Skip to content

Instantly share code, notes, and snippets.

View iimog's full-sized avatar

Markus J. Ankenbrand iimog

View GitHub Profile
@iimog
iimog / minimal.fa
Created November 24, 2014 10:59
Example fasta that causes a NullPointerException in RDPClassifier crossvalidate
>164458368 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum sphondylium
ACGCATTCACTTGCCCAAAACCACACACTCCTTGAGGAGCTGTGTTGGTTTGAGGGCGGAAATTGGCCTCCCATGCCTTCTCGCATGGTTGGCAAAAAAATGAGTCTCTGGCTATGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGAATCCGGGTCATCTTAACGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTCGA
>298507601 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia richardsonis
ACGCCAAAAGACACTCCCCACCCAACCTAGTGGGGACGTGGTATTTGGCTCCTCGTGTCGTTATGCACGGTGGGCAAAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTACGATACAAGCCGTGTACGGCGATGCTATGGCCCTTTGGACCCATTTAATCGAAGCGCGCGTCGCTCGAACCGCGA
>298507603 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia seatonii
ACGYCAAAAGACACTCCCCRCCTATCTGAGTAGGGATGTGGTATTTGGCCCCTCGTGCCTTTGCGTGCGGTGGGCAAAAGTTGGGGCTGCCGGCGGAGCCGATCACAGCACAAGGTGGATGACGTAAGTTGTTCTCGGTGCTACGATAYGAGCCGCACACGGCAATGCTATGGCCCTTTGGACCCATCAATCGAAGCGCGTG
@iimog
iimog / minimal.tax
Created November 24, 2014 11:00
Example tax that causes a NullPointerException in RDPClassifier crossvalidate
0*Root*-1*0*rootrank
1*k__Viridiplantae*0*1*kingdom
2*p__Streptophyta*1*2*phylum
3*c__asterids*2*3*class
4*o__Apiales*3*4*order
5*f__Apiaceae*4*5*family
6*g__Heracleum*5*6*genus
7*s__Heracleum sphondylium*6*7*species
8*c__Liliopsida*2*3*class
9*o__Poales*8*4*order

Keybase proof

I hereby claim:

  • I am iimog on github.
  • I am iimog (https://keybase.io/iimog) on keybase.
  • I have a public key whose fingerprint is A09D B088 B121 3D2E 5594 A81D 1303 8317 284F 6FAC

To claim this, I am signing this object:

@iimog
iimog / TBro_Individual_CLA
Last active April 15, 2016 14:32
Individual Contributor License Agreement for TBro (derived from jQuery Foundation ICLA v3.0 https://contribute.jquery.org/CLA/)
###Individual Contributor License Agreement
Thank you for Your interest in TBro. This document clarifies the terms under which You, the person signing this agreement, may make Contributions — which may include without limitation, software, bug fixes, configuration changes, documentation, or any other materials — to any of the projects owned or managed by TBroTeam.
Please read this agreement carefully. If You have questions about these terms, please contact us via [GitHub](https://github.com/TBroTeam).
You accept and agree to the following terms and conditions for Your present and future Contributions submitted to TBro. Except for the license granted herein to Us, You reserve all right, title, and interest in and to Your Contributions.
**Licenses**
{
"id":null,
"format": "Biological Observation Matrix 0.9.1-dev",
"format_url": "http://biom-format.org/documentation/format_versions/biom-1.0.html",
"type": "OTU table",
"generated_by": "QIIME revision 1.4.0-dev",
"date": "2011-12-19T19:00:00",
"rows":[
{"id":"GG_OTU_1", "metadata":{"taxonomy":["k__Bacteria", "p__Proteobacteria", "c__Gammaproteobacteria", "o__Enterobacteriales", "f__Enterobacteriaceae", "g__Escherichia", "s__"]}},
{"id":"GG_OTU_2", "metadata":{"taxonomy":["k__Bacteria", "p__Cyanobacteria", "c__Nostocophycideae", "o__Nostocales", "f__Nostocaceae", "g__Dolichospermum", "s__"]}},
@iimog
iimog / phinchHideOTU.biom
Last active January 5, 2017 15:26
Minimal biom file to demonstrate [a bug](https://github.com/PitchInteractiveInc/Phinch/issues/69) in Phinch.
{
"id": "No Table ID",
"format": "Biological Observation Matrix 2.1.0",
"format_url": "http://biom-format.org",
"matrix_type": "sparse",
"generated_by": "BIOM-Format 2.1",
"date": "2016-05-03T08:13:41.848780",
"type": "OTU table",
"matrix_element_type": "float",
"shape": [3, 3],
@iimog
iimog / phinchSampleList.biom
Created January 11, 2017 10:07
Minimal biom file to demonstrate [a bug](https://github.com/PitchInteractiveInc/Phinch/issues/70) in Phinch.
{
"id": "No Table ID",
"format": "Biological Observation Matrix 2.1.0",
"format_url": "http://biom-format.org",
"matrix_type": "sparse",
"generated_by": "BIOM-Format 2.1",
"date": "2016-05-03T08:13:41.848780",
"type": "OTU table",
"matrix_element_type": "float",
"shape": [3, 3],
@iimog
iimog / phinchDonutScale.biom
Created March 16, 2017 18:33
Minimal biom file to demonstrate [a bug](https://github.com/PitchInteractiveInc/Phinch/issues/72) in Phinch.
{
"id": "No Table ID",
"format": "Biological Observation Matrix 2.1.0",
"format_url": "http://biom-format.org",
"matrix_type": "sparse",
"generated_by": "BIOM-Format 2.1",
"date": "2016-05-03T08:13:41.848780",
"type": "OTU table",
"matrix_element_type": "float",
"shape": [3, 3],
@iimog
iimog / phinchFilterBug.biom
Created April 11, 2017 15:45
Minimal biom file to demonstrate [a bug](https://github.com/PitchInteractiveInc/Phinch/issues/73) in Phinch.
{
"id": "No Table ID",
"format": "Biological Observation Matrix 2.1.0",
"format_url": "http://biom-format.org",
"matrix_type": "sparse",
"generated_by": "BIOM-Format 2.1",
"date": "2017-04-11T17:40:40.014828",
"type": "OTU table",
"matrix_element_type": "float",
"shape": [3, 3],
@iimog
iimog / extract_scales_bee_traits_from_html.py
Created August 23, 2017 07:55
A python script (using beautiful soup) to extract bee traits from the html pages at http://scales.ckff.si/scaletool/?menu=6&submenu=3 and save as FENNEC compatible tsv files
# coding: utf-8
from bs4 import BeautifulSoup
import glob
trait_types = dict()
trait_values_numeric = dict()
trait_values_categorical = dict()
general_citation = "Budrys, E., Budriene., A. and Orlovskyte. S. 2014. Cavity-nesting wasps and bees database."