peterjc’s gists

peterjc / reportlab_ps_test.py

Last active January 2, 2016 17:09

Standalone test case originally Biopython for resting ReportLab under Python 2 and 3. Currently seeing a segmentation fault under Python 2.7, and a TypeError under Python 3.3 when testing on Mac OS X - see http://two.pairlist.net/pipermail/reportlab-users/2014-January/010972.html

	from reportlab.pdfgen import canvas
	from reportlab.lib.pagesizes import letter
	from reportlab.lib.units import inch
	from reportlab.lib import colors
	from reportlab.pdfbase.pdfmetrics import stringWidth

	from reportlab.graphics.shapes import Drawing, String, Line, Rect, Wedge, ArcPath
	from reportlab.graphics import renderPDF, renderPS
	from reportlab.graphics.widgetbase import Widget

peterjc / make_roomba_lirc.py

Created November 11, 2013 23:40

Python script to generate

	#!/usr/bin/env python
	#Copyright 2013, Peter Cock. All rights reserved.
	#Released under the MIT License.
	"""Python scipt to generate Roomba IR codes for LIRC.

	Tested under Python 2.7 and Python 3.3, example usage:

	$ python make_roomba_lirc.py > roomba.conf

	See also:

peterjc / decode_roomba_ir.py

Last active December 26, 2015 09:09

Python scipt to decode Roomba IR codes via the Linux mode2 tool. See http://astrobeano.blogspot.co.uk/2013/10/roomba-620-infrared-signals.html

	#!/usr/bin/env python
	#Copyright 2013, Peter Cock. All rights reserved.
	#Released under the MIT License.
	"""Python scipt to decode Roomba IR codes via the Linux mode2 tool.

	Tested under Python 2.7 and Python 3.3, example usage:

	$ mode2 -d /dev/lirc0 \| python decode_roomba_ir.py
	10101100 - 172 - 0xAC
	10101100 - 172 - 0xAC

peterjc / ace_to_contig_stats.py

Created February 19, 2013 16:56

Quick Python script to extract contig summary information (lengths and number of reads, as a tabular file) from an ACE assembly file, using the Biopython ACE parser for convenience.

	#!/usr/bin/env python
	#Example usage:
	#
	# $ python ace_to_contig_stats.py < example.ace > example_stats.tsv
	#
	import sys
	from Bio.Sequencing import Ace

	sys.stdout.write("#Contig\tPadded length\tUnpadded length\tReads\n")
	for contig in Ace.parse(sys.stdin):

peterjc / SAMv1_padded.fasta

Created May 14, 2012 10:00

SAM/BAM examples from the specification

	>ref
	AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT

peterjc / green_bottles.py

Created March 20, 2012 14:30

Simple "Green Bottles" Python script to benchmark ZLIB calls under different Python implementations + PyPy target

	import zlib
	import time

	def decompress(comp_data):
	d = zlib.decompressobj(-15) #Negative window size means no headers
	uncomp_data = d.decompress(comp_data) + d.flush()
	del d
	return uncomp_data, zlib.crc32(uncomp_data)

	def compress(orig_data):

peterjc / select_fastq2.py

Created September 7, 2011 16:29

Selecting FASTQ sequences by ID (Biopython with strings)

	from Bio.SeqIO.QualityIO import FastqGeneralIterator
	import sys
	ids = set(x[:-1] for x in open(sys.argv[1]))
	for title, seq, quals in FastqGeneralIterator(sys.stdin):
	if title.split(None,1)[0] in ids:
	print "@%s\n%s\n+\n%s\n" % (title, seq, quals)

peterjc / select_fastq.py

Created September 7, 2011 16:27

Selecting FASTQ sequences by ID (Biopython with SeqRecord object)

	from Bio import SeqIO
	import sys
	ids = set(x[:-1] for x in open(sys.argv[1]))
	wanted = (rec for rec in SeqIO.parse(sys.stdin, "fastq") if rec.id in ids)
	SeqIO.write(wanted, sys.stdout, "fastq")

peterjc / brad_gff_import.py

Created August 24, 2011 02:31

Hack script to import selected folders from one git repository to another

	#Copyright 2011 Peter Cock, released under GPL v3 licence
	#
	#Hack script to extract files in selected directories in one git
	#repository and apply them to another repository using a potentially
	#different directory structure.
	#
	#This written in Python and needs the git library, I used 0.3.2 RC1
	#https://github.com/gitpython-developers/GitPython
	#
	#I assume when run both repositories are clean (no untracked files,

Peter Cock peterjc