Created
October 31, 2011 10:20
-
-
Save allen501pc/1327234 to your computer and use it in GitHub Desktop.
Find string from stream
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| /* Program: Find the character substring location of the input character string. | |
| * Author: Jyun-Yao Huang (allen501pc@gmail.com) | |
| * License: Free | |
| */ | |
| #include <iostream> | |
| #include <bitset> | |
| #include <string> | |
| #include <set> | |
| #include <vector> | |
| #include <cstring> | |
| #include <algorithm> | |
| #include <map> | |
| using namespace std; | |
| /* ***** Definition ***** */ | |
| #define _SIZE_OF_PATTERN_ 6 | |
| #define _NUM_OF_ALPHABETS_ 4 | |
| /* ***** End ***** */ | |
| /* Members */ | |
| map<char,size_t> m_mapInputAlphabet_; | |
| /* ***** End ***** */ | |
| bool fnCompareBitMap(const vector<bitset<_SIZE_OF_PATTERN_> > & vecList1, const vector<bitset<_SIZE_OF_PATTERN_> > & vecList2) | |
| { | |
| bool bCheck = true; | |
| size_t nSize = vecList1.size(); | |
| if(nSize != vecList2.size()) | |
| return false; | |
| vector<bitset<_SIZE_OF_PATTERN_> >::const_iterator it1=vecList1.begin(); | |
| vector<bitset<_SIZE_OF_PATTERN_> >::const_iterator it2=vecList2.begin(); | |
| for(size_t nIdx=0; bCheck && nIdx < nSize; ++nIdx) | |
| { | |
| bCheck = bCheck && (*it1 == *it2); | |
| ++it1; | |
| ++it2; | |
| } | |
| return bCheck; | |
| } | |
| //void fnLoadInputAlphabet(char * ptrcInput, size_t nSize) | |
| void fnLoadInputAlphabet(const string & strInput) | |
| { | |
| for(string::const_iterator it=strInput.begin(); it!=strInput.end(); ++it) | |
| { | |
| size_t nMax=m_mapInputAlphabet_.size(); | |
| m_mapInputAlphabet_.insert(pair<char,size_t>(*it,nMax)); | |
| } | |
| } | |
| //@Function: bool fnEndOfCharString(char &) | |
| //@Brief: check the input character is the end of charstring. | |
| //@Input: reference type character. | |
| //@Output: True for success, or false. | |
| bool fnIsEndOfCharString(const char & cTarget) | |
| { | |
| return cTarget=='\0'; | |
| } | |
| //@Function: void fnShowBitsetInfo( vector<bitset<_SIZE_OF_PATTERN_> > & ) | |
| //@Brief: show the information of input bitset vector | |
| //@Input: reference type vector<bitset<_SIZE_OF_PATTERN_> > | |
| //@Output: the information of input | |
| void fnShowBitsetInfo( vector<bitset<_SIZE_OF_PATTERN_> > & source) | |
| { | |
| for(size_t nIdx=0; nIdx <4; ++ nIdx) | |
| { | |
| cout << source[nIdx] << endl; | |
| } | |
| } | |
| //@Function: void fnSetBitListViaSettedAlphabet(char & cInput, vector<bitset<_SIZE_OF_PATTERN_> > & bitsetTarget, int nLocation) | |
| //@Brief: Set bit-list using input character with corresponding location | |
| //@Input: cInput: the wanna found character. | |
| // bitsetTarget: the target list. | |
| // nLocation: the corresponding location. | |
| //@Output: None. | |
| void fnSetBitListViaSettedAlphabet(const char & cInput, vector<bitset<_SIZE_OF_PATTERN_> > & bitsetTarget, size_t nLocation) | |
| { | |
| bitsetTarget[m_mapInputAlphabet_.find(cInput)->second].set(nLocation); | |
| } | |
| int main(int argc, char * argv[]) | |
| { | |
| string strTargetPattern("ACGTAT"); // Done. | |
| string strInputString("AATACTGTAAACGACTGACAGATACCATTCAGACGTATCATGA"); // Done. | |
| set<char> setAlphabet; | |
| // Assume that there are 4 alphabets. | |
| vector<bitset<_SIZE_OF_PATTERN_> > vecBitSetList(_NUM_OF_ALPHABETS_); | |
| // Compared Sample Pattern. | |
| vector<bitset<_SIZE_OF_PATTERN_> > vecSampleList(_NUM_OF_ALPHABETS_); | |
| // Load BitSet characters. | |
| //fnLoadInputAlphabet(sTargetPattern,_SIZE_OF_PATTERN_); | |
| fnLoadInputAlphabet(strTargetPattern); // Done. | |
| // Create BitSetList of Target. | |
| size_t nIdx =0; | |
| for(string::const_iterator it=strTargetPattern.begin(); it!=strTargetPattern.end(); ++ it) | |
| { | |
| fnSetBitListViaSettedAlphabet(*it,vecBitSetList,nIdx++); | |
| } | |
| for(size_t nIdx=0;nIdx<strInputString.size() ; ++ nIdx) | |
| { | |
| if(fnIsEndOfCharString(strInputString[nIdx])) | |
| break; | |
| // Shifting | |
| for(int nTempIdx=0;nTempIdx < _NUM_OF_ALPHABETS_; ++ nTempIdx) | |
| { | |
| vecSampleList[nTempIdx] >>=1; | |
| } | |
| fnSetBitListViaSettedAlphabet(strInputString[nIdx],vecSampleList,strTargetPattern.size()-1); | |
| // Comparing. | |
| if(nIdx>= strTargetPattern.size()-1) | |
| { | |
| if(strInputString[nIdx]==strTargetPattern[strTargetPattern.size()-1]) | |
| { | |
| if(fnCompareBitMap(vecBitSetList,vecSampleList)) | |
| { | |
| cout << "Location:" << nIdx-(strTargetPattern.size()-1) << endl; | |
| return 0; | |
| } | |
| } | |
| } | |
| } | |
| return 0; | |
| } |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment