Created
September 10, 2013 17:26
-
-
Save BenLangmead/6512698 to your computer and use it in GitHub Desktop.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"metadata": { | |
"name": "CG_001_StringBasics1" | |
}, | |
"nbformat": 3, | |
"nbformat_minor": 0, | |
"worksheets": [ | |
{ | |
"cells": [ | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "'A'", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 1, | |
"text": "'A'" | |
} | |
], | |
"prompt_number": 1 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "'ACGT'", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 2, | |
"text": "'ACGT'" | |
} | |
], | |
"prompt_number": 2 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st = 'ACGT'", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [], | |
"prompt_number": 3 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "len(st) # getting the length of a string", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 6, | |
"text": "4" | |
} | |
], | |
"prompt_number": 6 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "'' # empty string (epsilon)", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 24, | |
"text": "''" | |
} | |
], | |
"prompt_number": 24 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "len('')", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 25, | |
"text": "0" | |
} | |
], | |
"prompt_number": 25 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "import random\nrandom.choice('ACGT') # generating a random nucleotide", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 7, | |
"text": "'T'" | |
} | |
], | |
"prompt_number": 7 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "random.choice('ACGT') # repeated invocations might yield different nucleotides", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 8, | |
"text": "'G'" | |
} | |
], | |
"prompt_number": 8 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "random.choice('ACGT') # repeated invocations might yield different nucleotides", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 9, | |
"text": "'G'" | |
} | |
], | |
"prompt_number": 9 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "random.choice('ACGT') # repeated invocations might yield different nucleotides", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 10, | |
"text": "'G'" | |
} | |
], | |
"prompt_number": 10 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "random.choice('ACGT') # repeated invocations might yield different nucleotides", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 11, | |
"text": "'C'" | |
} | |
], | |
"prompt_number": 11 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "# now I'll make a random nucleotide string by concatenating random nucleotides\nst = ''.join([random.choice('ACGT') for _ in xrange(40)])\nst", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 13, | |
"text": "'CTACATACGACAAGTCTTCGAAAGAGCCTATCAATTGCTC'" | |
} | |
], | |
"prompt_number": 13 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st[1:3] # substring, starting at position 1 and extending up to but not including position 3\n# note that the first position is numbered 0", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 15, | |
"text": "'TA'" | |
} | |
], | |
"prompt_number": 15 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st[0:3] # prefix of length 3", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 16, | |
"text": "'CTA'" | |
} | |
], | |
"prompt_number": 16 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st[:3] # another way of getting the prefix of length 3", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 17, | |
"text": "'CTA'" | |
} | |
], | |
"prompt_number": 17 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st[len(st)-3:len(st)] # suffix of length 3", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 18, | |
"text": "'CTC'" | |
} | |
], | |
"prompt_number": 18 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st[-3:] # another way of getting the suffix of length 3", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 19, | |
"text": "'CTC'" | |
} | |
], | |
"prompt_number": 19 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st1, st2 = 'CAT', 'ATAC'", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [], | |
"prompt_number": 20 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st1", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 21, | |
"text": "'CAT'" | |
} | |
], | |
"prompt_number": 21 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st2", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 22, | |
"text": "'ATAC'" | |
} | |
], | |
"prompt_number": 22 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "st1 + st2 # concatenation of 2 strings", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [ | |
{ | |
"output_type": "pyout", | |
"prompt_number": 23, | |
"text": "'CATATAC'" | |
} | |
], | |
"prompt_number": 23 | |
}, | |
{ | |
"cell_type": "code", | |
"collapsed": false, | |
"input": "", | |
"language": "python", | |
"metadata": {}, | |
"outputs": [] | |
} | |
], | |
"metadata": {} | |
} | |
] | |
} |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment