Timothy R. Fallon, PhD photocyte

postdoc @ SIO/UCSD

photocyte / blast_outfmt7_all_to_just_best_hit.sh

Created December 23, 2016 00:36

zcat Athal_to_Goffic_blastp_out6.tsv.gz | grep -P -v "^#" | sort -u -nr -k12,12 -k1,1 | sort -u -k1,1

photocyte / Busco_count_transcript_level_duplicates.sh

Last active December 23, 2016 00:38

grep -v -f <(cat full_table_eukaryota_odb9.tsv | grep -v "#" | sort -u -k 3,3) full_table_eukaryota_odb9.tsv

photocyte / orthomcl_mysql_commands

Created December 25, 2016 03:36

	CREATE DATABASE orthomcl;
	CREATE USER 'orthomcl'@'localhost' IDENTIFIED BY 'orthomcl!';
	GRANT ALL PRIVILEGES ON orthomcl.* TO 'orthomcl'@'localhost';

photocyte / Busco_count_full_table

Last active January 31, 2017 23:18

	##Total hits
	cat full_table_*.tsv \| grep -v "Missing" \| grep -v "#" \| cut -f 3 \| sort \| uniq -c

	##Hits broken down by complete/fragmented/duplicated status
	cat full_table_*.tsv \| grep -v "Missing" \| grep -v "#" \| sort -k 2,3 \| cut -f 2,3 \| uniq -c

photocyte / graphmap_streaming

Last active February 8, 2017 14:28

	##Abusing file descriptors to have graphmap stream/pipe the .sam output into samtools for filtering and compression to .bam
	/lab/solexa_weng/testtube/graphmap/bin/Linux-x64/graphmap align -r mito_reference.fasta -d raw_reads.fasta -P -o /dev/fd/3 3>&1 1>&2 \| samtools view -b -h -F 4 > aligned_reads.bam

photocyte / Rotate_circular_reference.sh

Last active February 22, 2017 19:41

	##No warranty expressed or implied. Hackish code to use Seqkit to "rotate" circular genomes.
	##Intended for use with Quiver, or other polishing tools like Pilon, to ensure that
	##there isn't a coverage drop at the end of the circular sequence which prevents calling of the true consensus bases
	##Graphmap is the only aligner that I'm aware of that properly deals with circular references!

	FASTA=$1
	NAME=$(basename $FASTA)

	LENGTH=$(seqkit stat $FASTA \| grep "FASTA" \| tr -s " "\| cut -f 5 -d " " \| tr -d ",")
	HALF=$(expr $LENGTH / 2 )

photocyte / Sequencing_adaptors.fasta

Created September 1, 2017 06:33

	>Illumina Single End Apapter 1
	ACACTCTTTCCCTACACGACGCTGTTCCATCT
	>Illumina Single End Apapter 2
	CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
	>Illumina Single End PCR Primer 1
	AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
	>Illumina Single End PCR Primer 2
	CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
	>Illumina Single End Sequencing Primer
	ACACTCTTTCCCTACACGACGCTCTTCCGATCT

photocyte / Chromium_v2_adaptors

Created January 29, 2018 16:15

	>R1_readthrough
	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[NACTG]{7,9}ATCTCGTATGCCGTCTTCTGCTTG[A]{5,7}
	>R2_readthrough
	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT[A]{5,7}

photocyte / nextflow_cleanup_extraneous_work.sh

Last active November 14, 2024 01:24

	#! /bin/bash

	## See also https://github.com/nextflow-io/nextflow/discussions/4308

	## cd to a parent directory for a Nextflow pipeline executation, i.e. contains .nextflow and work directories

	## Find work directories essential to the last pipeline run, as absolute paths
	nextflow log last > /tmp/preserve_dirs.txt

	## Find all work directories, as absolute paths