This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| zcat Athal_to_Goffic_blastp_out6.tsv.gz | grep -P -v "^#" | sort -u -nr -k12,12 -k1,1 | sort -u -k1,1 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| grep -v -f <(cat full_table_eukaryota_odb9.tsv | grep -v "#" | sort -u -k 3,3) full_table_eukaryota_odb9.tsv |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| CREATE DATABASE orthomcl; | |
| CREATE USER 'orthomcl'@'localhost' IDENTIFIED BY 'orthomcl!'; | |
| GRANT ALL PRIVILEGES ON orthomcl.* TO 'orthomcl'@'localhost'; |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ##Total hits | |
| cat full_table_*.tsv | grep -v "Missing" | grep -v "#" | cut -f 3 | sort | uniq -c | |
| ##Hits broken down by complete/fragmented/duplicated status | |
| cat full_table_*.tsv | grep -v "Missing" | grep -v "#" | sort -k 2,3 | cut -f 2,3 | uniq -c |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ##Abusing file descriptors to have graphmap stream/pipe the .sam output into samtools for filtering and compression to .bam | |
| /lab/solexa_weng/testtube/graphmap/bin/Linux-x64/graphmap align -r mito_reference.fasta -d raw_reads.fasta -P -o /dev/fd/3 3>&1 1>&2 | samtools view -b -h -F 4 > aligned_reads.bam |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ##No warranty expressed or implied. Hackish code to use Seqkit to "rotate" circular genomes. | |
| ##Intended for use with Quiver, or other polishing tools like Pilon, to ensure that | |
| ##there isn't a coverage drop at the end of the circular sequence which prevents calling of the true consensus bases | |
| ##Graphmap is the only aligner that I'm aware of that properly deals with circular references! | |
| FASTA=$1 | |
| NAME=$(basename $FASTA) | |
| LENGTH=$(seqkit stat $FASTA | grep "FASTA" | tr -s " "| cut -f 5 -d " " | tr -d ",") | |
| HALF=$(expr $LENGTH / 2 ) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >Illumina Single End Apapter 1 | |
| ACACTCTTTCCCTACACGACGCTGTTCCATCT | |
| >Illumina Single End Apapter 2 | |
| CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
| >Illumina Single End PCR Primer 1 | |
| AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT | |
| >Illumina Single End PCR Primer 2 | |
| CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
| >Illumina Single End Sequencing Primer | |
| ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >R1_readthrough | |
| AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[NACTG]{7,9}ATCTCGTATGCCGTCTTCTGCTTG[A]{5,7} | |
| >R2_readthrough | |
| AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT[A]{5,7} |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #! /bin/bash | |
| ## See also https://github.com/nextflow-io/nextflow/discussions/4308 | |
| ## cd to a parent directory for a Nextflow pipeline executation, i.e. contains .nextflow and work directories | |
| ## Find work directories essential to the last pipeline run, as absolute paths | |
| nextflow log last > /tmp/preserve_dirs.txt | |
| ## Find all work directories, as absolute paths |