Stephen Turner stephenturner
stephenturner
/ mm9symbols.txt
Last active
December 17, 2015 01:09
Official gene symbols obtained from the mm9 UCSC GTF using the command: cat genes.gtf | awk '{print $10}' | sed 's/[";]//g' | uniq | sort | uniq > mm9symbols.txt
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| 0610005C13Rik | |
| 0610007C21Rik | |
| 0610007L01Rik | |
| 0610007N19Rik | |
| 0610007P08Rik | |
| 0610007P14Rik | |
| 0610007P22Rik | |
| 0610008F07Rik | |
| 0610009B14Rik | |
| 0610009B22Rik |
stephenturner
/ hg19symbols.txt
Created
May 6, 2013 16:28
Official gene symbols obtained from the hg19 UCSC GTF using the command: cat genes.gtf | awk '{print $10}' | sed 's/[";]//g' | uniq | sort | uniq > hg19symbols.txt
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| 1/2-SBSRNA4 | |
| A1BG | |
| A1BG-AS1 | |
| A1CF | |
| A2LD1 | |
| A2M | |
| A2ML1 | |
| A2MP1 | |
| A4GALT | |
| A4GNT |
stephenturner
/ get-uscode-wc.sh
Last active
June 12, 2021 21:43
Get a rough word count of the entire US Code of Law
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # Replace the parallel stuff with xargs if you don't have GNU parallel, or just pipe to 'sh'. | |
| # Use 'wget' on linux, 'curl -O' on mac. | |
| for i in $(seq -f "%02.f" 1 51); do echo "curl -O http://uscode.house.gov/download/pls/Title_$i.ZIP"; done | parallel | |
| find *ZIP | parallel --dry-run unzip {} | |
| cat *txt | wc | |
| ## Results: | |
| # cat *txt | wc | |
| # 6546729 45920853 338309328 |
stephenturner
/ newmedips-roi-file.csv
Created
April 9, 2013 14:27
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| chr | start | stop | ID | |
|---|---|---|---|---|
| chr1 | 4773206 | 4785739 | Mrpl15 | |
| chr1 | 8361475 | 9299878 | Sntg1 | |
| chr1 | 10993465 | 11303682 | Prex2 | |
| chr1 | 11414105 | 11975901 | A830018L16Rik | |
| chr1 | 12692430 | 12860371 | Sulf1 | |
| chr1 | 13113457 | 13127163 | Prdm14 | |
| chr1 | 16228674 | 16520112 | Stau2 | |
| chr1 | 18115191 | 18145902 | Crisp4 | |
| chr1 | 19208914 | 19238734 | Tfap2b |
stephenturner
/ qq-with-ymax.r
Created
April 5, 2013 19:22
create qq plot where you can specify the upper limit on the y-axis.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| qq = function(pvector, ymax=NA, ...) { | |
| if (!is.numeric(pvector)) stop("D'oh! P value vector is not numeric.") | |
| pvector <- pvector[!is.na(pvector) & pvector<1 & pvector>0] | |
| o = -log10(sort(pvector,decreasing=F)) | |
| e = -log10( ppoints(length(pvector) )) | |
| if (!is.numeric(ymax) | ymax<max(o)) ymax <- max(o) | |
| plot(e,o,pch=19,cex=1, xlab=expression(Expected~~-log[10](italic(p))), ylab=expression(Observed~~-log[10](italic(p))), xlim=c(0,max(e)), ylim=c(0,ymax), ...) | |
| abline(0,1,col="red") | |
| } |
stephenturner
/ intro-bioinfo-microarray.r
Created
April 4, 2013 14:49
Code from UVA cell bio 8401 intro bioinformatics lab. Demonstrates some basic features of R, then dives into a microarray analysis of Affy genechips using limma.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ## Introduction to R and Bioconductor for Cell Biology 8401 | |
| # Introduction to R ------------------------------------------------------- | |
| # Introduce R, Rstudio, layout, workspace, etc. | |
| # R is a glorified calculator | |
| # Start this in console, move to editor, use run button | |
| 2+2 | |
| 5*4 | |
| 2^3 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| niter <- 100 | |
| pb <- txtProgressBar(min=0, max=niter, style=3) | |
| for (i in 1:niter) { | |
| Sys.sleep(0.025) # Do something here besides sleep! | |
| setTxtProgressBar(pb, i) | |
| } |
stephenturner
/ genefilter-example.r
Created
February 20, 2013 18:41
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| library(genefilter) | |
| library(mouse4302.db) | |
| # do stuff here to load your affybatch, run rma. | |
| # affybatch <- ReadAffy(filenames) | |
| # eset_orig <- rma(affybatch) | |
| ## Condinue using the genefilter package to: | |
| ## 1. Remove probes that aren't annotated with an entrez ID, | |
| ## 2. If multiple probes map to the same gene, keep the one with the largest IQR (most reliably detected) |
stephenturner
/ medips-biomart-ROI-file.txt
Last active
December 14, 2015 00:18
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| chr7 109521280 109521409 SNORA3_1 | |
| chr11 6619808 6619940 SNORA5_2 | |
| chr19 8725594 8725660 SNORD31_3 | |
| chr19 8725341 8725409 SNORD30_4 | |
| chr4 3835079 3835146 snoU54_5 | |
| chr7 111076060 111076227 snoU97_6 | |
| chr15 32241853 32241923 SNORD123_7 | |
| chr19 8725866 8725991 Snord22_8 | |
| chr11 6620319 6620454 Snora5c_9 | |
| chr19 8725092 8725156 SNORD29_10 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >scaffold46 3.1 | |
| TTCAGTGACATCACCCTCTAAAGAATTCTCTCCCACCGATAAATTCTCCAACTTTGATAGGAGTAGGATGCTCTCGGGTA | |
| TCTTGCCAGTAATTTGGTTATAAGATATGTTCAATATCCTTAATGTGTGTCTGGTGCACCATNNNNNNNNNNNNNNNNNN | |
| NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | |
| NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | |
| NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | |
| NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | |
| NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | |
| NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | |
| NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN |