Counting nucleotides from a sequence

count_nucleotides.py

def count_nucleotides_by_type(sequence):
  # use a dictionary to keep track of the counts of each nucleotide type in the sequence
  counts = {
    "A": 0,
    "C": 0,
    "G": 0,
    "T": 0,
    "length": 0
  }

  for nucleotide in sequence:
    # we iterate through the sequence once
    counts[nucleotide] += 1
    # for each type, we incriment that count by one
    counts["length"] += 1
    # then we incriment the total count by one too
  
  # there are several ways we could get the 'counts["length"]'
  # here we're counting as we go
  # we could also just add up the other counts 'counts["length"] = counts["A"] + counts["C"] +  counts["G"] + counts["T"]
  # either way is fine, the second way is technically more efficient
  
  return counts

def normalize_nucleotide_count(counts):
  # we compute the percentages by dividing the individual nucleotide counts by the total count
  percentages = {
    "A": counts["A"] / float(counts["length"]),
    "C": counts["C"] / float(counts["length"]),
    "G": counts["G"] / float(counts["length"]),
    "T": counts["T"] / float(counts["length"])
  }
  return percentages



sequence = "GATGTTCAGCTGAAGTGGAGTAAAGAGTTGCAGCA"

# count the nucleotides
counts = count_nucleotides_by_type(sequence)
# calculate percentages using the counts
percentages = normalize_nucleotide_count(counts)


# to get the percent of both G and C, we add up their percentages
G_and_C_percent = percentages["G"] + percentages["C"]

print "G and C make up %f percent of the sequence" % G_and_C_percent