Skip to content

Instantly share code, notes, and snippets.

@Vaguery
Created August 16, 2010 19:29
Show Gist options
  • Select an option

  • Save Vaguery/527578 to your computer and use it in GitHub Desktop.

Select an option

Save Vaguery/527578 to your computer and use it in GitHub Desktop.
block {
value «code»
value «int»
value «matrix»
value «dna»
value «uri»}
«code» value «int»
«int» -1
«int» 1000
«matrix» [[1,2],[3,4]]
«dna» ATGTGATCAATATGCGGCTTAAACCGCTTAA
«uri» https://127.0.0.1:9182/foo/bar_baz
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment