Skip to content

Instantly share code, notes, and snippets.

@SoxFace
Forked from ga-wolf/readme.md
Last active August 29, 2015 14:16
Show Gist options
  • Save SoxFace/ea2a3d986f3dee0cc8d8 to your computer and use it in GitHub Desktop.
Save SoxFace/ea2a3d986f3dee0cc8d8 to your computer and use it in GitHub Desktop.

Nucleotide Count

DNA is represented by an alphabet of the following symbols: 'A', 'C', 'G', and 'T'.

Each symbol represents a nucleotide, which is a fancy name for the particular molecules that happen to make up a large part of DNA.

Shortest intro to biochemistry EVAR:

  • twigs are to birds nests as
  • nucleotides are to DNA and RNA as
  • amino acids are to proteins as
  • sugar is to starch as
  • oh crap lipids

I'm not going to talk about lipids because they're crazy complex.

So back to DNA.

Write a class DNA that takes a DNA string. It should have two ways of telling us how many times each nucleotide occurs in the string: #count(nucleotide) and #nucleotide_count.

dna = DNA.new("ATGCTTCAGAAAGGTCTTACG")

dna.count('A')
# => 6

dna.count('T')
# => 6

dna.count('G')
# => 5

dna.count('C')
# => 4

dna.count('U') # Uracil is a nucleotide that is used in RNA
# => 0

dna.nucleotide_counts
# => {'A' => 6, 'T' => 6, 'G' => 5, 'C' => 4}

The code should raise an argument error if you try to count something that isn't a nucleotide.

dna.count('S')
# dna.rb:23:in 'count': That's not a nucleotide, silly! (ArgumentError)

Sample Dataset

s = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
dna = DNA.new(s)
dna.nucleotide_counts
# => {'A' => 20, 'T' => 21, 'G' => 17, 'C' => 12}

Source

The Calculating DNA Nucleotides problem at Rosalind

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment