Rintze M. Zelle, PhD rmzelle
rmzelle
/ gist:9474163
Created
March 10, 2014 20:58
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <?xml version="1.0" encoding="utf-8"?> | |
| <style xmlns="http://purl.org/net/xbiblio/csl" class="in-text" version="1.0" demote-non-dropping-particle="never" default-locale="sk-SK"> | |
| <info> | |
| <title>ISO-690 (author-date, Slovak)</title> | |
| <id>http://www.zotero.org/styles/iso690-author-date-sk</id> | |
| <link href="http://www.zotero.org/styles/iso690-author-date-sk" rel="self"/> | |
| <link href="http://www.zotero.org/styles/iso690-author-date-cs" rel="template"/> | |
| <author> | |
| <name>Tomáš Ferianc</name> | |
| <email>tferianc@gmail.com</email> |
rmzelle
/ gist:11239889
Created
April 24, 2014 02:55
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| $ bundle exec rake | |
| /usr/local/Cellar/ruby/2.1.1_1/bin/ruby -S rspec ./spec/dependent_styles_spec.rb ./spec/independent_styles_spec.rb ./spec/repository_spec.rb --require spec_helper.rb --format Fuubar --color | |
| /Library/Ruby/Gems/2.0.0/gems/nokogiri-1.6.1/lib/nokogiri/nokogiri.bundle: [BUG] Segmentation fault at 0x00000000000418 | |
| ruby 2.1.1p76 (2014-02-24 revision 45161) [x86_64-darwin13.0] | |
| -- Crash Report log information -------------------------------------------- | |
| See Crash Report log file under the one of following: | |
| * ~/Library/Logs/CrashReporter | |
| * /Library/Logs/CrashReporter | |
| * ~/Library/Logs/DiagnosticReports |
rmzelle
/ gist:11258367
Created
April 24, 2014 15:14
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| 246) dependent style annals-of-diagnostic-pathology is a valid CSL 1.0 style | |
| Failure/Error: CSL.validate(path).should == [] | |
| CSL::ValidationError: | |
| please `gem install nokogiri' for validation support | |
| # ./spec/dependent_styles_spec.rb:6:in `block (3 levels) in <top (required)>' | |
| 247) dependent style annals-of-dyslexia is a valid CSL 1.0 style | |
| Failure/Error: CSL.validate(path).should == [] | |
| CSL::ValidationError: | |
| please `gem install nokogiri' for validation support |
rmzelle
/ gist:85b9ad841ca101f04803
Created
May 31, 2014 19:50
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Title TitleShort ISSN EISSN Field Field2 Documentation | |
| The American Journal of Human Genetics AJHG 0002-9297 1537-6605 biology medicine http://www.cell.com/ajhg/authors | |
| Biophysical Journal x 0006-3495 1542-0086 biology medicine http://www.cell.com/biophysj/authors |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Total: 5118 | |
| === | |
| Elsevier: 1808 | |
| Springer: 1408 | |
| Taylor & Francis: 615 | |
| BioMed Central (BMC): 302 | |
| Institute of Electrical and Electronics Engineers (IEEE): 203 | |
| Multidisciplinary Digital Publishing Institute (MDPI): 124 | |
| IOP Publishing: 68 | |
| Future Science Group: 58 |
rmzelle
/ gist:b271c9a5b56f0189a178
Created
June 2, 2014 01:57
Parents with non-generated dependent count
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| vancouver-superscript: 139 | |
| vancouver: 113 | |
| apa: 84 | |
| karger-journals: 78 | |
| american-medical-association: 59 | |
| nature: 54 | |
| vancouver-brackets: 30 | |
| elsevier-with-titles: 27 | |
| vancouver-superscript-brackets-only-year: 13 | |
| american-institute-of-physics: 13 |
rmzelle
/ gist:b31079951881892e311b
Created
June 15, 2014 02:17
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| vancouver-superscript: 139 | |
| vancouver: 115 | |
| american-medical-association: 59 | |
| nature: 52 | |
| vancouver-brackets: 30 | |
| apa: 28 | |
| elsevier-with-titles: 27 | |
| vancouver-superscript-brackets-only-year: 13 | |
| sage-vancouver: 10 | |
| elsevier-harvard: 9 |
rmzelle
/ apa-line-break.csl
Created
July 25, 2014 01:54
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <?xml version="1.0" encoding="utf-8"?> | |
| <style xmlns="http://purl.org/net/xbiblio/csl" class="in-text" version="1.0" demote-non-dropping-particle="never"> | |
| <!-- This style was edited with the Visual CSL Editor (http://steveridout.com/csl/visualEditor/) --> | |
| <info> | |
| <title>APA 6th edition (line-break)</title> | |
| <title-short>APA</title-short> | |
| <id>http://www.zotero.org/styles/apa-line-break</id> | |
| <link href="http://www.zotero.org/styles/apa-line-break" rel="self"/> | |
| <link href="http://owl.english.purdue.edu/owl/resource/560/01/" rel="documentation"/> | |
| <author> |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| start = element boundary { Bounds } | |
| Bounds = ( | |
| attribute from { "published" | "global" | xsd:date }, | |
| attribute to { "published" | "global" | xsd:date } | |
| ) |
rmzelle
/ gist:94a9c01f1b7cfc60d15a
Created
July 31, 2014 15:53
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| target_number sequence_number sequence_id sequence_range sequence_refpoint sequence_acceptnum sequence_other_annotation target_threshold_rejection_score target_all_matches_analyzed? target_nonstandard_basecode_matches target_location target_strand target_refpoint_5p_offset target_sequence | |
| 1 1 m3707-fcy1 FASTA:1-477 1 1 5 1 0 FASTA:8-30 + 7 CAGGGGGAATGGCAAGCAAGTGG | |
| 2 1 m3707-fcy1 FASTA:1-477 1 1 8 1 0 FASTA:9-31 + 8 AGGGGGAATGGCAAGCAAGTGGG | |
| 3 1 m3707-fcy1 FASTA:1-477 1 1 Inf 1 0 FASTA:18-40 + 17 GGCAAGCAAGTGGGATCAGAAGG | |
| 4 1 m3707-fcy1 FASTA:1-477 1 1 Inf 1 0 FASTA:19-41 + 18 GCAAGCAAGTGGGATCAGAAGGG | |
| 5 1 m3707-fcy1 FASTA:1-477 1 1 6 1 0 FASTA:24-46 + 23 CAAGTGGGATCAGAAGGGTATGG | |
| 6 1 m3707-fcy1 FASTA:1-477 1 1 8 1 0 FASTA:39-61 + 38 GGGTATGGACATTGCCTATGAGG | |
| 7 1 m3707-fcy1 FASTA:1-477 1 1 Inf 1 0 FASTA:42-64 + 41 TATGGACATTGCCTATGAGGAGG | |
| 8 1 m3707-fcy1 FASTA:1-477 1 1 Inf 1 0 FASTA:45-67 + 44 GGACATTGCCTATGAGGAGGCGG | |
| 9 1 m3707-fcy1 FASTA:1-477 1 1 Inf 1 0 FASTA:52-74 + 51 GCCTATGAGGAGGCGGCCTTAGG |