Last active
February 20, 2025 19:51
-
-
Save fomightez/6077226 to your computer and use it in GitHub Desktop.
compositioncalc1.py from Practical Computing for Biologists by Steven H. D. Haddock and Casey W. Dunn AS A STATIC IPYTHON Notebook. Posted as a Gist by Wayne Decatur (fomightez) with full credit and reference to the original authors and note where the freely share the code online. You can see an interactive IPython gist of this at https://www.py…
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| { | |
| "cells": [ | |
| { | |
| "cell_type": "markdown", | |
| "id": "bc0fe996", | |
| "metadata": {}, | |
| "source": [ | |
| "# compositioncalc1.py" | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "f6eda2ef", | |
| "metadata": {}, | |
| "source": [ | |
| ">code by Steven H. D. Haddock and Casey W. Dunn as described in: \n", | |
| ">Practical Computing for Biologists \n", | |
| ">by Steven H. D. Haddock and Casey W. Dunn \n", | |
| ">published in 2011 by Sinauer Associates. \n", | |
| ">ISBN 978-0-87893-391-4 \n", | |
| ">\n", | |
| ">[http://www.sinauer.com/practical-computing-for-biologists.html](http://www.sinauer.com/practical-computing-for-biologists.html) \n", | |
| ">see [practicalcomputing.org](practicalcomputing.org) \n", | |
| ">\n", | |
| ">scripts freely available by the original authors at practicalcomputing.org \n", | |
| ">DIRECT LINK: [http://practicalcomputing.org/files/pcfb_examples.zip](http://practicalcomputing.org/files/pcfb_examples.zip) \n", | |
| ">Updated to Python 3 by Wayne Decatur \n", | |
| ">#### posted as a Gist and IPython Notebook by Wayne (fomightez at GitHub) with full credit and reference to original code authors." | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "ba50981c", | |
| "metadata": {}, | |
| "source": [ | |
| "#### compositioncalc1.py calculates percent of the four bases (A,C,G,&T) in a DNA sequence. <br/> The code:" | |
| ] | |
| }, | |
| { | |
| "cell_type": "code", | |
| "execution_count": 1, | |
| "id": "b734625e", | |
| "metadata": { | |
| "collapsed": false, | |
| "jupyter": { | |
| "outputs_hidden": false | |
| } | |
| }, | |
| "outputs": [ | |
| { | |
| "name": "stdout", | |
| "output_type": "stream", | |
| "text": [ | |
| "A: 35.3\n", | |
| "C: 23.5\n", | |
| "G: 11.8\n", | |
| "T: 29.4\n" | |
| ] | |
| } | |
| ], | |
| "source": [ | |
| "DNASeq = \"ATGTCTCATTCAAAGCA\"\n", | |
| "SeqLength = float(len(DNASeq))\n", | |
| " \n", | |
| "BaseList = \"ACGT\"\n", | |
| "for Base in BaseList:\n", | |
| " Percent = 100 * DNASeq.count(Base) / SeqLength\n", | |
| " print (\"%s: %4.1f\" % (Base,Percent))\n", | |
| " " | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "e2388615", | |
| "metadata": {}, | |
| "source": [ | |
| "**See the code in action and explore it interactively [here](https://www.pythonanywhere.com/gists/6076502/compositioncalc1.py/ipython2/).** " | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "d9e8cb85", | |
| "metadata": {}, | |
| "source": [ | |
| "**Obtain a copy of this entire IPython Notebook [here](https://gist.github.com/fomightez/6077226) in order to explore it interactively.** " | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "686f09b0", | |
| "metadata": {}, | |
| "source": [ | |
| "\n", | |
| "\n", | |
| "\n", | |
| "\n", | |
| " \n", | |
| " \n", | |
| " \n", | |
| " " | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "e8bd440d", | |
| "metadata": {}, | |
| "source": [ | |
| "### <br/> Additional aid and exploration below:" | |
| ] | |
| }, | |
| { | |
| "cell_type": "code", | |
| "execution_count": 2, | |
| "id": "cd593838", | |
| "metadata": { | |
| "collapsed": false, | |
| "jupyter": { | |
| "outputs_hidden": false | |
| } | |
| }, | |
| "outputs": [ | |
| { | |
| "name": "stdout", | |
| "output_type": "stream", | |
| "text": [ | |
| "Variable Type Data/Info\n", | |
| "------------------------------\n", | |
| "Base str T\n", | |
| "BaseList str ACGT\n", | |
| "DNASeq str ATGTCTCATTCAAAGCA\n", | |
| "Percent float 29.41176470588235\n", | |
| "SeqLength float 17.0\n" | |
| ] | |
| } | |
| ], | |
| "source": [ | |
| "%whos" | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "7b16ca3a", | |
| "metadata": {}, | |
| "source": [ | |
| "The above special command lets us see what is defined and can be used in an IPython Notebook. \n", | |
| "(For some reason it doesn't work for any of the initiating variables over in the interactive gist console.)" | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "abfd01a1", | |
| "metadata": {}, | |
| "source": [ | |
| " \n", | |
| " \n", | |
| " " | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "214bde3b", | |
| "metadata": {}, | |
| "source": [ | |
| " _We can go ahead and define a function that will do this caculation:_" | |
| ] | |
| }, | |
| { | |
| "cell_type": "code", | |
| "execution_count": 3, | |
| "id": "3231360f", | |
| "metadata": { | |
| "collapsed": false, | |
| "jupyter": { | |
| "outputs_hidden": false | |
| } | |
| }, | |
| "outputs": [], | |
| "source": [ | |
| "def calc(MyDNASeq):\n", | |
| " SeqLength = float(len(MyDNASeq))\n", | |
| " BaseList = \"ACGT\"\n", | |
| " for Base in BaseList:\n", | |
| " Percent = 100 * MyDNASeq.count(Base) / SeqLength\n", | |
| " print (\"%s: %4.1f\" % (Base,Percent))" | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "464aa5a0", | |
| "metadata": {}, | |
| "source": [ | |
| "_Then define a variable_" | |
| ] | |
| }, | |
| { | |
| "cell_type": "code", | |
| "execution_count": 4, | |
| "id": "87b4acb6", | |
| "metadata": { | |
| "collapsed": false, | |
| "jupyter": { | |
| "outputs_hidden": false | |
| } | |
| }, | |
| "outputs": [], | |
| "source": [ | |
| "MyDNASeq=\"TTGGGGGGCGAAAA\"" | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "067a7dbe", | |
| "metadata": {}, | |
| "source": [ | |
| "_Then we feed that variable to the function:_" | |
| ] | |
| }, | |
| { | |
| "cell_type": "code", | |
| "execution_count": 5, | |
| "id": "f304c1ee", | |
| "metadata": { | |
| "collapsed": false, | |
| "jupyter": { | |
| "outputs_hidden": false | |
| } | |
| }, | |
| "outputs": [ | |
| { | |
| "name": "stdout", | |
| "output_type": "stream", | |
| "text": [ | |
| "A: 28.6\n", | |
| "C: 7.1\n", | |
| "G: 50.0\n", | |
| "T: 14.3\n" | |
| ] | |
| } | |
| ], | |
| "source": [ | |
| "calc(MyDNASeq)" | |
| ] | |
| }, | |
| { | |
| "cell_type": "markdown", | |
| "id": "c0aab822", | |
| "metadata": {}, | |
| "source": [ | |
| "_In fact, we can even skip the variable and directly input the sequence into the function:_" | |
| ] | |
| }, | |
| { | |
| "cell_type": "code", | |
| "execution_count": 6, | |
| "id": "49b473cf", | |
| "metadata": { | |
| "collapsed": false, | |
| "jupyter": { | |
| "outputs_hidden": false | |
| } | |
| }, | |
| "outputs": [ | |
| { | |
| "name": "stdout", | |
| "output_type": "stream", | |
| "text": [ | |
| "A: 16.7\n", | |
| "C: 33.3\n", | |
| "G: 4.2\n", | |
| "T: 45.8\n" | |
| ] | |
| } | |
| ], | |
| "source": [ | |
| "calc(\"TGTTTTTCTTTTTCCCCCCCAAAA\")" | |
| ] | |
| } | |
| ], | |
| "metadata": { | |
| "kernelspec": { | |
| "display_name": "Python 3 (ipykernel)", | |
| "language": "python", | |
| "name": "python3" | |
| }, | |
| "language_info": { | |
| "codemirror_mode": { | |
| "name": "ipython", | |
| "version": 3 | |
| }, | |
| "file_extension": ".py", | |
| "mimetype": "text/x-python", | |
| "name": "python", | |
| "nbconvert_exporter": "python", | |
| "pygments_lexer": "ipython3", | |
| "version": "3.10.16" | |
| } | |
| }, | |
| "nbformat": 4, | |
| "nbformat_minor": 5 | |
| } |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment