Inspired by this Atlantic article, I decided to replicate it as a personal challenge.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
var codons = [ | |
{'UUU': 'F'}, | |
{'CUU': 'L'}, | |
{'AUU': 'I'}, | |
{'GUU': 'V'}, | |
{'UUC': 'F'}, | |
{'CUC': 'L'}, | |
{'AUC': 'I'}, | |
{'GUC': 'V'}, | |
{'UUA': 'L'}, |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<!DOCTYPE html> | |
<meta charset="utf-8"> | |
<style> | |
.state { | |
fill: #d3d3d3; | |
stroke: #f1f1f1; | |
stroke-width: 1px; | |
} |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<!DOCTYPE html> | |
<meta charset="utf-8"> | |
<style> | |
.country-border { | |
/*fill: #d3d3d3; | |
stroke: #f1f1f1;*/ | |
fill: none; | |
stroke: #000; | |
stroke-width: 1px; |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
GENERATED_FILES = \ | |
fedland.json | |
all: $(GENERATED_FILES) | |
.PHONY: clean all | |
clean: | |
rm -rf -- $(GENERATED_FILES) build |
This file has been truncated, but you can view the full file.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome | |
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG | |
GTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGAC | |
AGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGT | |
AACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGG | |
TAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCG | |
ATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTG | |
GCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTT | |
GACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAA | |
AACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAA |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
GENERATED_FILES = \ | |
ok-blocks.json | |
all: $(GENERATED_FILES) | |
.PHONY: clean all | |
clean: | |
rm -rf -- $(GENERATED_FILES) build |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
GENERATED_FILES = \ | |
ok-tracts.json | |
all: $(GENERATED_FILES) | |
.PHONY: clean all | |
clean: | |
rm -rf -- $(GENERATED_FILES) build |
Similar Makefile to create the ok-counties.json as the previous example. Updated the ok-counties.json with name, fips as id, and area. Uses CitySDK to retrieve county level data for the state of Oklahoma. We use that data to construct a map to then style the county with the appropriately scaled color.
Please change the API key from the census bureau if you're forking. Thanks.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
GENERATED_FILES = \ | |
ok-counties.json | |
all: $(GENERATED_FILES) | |
.PHONY: clean all | |
clean: | |
rm -rf -- $(GENERATED_FILES) build |