Snippet for translating DNA to amino acid sequences, trying to use the most Perl6ish looking code.

DNASequence.pm

use v6;

class BioInfo::Sequence {
    has Str $.seq;
    has Str @.residues;

    submethod BUILD (Str :$seq, Str :@residues) {
        die X::BioInfo::UnknownResidue.new(seq => $seq, residues => @residues);
        $!seq := $seq;
        @!residues := @residues;
    }

}

class BioInfo::NucleotideSequence is BioInfo::Sequence {

    method translate (:$table='standard') {
        #Get all the combinations of bases that map to the @aminos ordering
        #my @codons = map *~*~*, (@!bases X @!bases X @!bases);
        my @codons = [X~] @.residues.item xx 3;
        #Translation table
        #TODO add in the weirdy beardy translation tables
        my %aminos = {standard => <F F L L S S S S
                                   Y Y * * C C * W
                                   L L L L P P P P
                                   H H Q Q R R R R
                                   I I I M T T T T
                                   N N K K S S R R
                                   V V V V A A A A
                                   D D E E G G G G>};
        #Create a map of the codons to amino acids
        my %codon_table = zip @codons, %aminos{$table};

        #Take all of the codons mapped to aminos and join them together
        return %codon_table{map *~*~*, $.seq.uc.comb}.join;
    }

}

class BioInfo::DNASequence is BioInfo::NucleotideSequence {
    has Str @.residues = ('T','C','A','G');
}

class BioInfo::RNASequence is BioInfo::NucleotideSequence {
    has Str @.residues = ('U','C','A','G');
}

class X::BioInfo::UnknownResidue is Exception {
    has Str $!seq;
    has Str @!residues;

    method message {
        return "Valid residue " ~ @!residues ~ " was not recognised in " ~ $!seq;
    }
}

my $dna = BioInfo::DNASequence.new(seq => 'GTCATAGTCATAGTCATAGTCATA');
my $rna = BioInfo::DNASequence.new(seq => 'GUCAUAGUCAUAGUCAUAGUCAUA');
say $dna.translate;
say $rna.translate;

return %codon_table{map *~*~*, $!seq.uc.comb}.join