Created
November 3, 2013 00:37
-
-
Save Puriney/7285136 to your computer and use it in GitHub Desktop.
R: HMM
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ## Demo for HMM | |
| ## Reproduce "What is HMM", Sean R Eddy, Nature Biotechnology 2004 | |
| S <- c(0,1,rep(0,3)) | |
| E <- c(0, 0.9, 0.1, 0, 0) | |
| SS5 <- c(rep(0,3), 1, 0) | |
| I <- c(rep(0,3), 0.9, 0.1) | |
| N <- c(rep(0,4), 1) | |
| myTransMtx <- rbind(S,E, SS5, I, N) | |
| colnames(myTransMtx) <- rownames(myTransMtx) | |
| myTransMtx | |
| S <- rep(0,4) | |
| E <- rep(1/4, 4) | |
| SS5 <- c(0.05, 0, 0.95, 0) | |
| I <- c(0.4, 0.1, 0.1, 0.4) | |
| N <- c(rep(0, 4)) | |
| myEmisMtx <- rbind(S,E, SS5, I, N) | |
| colnames(myEmisMtx) <- c("A", "C", "G", "T") | |
| myEmisMtx | |
| mySeq <- "CTTCATGTGAAAGCAGACGTAAGTCA" | |
| myPath <- "EEEEEEEEEEEEEEEEEE5IIIIIII" | |
| computeProb <- function(obsSeq, imgPath, transMtx, emisMtx, log=TRUE){ | |
| obsSeq <- unlist(strsplit(toupper(obsSeq), "")) | |
| imgPath <- unlist(strsplit(imgPath, "")) | |
| imgPath[imgPath=="5"] <- "SS5" | |
| ## Previous is Start State | |
| prob <- transMtx["S", imgPath[1]] * emisMtx[imgPath[1], obsSeq[1]] | |
| for (i in 2:length(obsSeq)){ | |
| state_i <- imgPath[i] | |
| nucleotide_i <- obsSeq[i] | |
| prob_i <- transMtx[imgPath[i-1],state_i] * emisMtx[imgPath[i],nucleotide_i] | |
| prob <- prob * prob_i | |
| } | |
| ## End State | |
| prob <- prob * transMtx[imgPath[length(imgPath)],"N"] | |
| if (log){ | |
| return (log2(prob)/log2(exp(1))) ## Why use e ?! Sean Eddy!!! | |
| } else { | |
| return (prob) | |
| } | |
| } | |
| giveMeMore <- function(obsSeq, transMtx, emisMtx ){ | |
| sumProb <- 0 | |
| allPath <- NULL | |
| allProb <- NULL | |
| print ("All State Path with non-zero Probability: ") | |
| for (i in 1:24) { | |
| path_i <- c(rep("E", i), "5", rep("I", 25-i)) | |
| path_i <- paste(path_i, collapse="") | |
| allPath[i] <- path_i | |
| p <- computeProb(obsSeq, path_i,transMtx, emisMtx,log=FALSE) | |
| allProb[i] <- p | |
| if (p != 0){ | |
| print (path_i) | |
| print (p) | |
| sumProb <- sumProb + p | |
| } | |
| } | |
| maxProb <- max(allProb, na.rm=TRUE) | |
| max <- which(allProb == maxProb) | |
| cat ("Best State Path and original Sequence", "\n") | |
| cat (allPath[max], "\n") | |
| cat (obsSeq,"\n") | |
| cat (paste("Maximum Probability: ", maxProb, sep=""),"\n") | |
| cat (paste("Maximum Prob (log): ", log2(maxProb)/log2(exp(1)), sep=""),"\n") | |
| cat (paste("Posterior Decoding: ", maxProb/sumProb, sep=""),"\n") | |
| return (allPath[max]) | |
| } | |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment