This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| root@tester-00:~# sudo apt-get -y install git curl | |
| Reading package lists... Done | |
| Building dependency tree | |
| Reading state information... Done | |
| Package curl is not available, but is referred to by another package. | |
| This may mean that the package is missing, has been obsoleted, or | |
| is only available from another source | |
| Package git is not available, but is referred to by another package. | |
| This may mean that the package is missing, has been obsoleted, or |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| 2014-09-08 23:55:09,884 [salt.client ][ERROR ] Salt request timed out. If this error persists, worker_threads may need to be increased. | |
| 2014-09-08 23:55:10,179 [salt.config ][DEBUG ] Reading configuration from /etc/salt/master | |
| 2014-09-08 23:55:10,181 [salt.config ][DEBUG ] Missing configuration file: /root/.saltrc | |
| 2014-09-08 23:55:10,182 [salt.utils.event ][DEBUG ] LocalClientEvent PUB socket URI: ipc:///var/run/salt/master/master_event_pub.ipc | |
| 2014-09-08 23:55:10,182 [salt.utils.event ][DEBUG ] LocalClientEvent PULL socket URI: ipc:///var/run/salt/master/master_event_pull.ipc | |
| 2014-09-08 23:55:10,183 [salt.config ][DEBUG ] Reading configuration from /etc/salt/master | |
| 2014-09-08 23:55:10,186 [salt.config ][DEBUG ] Missing configuration file: /root/.saltrc | |
| 2014-09-08 23:55:10,186 [salt.utils.event ][DEBUG ] LocalClientEvent PUB socket URI: ipc:///var/run/salt/master/master_event_pub.ipc | |
| 2014-09-08 23:55:10,186 [salt.utils.event ][DEBUG ] LocalClientEvent PULL socket URI |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >BBa_K510044 Part-only sequence (8490 bp) | |
| tactagtagcggccgctgcagtccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgttatgcagg | |
| cttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaataggccaaccagataagtgaaatct | |
| agttccaaactattttgtcatttttaattttcgtattagcttacgacgctacacccagttcccatctattttgtcactcttccctaaataatccttaaaa | |
| actccatttccacccctcccagttcccaactattttgtccgcccacaggccgcctaggccggaagcataaagtgtaaagcctggggtgcctaatgagtga | |
| gctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagagg | |
| cggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggta | |
| atacggttatccacagaatcaggggataacgcaggaaagaacatgttaaggtatactttccgctgcataaccctgcttcggggtcattatagcgattttt | |
| tcggtatatccatcctttttcgcacgatatacaggattttgccaaagggttcgtgtagactttccttggtgtatccaacggcgtcagccgggcaggatag | |
| gtgaagtaggcccacccgcgagcgggtgttccttcttcactgtcccttattcgcacctggcggtgctcaacgggaatcctgctctgcgaggctggccgat |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| root@meteorhack-01:/etc/salt# salt '*' grains.get ipv4 | |
| meteorhack-01: | |
| - 10.208.225.53 | |
| - 104.130.3.198 | |
| - 127.0.0.1 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| lilith@lilith:~/javascript_projects/screengrab$ phantomjs login.js | |
| step 1 | |
| load started | |
| loading app.js | |
| loading routes.js | |
| loading config.js | |
| loading services.js | |
| loading service.login.js | |
| loading service.firebase.js | |
| loading service.events.js |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| lilith@lilith:~/javascript_projects/junk$ phantomjs ladybug_screencap.js | |
| TypeError: 'undefined' is not a function (evaluating 'this.login.bind(this)') | |
| http://localhost/www/js/angularfire.min.js:1 | |
| http://localhost/www/js/angularfire.min.js:1 | |
| http://localhost/www/js/service.login.js:14 | |
| http://localhost/www/js/app.js:34 | |
| http://localhost/www/js/angular.min.js:34 in d | |
| http://localhost/www/js/angular.min.js:36 | |
| lilith@lilith:~/javascript_projects/junk$ |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| lilith@lilith:/usr/local/platform-tools$ ls | |
| adb api fastboot NOTICE.txt source.properties systrace | |
| lilith@lilith:/usr/local/platform-tools$ ./adb | |
| bash: ./adb: No such file or directory | |
| lilith@lilith:/usr/local/platform-tools$ |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| wget http://nodejs.org/dist/v0.10.26/node-v0.10.26.tar.gz | |
| tar -xzvf node-v0.10.26.tar.gz | |
| cd node* | |
| ./configure --prefix=/usr/local && make && make install |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| lilith@lilith:~/javascript_projects/node$ ./configure | |
| { 'target_defaults': { 'cflags': [], | |
| 'default_configuration': 'Release', | |
| 'defines': ['OPENSSL_NO_SSL2=1'], | |
| 'include_dirs': [], | |
| 'libraries': []}, | |
| 'variables': { 'clang': 0, | |
| 'gcc_version': 46, | |
| 'host_arch': 'x64', | |
| 'node_install_npm': 'true', |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| $ sudo apt-get install nodejs | |
| $ sudo npm install -g phonegap | |
| $ sudo npm install -g appium | |
| $ appium | |
| error: Appium will not work if used or installed with sudo. Please rerun/install as a non-root user. If you had to install Appium using `sudo npm install -g appium`, the solution is to reinstall Node using a method (Homebrew, for example) that doesn't require sudo to install global npm packages. |