Skip to content

Instantly share code, notes, and snippets.

View 100ideas's full-sized avatar

Mac Cowell 100ideas

34 followers · 23 following
View GitHub Profile
@100ideas
100ideas / arduino_osx_servo_tuio.pde
Created May 19, 2010 00:32
import processing.serial.*;
import cc.arduino.*;
import TUIO.*;
Arduino arduino;
int servoX = 9;
int servoY = 11;
int mapX = 0;
int mapY = 0;
@100ideas
100ideas / cofactor-visitator.rb
Created October 22, 2010 21:11
use watir-webdriver to script firefix to visit a page
#!/usr/bin/env ruby
# How does webdriver work?
# http://wiki.openqa.org/display/WTR/Selection+Boxes
# http://jarib.github.com/watir-webdriver/doc/#
# http://github.com/jarib/watir-webdriver/wiki/FAQ
require 'rubygems'
require 'watir-webdriver'
require 'watir-webdriver/extensions/wait'
@100ideas
100ideas / breadboard-thermocycler-v0_1
Created April 13, 2011 22:50
thermocycles an IRF510 power-MOSFET in a TO-220 package for PCR; from FutureLabCamp-NYC 2011
/*
// This is a basic arduino program to control a PCR thermocycler
// made from a TO-220 IC, such as an IRF510 power-MOSFET. More
// information: http://futurelabcamp.com/2011/nyc-projects
//
// code by Marc Guell and Mac Cowell at FutureLabCamp-NYC 2011
//
// Adapted from "Blink Without Delay" by David A. Mellis
// http://www.arduino.cc/en/Tutorial/BlinkWithoutDelay
*/
@100ideas
100ideas / AF9849-Aaron_TAS2R_test-rs713598_For_A12.fasta
Created May 3, 2011 21:31
waaronw's sequencing results for TAS2R38 SNP rs713598
>AF9849-Aaron_TAS2R_test-rs713598_For_A12.ab1
NNNNNNNNNNNCNTGTCTCNTGTGCCTTCCCAGGGAGACAGTCAGCATCCCAGAAGAAACCAGAAACAATAGGAAAGGAG
GCACAGACCACAGATAGCAGAAGAGAAAGGAATAAAATAAATTGAGATCTTTAATCTGCCAGTTGAGCCTTGTATTGTTA
TTCATGAATAGCACAGTTGTGACTGTGAAGTGAGGTCTGCTAAAAAAGCACCAAACACAGAGGACAGTGCAGATGCAGGA
GCAAAGAATAATACCCAGGAGCATCTGGGAGATCTTCCTGGAGACCCAGCTTGCCAAGCAGATCAGGAAGGTGTGAGAGA
AACGGATGAGCTTGGAGCAGTAAAGCAGGCTGAGGCAGGCAGCAAGCCAGAGGTTGGCTTGGTTTGCAATCATCCATAGC
ATGATGATGGCTTGGTAGCTGTGGTTCAGTGGTTCACTCAACTTCTGGAAGTGGGTAAGCTGGATAGCACTCAGGAACAG
CAGTCCATGCAGGAAAAGCCGGCTGATGCTGAGACACAGCAGCACACAATCACTGTTGCTCAGTGCCTGCCTCTTCACTA
CATCCCAAAAATTCACCAAGAAAACGAAGGCATTGGTCAGAAACCCCACTGCAAACTCCAGGACTGAAATGAACAGAAAT
GTACTCCTGACTTCATAGGACACAGTGCGGATGCGAGTTAGAGTCAACATGATGTCACTTCTCTAATTGGCTATTCTACT
@100ideas
100ideas / ComponentLib_Thermistor2.pde
Created August 2, 2011 03:17
Mystery Thermistor A B C coefficients (Steinhart-hart model)
/*
* http://arduino.cc/playground/ComponentLib/Thermistor2
*
* Inputs ADC Value from Thermistor and outputs Temperature in Celsius
* requires: include <math.h>
* Utilizes the Steinhart-Hart Thermistor Equation:
* Temperature in Kelvin = 1 / {A + B[ln(R)] + C[ln(R)]3}
* where A = 0.001129148, B = 0.000234125 and C = 8.76741E-08
*
* These coefficients seem to work fairly universally, which is a bit of a
@100ideas
100ideas / CyclerCan_hairdryer.pde
Created August 2, 2011 13:11
CyclerCan PCR program for Arduino, updated for hairdryer thermocycler
/*
Generalised Finite-State Thermal Cycler Code
by Cathal Garvey - [email protected], @onetruecathal
Designed for CyclerCan, a project that will be hosted at www.indiebiotech.com
Inspired heavily by the Lightbulb PCR Machine from Russel Durret: http://russelldurrett.com/lightbulbpcr.html
All original code presented before is co-licensed under the LGPL Lesser GNU Public License and
a Creative Commons Attribution, Sharealike license. Attribution is preferentially directed towards
"Cathal Garvey, Indiebiotech.com".
@100ideas
100ideas / PersonalPCR v1 Bill of Materials
Last active September 28, 2015 01:08
PersonalPCR-v1 Source: BOM, firmware, PCB files. https://web.archive.org/web/20120118133606/http://cofactorbio.com/personalpcr
Project:,PersonalPCR,,,,,,,
Circuit Board Components,,,,,,,,
Part,Description,Value,Package,#,Manufact.,Man PN,Vendor,Vend PN
"R1,R2,R3,R4,R5",Resistor,2000 Ohm,1206,3,,,Digikey,P2.00KFCT-ND
"A0,A1,A2,A3,A4",Thermistor,2000 Ohm,Leaded,3,,,Digikey,495-2144-ND
"R6,R7,R8",Resistor,240 Ohm,1206,2,,,Digikey,311-240ERCT-ND
"R11,R14,R17",Heater Resistor,12 Ohm,TH,1,Yageo,,Digikey,12W-5-ND
C1,Capacitor,10 uF,5x2mm TH,1,Panasonic,ECA-1CM101,Digikey,P5138-ND
--,Header,--,6 pin,2,3M,961106-6404-AR,Digikey,3M9451-ND
--,Header,--,8 pin,2,3M,961108-6404-AR,Digikey,3M9452-ND
@100ideas
100ideas / diybio.opml
Created February 14, 2012 22:19
diybio blogs opml
<?xml version="1.0"?>
<opml version="1.1">
<head>
<title>diybio</title>
<dateCreated>Feb 14 2012 22:20:33 GMT</dateCreated>
<dateModified>Feb 14 2012 22:22:13 GMT</dateModified>
<ownerName>diy bio</ownerName>
<ownerEmail>contact [at] diybio.org</ownerEmail>
</head>
<body>
@100ideas
100ideas / index.html
Last active December 10, 2015 22:08 — forked from sam1vp/index.html
prototype of @brewlabsf sensor dashboard
<!DOCTYPE html>
<head>
<!-- <link href="../src/nv.d3.css" rel="stylesheet" type="text/css"> -->
<script src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.3/jquery.min.js"></script>
<style>
<!DOCTYPE html>
@100ideas
100ideas / kickstarter_backer_poller.js
Created April 8, 2013 19:06
Javascript function to play a noise every time someone backs a particular kickstarter project. Works with the Kickstarter Status Board [1]. Paste code into the console when viewing the board and crank your speakers. Code by Jesse Farmer (https://github.com/jfarmer). [1]https://chrome.google.com/webstore/detail/kickstarter-status-board/pbbbkenlhf…
var BackerPoller = function() {
this.currentCount = this.scanCount();
this.audioElement = document.createElement('audio');
this.audioElement.setAttribute('src', 'https://dl.dropbox.com/u/3736314/kickstarter_backer_poller/kickbacker.wav');
}
BackerPoller.prototype.scanCount = function() {
return $('.project-stats li:nth-child(3)').text().match(/\d+/)[0];
}