
CGCGCCGGGGAATTTTTGGGTATACTCACCGCCACTACGAATGCAGCAGCGAC
>by05e12.y1|BF724769
CCGCCGTGCGCCCAGCCAGCCATGGGGAAGATCACCCTCTACGAGGACCG
GGGCTTCCAGGGCCGCCACTACGAATGCAGCAGCGACCACCCCAACCTGC
AGCCCTACTTGAGGAATTCGAACTCGGCGCGCGTGGACAGCGGCTGCTGG
ATGCTCTATGAGCAGCCCAACTACTCGGGCCTCCAGTACTTCCTGCGCCG