This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: As needful in our loves, fitting our duty? | |
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: And with no less nobility of love | |
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: Ham. For God's love let me hear! | |
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: I will requite your loves. So, fare you well. | |
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: Ham. Your loves, as mine to you. Farewell. | |
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: Grows wide withal. Perhaps he loves you now, | |
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: Whereof he is the head. Then if he says he loves you, | |
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: Oph. My lord, he hath importun'd me with love | |
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: If thou didst ever thy dear father love- | |
| Shakespeare/THE TRAGEDY OF HAMLET, PRINCE OF DENMARK.txt: As meditation or the thoughts of lo |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ( | |
| sequence1:0.01334, | |
| sequence2:0.03947, | |
| sequence3:0.18597); |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| CLUSTAL 2.1 multiple sequence alignment | |
| sequence1 ----GTGTCTACTCAATCCAATCGTAATGCGCTCGTAGTGGCGCAACTGAAAGGAGACTT | |
| sequence2 ATGAGCGAC-ACCCAAGCAAACCGTAATGCGCTAATCATCGCGCAGCTTAAGGGCGACTT | |
| sequence3 ----GTGTCTACTCAATCCAATCGTAATGCGCTCGTAGTGGCGCAACTGAAAGGAGACTT | |
| * * * ** *** * ** *********** * * ***** ** ** ** ***** | |
| sequence1 CGTGGCGTTCCTGTTCGTCTTATGGAAGGCGTTAAATCTTCCGGTGCCAACTAAGTGCCA | |
| sequence2 TGTGGCCTTCCTGTTCGTATTGTGGAAGGCTTTGGCTCTCCCGCCACCGACTAAGTGTCA |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| 1 CHILDE HAROLD'S PILGRIMAGE | |
| 2 | |
| 3 By Lord Byron | |
| 4 | |
| 5 List of Contents | |
| 6 | |
| 7 To Ianthe | |
| 8 Canto the First | |
| 9 Canto the Second | |
| 10 Canto the Third |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| 1 CHILDE HAROLD'S PILGRIMAGE | |
| 2 | |
| 3 By Lord Byron | |
| 4 | |
| 5 List of Contents | |
| 6 | |
| 7 To Ianthe | |
| 8 Canto the First | |
| 9 Canto the Second | |
| 10 Canto the Third |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| XXXA XXXB XXXC | |
| 172.28.16.0/23 1 | |
| 10.57.0.0/26 1 | |
| 192.168.1.0/24 1 | |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| # Stop all containers | |
| containers=`docker ps -a -q` | |
| if [ -n "$containers" ] ; then | |
| docker stop $containers | |
| fi | |
| # Delete all containers | |
| containers=`docker ps -a -q` | |
| if [ -n "$containers" ]; then | |
| docker rm -f -v $containers |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <body style="margin : 0px; overflow: hidden;"> | |
| <script src="https://aframe.io/releases/1.0.0/aframe.min.js"></script> | |
| <!-- we import arjs version without NFT but with marker + location based support --> | |
| <script src="https://raw.githack.com/AR-js-org/AR.js/master/aframe/build/aframe-ar.js"></script> <a-scene embedded arjs> | |
| <a-marker preset="hiro"> | |
| <a-entity | |
| position="0 -1 0" | |
| scale="0.05 0.05 0.05" | |
| gltf-model="https://arjs-cors-proxy.herokuapp.com/https://raw.githack.com/AR-js-org/AR.js/master/aframe/examples/image-tracking/nft/trex/scene.gltf" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <body style="margin : 0px; overflow: hidden;"> | |
| <script src="https://aframe.io/releases/1.0.0/aframe.min.js"></script> | |
| <!-- we import arjs version without NFT but with marker + location based support --> | |
| <script src="https://raw.githack.com/AR-js-org/AR.js/master/aframe/build/aframe-ar.js"></script> <a-scene embedded arjs> | |
| <a-marker preset="hiro"> | |
| <a-entity | |
| position="0 -1 0" | |
| scale="0.05 0.05 0.05" | |
| gltf-model="https://arjs-cors-proxy.herokuapp.com/https://raw.githubusercontent.com/KhronosGroup/glTF-Sample-Models/master/2.0/Fox/glTF/Fox.gltf" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ymaps.ready(function () { | |
| var myMap = new ymaps.Map('map', { | |
| center: [55.751574, 37.573856], | |
| zoom: 9 | |
| }, { | |
| searchControlProvider: 'yandex#search' | |
| }), | |
| // Создаём макет содержимого. | |
| MyIconContentLayout = ymaps.templateLayoutFactory.createClass( |
OlderNewer