Peter West peterjwest

How to intercept any request that matches a route (in this case '/admin') in three different languages/frameworks.

Better variable dumping for PHP

Associative arrays are printed as:

{
  key: 'value'

'key 2': 'value 2'

Some html:

<a id="redLink" class="red link" href="#">Click me!</a>

CSS specifity, low to high:

a { color: red; }
body a { color: red; }
a.red { color: red; }

body a.red { color: red; }

	html .cmsms_color_scheme_fourth h1,
	html .cmsms_color_scheme_fourth h2,
	html .cmsms_color_scheme_fourth h3,
	html .cmsms_color_scheme_fourth h4,
	html .cmsms_color_scheme_fourth h5,
	html .cmsms_color_scheme_fourth h6,
	html .cmsms_color_scheme_fourth h1 a,
	html .cmsms_color_scheme_fourth h2 a,
	html .cmsms_color_scheme_fourth h3 a,
	html .cmsms_color_scheme_fourth h4 a,

	from __future__ import division

	print '\nExample 1'

	# Input DNA 1
	dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
	print 'DNA:', dna

	# Calculate AT count
	A_count = dna.count("A")

	# Normally a block is passed after the arguments
	[1,2,3].map(){ \|i\| i.next }

	# & passes the argument as a block
	[1,2,3].map(&:next)

	# & arguments are cast to a Proc
	[1,2,3].map(&:next.to_proc)

	# Procs are already procs

	<!DOCTYPE html>
	<html>
	<head><title>Novalidate bug test</title></head>
	<style>
	button {
	border: 0 background: red;
	}
	button span {
	background: green;
	}

	public function setSegments($segments)
	{
	$mandango = $this->getMandango();

	$segments = array_map(function($name) use ($mandango) {
	return $mandango->create('Model\Intervention\InterventionSetSegment')->setName($name);
	}, $segments);

	$segmentGroup = parent::getSegments();
	$segmentGroup->remove($segmentGroup->all());

	# Removes deleted branches on remote, locally deletes all merged branches which are not the current branch or master or develop
	git checkout develop && git fetch --prune && git branch --merged \| grep -E -v "^((\* )\|\s*(develop\|master)$)" \| xargs git branch -d

	var pad = function(string, length, char) {
	return (new Array(length).join(char[0] \|\| '0') + string).slice(-Math.max(string.toString().length, length));
	};