OneCodex real-time search API

onecodex_real-time_k-mer_search_api.ipynb

{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# OneCodex 'real-time' *k*-mer search API\n",
    "OneCodex has a mature asynchronous API for dealing with whole files, but they also provide an undocumented API that returns lowest common ancestor (LCA) results for a single query from its in-memory 31mer database. It's millisecond fast, so the round trip to the US west coast is the limiting factor in terms of speed.\n",
    "\n",
    "You'll need to [register](https://app.onecodex.com/register) an account to receive your [API key](https://app.onecodex.com/settings)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 20,
   "metadata": {
    "collapsed": false
   },
   "outputs": [
    {
     "data": {
      "text/plain": [
       "{'elapsed_secs': '0.0001',\n",
       " 'k': 31,\n",
       " 'n_hits': 40,\n",
       " 'n_lookups': 40,\n",
       " 'tax_id': 11676}"
      ]
     },
     "execution_count": 20,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "import json\n",
    "import requests\n",
    "\n",
    "onecodex_api_key = 'YOUR_API_KEY'\n",
    "test_sequence = 'TAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCT'\n",
    "\n",
    "def onecodex_lca(seq, onecodex_api_key):\n",
    "    url = 'https://app.onecodex.com/api/v0/search'\n",
    "    payload = {'sequence':str(seq)}\n",
    "    auth = requests.auth.HTTPBasicAuth(onecodex_api_key, '')\n",
    "    response = requests.post(url, payload, auth=auth, timeout=5)\n",
    "    result = json.loads(response.text)\n",
    "    return result\n",
    "\n",
    "lca = onecodex_lca(test_sequence, onecodex_api_key)\n",
    "lca"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "One can easily look up the taxid using an EBI API"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 21,
   "metadata": {
    "collapsed": false
   },
   "outputs": [
    {
     "data": {
      "text/plain": [
       "('Human immunodeficiency virus 1',\n",
       " ['Viruses',\n",
       "  'Retro-transcribing viruses',\n",
       "  'Retroviridae',\n",
       "  'Orthoretrovirinae',\n",
       "  'Lentivirus',\n",
       "  'Primate lentivirus group'])"
      ]
     },
     "execution_count": 21,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "def ebi_taxid_to_lineage(tax_id):\n",
    "    url = 'http://www.ebi.ac.uk/ena/data/taxonomy/v1/taxon/tax-id/{}'\n",
    "    if tax_id == 0 or tax_id == 1:\n",
    "        return None, None\n",
    "    response = requests.get(url.format(tax_id), timeout=5)\n",
    "    result = json.loads(response.text)\n",
    "    sciname = result['scientificName']\n",
    "    taxonomy = [x for x in result['lineage'].split('; ') if x]\n",
    "    return sciname, taxonomy\n",
    "\n",
    "taxon = ebi_taxid_to_lineage(lca['tax_id'])\n",
    "taxon"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "This can be trivially parallelised for fast sequence characterisation, bearing in mind that this is an undocumented API which I'm informed runs on a single node… Be gentle."
   ]
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.5.1"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 0
}