baobabprince
baobabprince
/ DB32.377_microbiome_data.csv
Created
May 21, 2025 12:44
Microbiome data for sample: DB32.377 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.343355107396526,0.070054830089081,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__[Paraprevotellaceae]"," g__[Prevotella]"," s__",0.087913968679579,0.0396404995358876,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTTTTAAGTCAGTTGTGAAAGTTCACGGCCCAACCGTGAAATTGCAGTTGAAACTGAAAGTCTTGAGTGCACGCAGGGATGCTGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTTTTAAGTCAGTTG |
baobabprince
/ DB32.368_microbiome_data.csv
Created
May 21, 2025 12:41
Microbiome data for sample: DB32.368 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Firmicutes"," c__Clostridia"," o__Clostridiales"," f__Ruminococcaceae"," g__Faecalibacterium"," s__prausnitzii",0.2266690409414,0.0138379672627271,"AACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG","http://dbbact.org/search_results?sequence=AACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG" | |
| "k__Bacteria"," p__Verrucomicrobia"," c__Verrucomicrobiae"," o__Verrucomicrobiales"," f__Verrucomicrobiaceae"," g__Akkermansia"," s__muciniphila",0.0955645580139192,0.0303319822215979,"TACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG","http://dbbact.org/search_results?sequence=TACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCG |
baobabprince
/ DB32.362_microbiome_data.csv
Created
May 21, 2025 12:38
Microbiome data for sample: DB32.362 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.375695461200586,0.0704265582937253,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__[Paraprevotellaceae]"," g__Paraprevotella"," s__",0.125585651537335,0.0110345922111812,"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCTTTTAAGTCAGCGGTCAAATGCCACGGCTCAACCGTGGCCAGCCGTTGAAACTGCAAGCCTTGAGTCTGCACAGGGCACATGGAATTCGTGGT","http://dbbact.org/search_results?sequence=TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCTTTTAAGTCAG |
baobabprince
/ DB32.360_microbiome_data.csv
Created
May 21, 2025 12:35
Microbiome data for sample: DB32.360 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.489169655647828,0.133918645225908,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.0625477967708232,0.0739534132866144,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGAACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGT |
baobabprince
/ DB32.359_microbiome_data.csv
Created
May 21, 2025 12:32
Microbiome data for sample: DB32.359 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Firmicutes"," c__Clostridia"," o__Clostridiales",NA,NA,NA,0.109282422646478,0.00573606434537017,"TACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT","http://dbbact.org/search_results?sequence=TACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT" | |
| "k__Bacteria"," p__Firmicutes"," c__Clostridia"," o__Clostridiales"," f__Veillonellaceae"," g__Dialister"," s__",0.0680899087745697,0.0303459315440914,"TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTTCTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT","http://dbbact.org/search_results?sequence=TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTTCTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAAGCTGGA |
baobabprince
/ DB32.358_microbiome_data.csv
Created
May 21, 2025 12:29
Microbiome data for sample: DB32.358 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.208842636780689,0.0424954350713861,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.0514640229071092,0.0202899992895566,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCAGTCTTGAGTACAGTTGAGGTAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAA |
baobabprince
/ DB32.357_microbiome_data.csv
Created
May 21, 2025 12:26
Microbiome data for sample: DB32.357 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.288055677471942,0.131372898666719,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.159847012351872,0.0677256824987321,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTT |
baobabprince
/ DB32.356_microbiome_data.csv
Created
May 21, 2025 12:23
Microbiome data for sample: DB32.356 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.196998463068439,0.0683725698094478,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__eggerthii",0.135732152005545,0.0211166750320504,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGTGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGCGCCTTGAGTGCAGCATAGGTAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGTGCTTAAGTCAG |
baobabprince
/ DB32.346_microbiome_data.csv
Created
May 21, 2025 12:20
Microbiome data for sample: DB32.346 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Firmicutes"," c__Clostridia"," o__Clostridiales"," f__Ruminococcaceae"," g__"," s__",0.327014352438402,0.0347424376555503,"TACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG","http://dbbact.org/search_results?sequence=TACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.144167312747008,0.0677648993657346,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACC |
baobabprince
/ DB32.323_microbiome_data.csv
Created
May 21, 2025 12:17
Microbiome data for sample: DB32.323 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.159788330160152,0.0679448671323411,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG" | |
| "k__Bacteria"," p__Firmicutes"," c__Clostridia"," o__Clostridiales"," f__Lachnospiraceae"," g__[Ruminococcus]"," s__",0.0996192182775227,0.0028435330378493,"TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG","http://dbbact.org/search_results?sequence=TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAA |
NewerOlder