baobabprince
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # get hebrew date from internet | |
| hebrew.date <- function(){ | |
| api <- httr::GET("https://www.hebcal.com/etc/hdate-he.js") | |
| html <- httr::content(api, as = "text") | |
| heb <- gsub("\\w" , "" , html, perl = T) | |
| gsub("[[:punct:]\n]","" ,heb) | |
| } | |
| hebrew.date() |
baobabprince
/ DB5.002.html
Created
December 21, 2021 15:59
This file has been truncated, but you can view the full file.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <!DOCTYPE html> | |
| <html xmlns="http://www.w3.org/1999/xhtml"><head> | |
| <meta charset="utf-8"> | |
| <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> | |
| <meta name="generator" content="pandoc"> | |
| <meta name="author" content=" Sheba Microbiome Center"> | |
| <meta name="date" content="2021-12-21"> | |
baobabprince
/ hm_for Nina.rmd
Last active
June 27, 2022 13:23
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| --- | |
| title: "heatmap" | |
| author: "Rotem Hadar" | |
| date: "27/06/2022" | |
| output: html_document | |
| --- | |
| ```{r} | |
| library(tidyverse) |
baobabprince
/ hm_for Nina.rmd
Last active
June 27, 2022 14:32
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| --- | |
| title: "heatmap" | |
| author: "Rotem Hadar" | |
| date: "27/06/2022" | |
| output: html_document | |
| --- | |
| ```{r} | |
| library(tidyverse) |
baobabprince
/ log_sensibo.R
Created
July 26, 2022 15:40
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| sensorID = "Your sensibo ID" | |
| apikey = readLines("sensibo.api") | |
| ## commented lines run only once | |
| # file.create("./sensibo.csv") | |
| # data <- jsonlite::fromJSON(url)$result | |
| # write(as.character(names(data)), "./sensibo.csv", sep=",") | |
| url = paste0("https://home.sensibo.com/api/v2/pods/", sensorID, "/measurements?apiKey=", apikey) | |
| while(1 == 1){ | |
| data <- jsonlite::fromJSON(url)$result | |
| text <- paste(as.character(unlist(data)), collapse = ",") |
baobabprince
/ DB14.310_microbiome_data.csv
Created
September 12, 2022 13:03
Microbiome data for sample: DB14.310 . ASV column represent the sequence of specific bacteria. thanthere is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel.
We can make this file beautiful and searchable if this error is corrected: Illegal quoting in line 1.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| [{"ASV":"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","Kingdom":"k__Bacteria","Phyla":" p__Bacteroidetes","Class":" c__Bacteroidia","Order":" o__Bacteroidales","Family":" f__Bacteroidaceae","Genus":" g__Bacteroides","Species":" s__","You":0.148,"Population":0.0408,"link":"http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG"},{"ASV":"TACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTTTGTTAAGTTTGGTGTTAAATGCAGAGGCTCAACTTCTGTTCGGCATCGGATACTGGCAGACTAGAATGCGGTAGAGGTAAAGGGAATTCCTGG","Kingdom":"k__Bacteria","Phyla":" p__Cyanobacteria","Class":" c__4C0d-2","Order":" o__YS2","Family":" f__","Genus":" g__","Species":" s__","You":0.0798,"Population":0.0074,"link":"http://dbbact.org/search_results?sequence=TACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTTTGTTAAGTTT |
baobabprince
/ DB14.310_microbiome_data.csv
Created
September 12, 2022 13:06
Microbiome data for sample: DB14.310 . ASV column represent the sequence of specific bacteria. thanthere is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel.
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "","ASV","Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","link" | |
| "1","TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.14798418972332,0.0408366084237244,"http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG" | |
| "2","TACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTTTGTTAAGTTTGGTGTTAAATGCAGAGGCTCAACTTCTGTTCGGCATCGGATACTGGCAGACTAGAATGCGGTAGAGGTAAAGGGAATTCCTGG","k__Bacteria"," p__Cyanobacteria"," c__4C0d-2"," o__YS2"," f__"," g__"," s__",0.0798418972332016,0.00740522149833383,"http://dbbact.org/search_results?sequence=TACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTTTGTTAAGTTTGGTGTTAAATGCAGAGGCTCAACTTCTGTTCGGCATCG |
baobabprince
/ DB14.310_microbiome_data.csv
Created
September 12, 2022 13:07
Microbiome data for sample: DB14.310 . ASV column represent the sequence of specific bacteria. thanthere is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel.
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "","ASV","Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","link" | |
| "1","TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.14798418972332,0.0408366084237244,"http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG" | |
| "2","TACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTTTGTTAAGTTTGGTGTTAAATGCAGAGGCTCAACTTCTGTTCGGCATCGGATACTGGCAGACTAGAATGCGGTAGAGGTAAAGGGAATTCCTGG","k__Bacteria"," p__Cyanobacteria"," c__4C0d-2"," o__YS2"," f__"," g__"," s__",0.0798418972332016,0.00740522149833383,"http://dbbact.org/search_results?sequence=TACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTTTGTTAAGTTTGGTGTTAAATGCAGAGGCTCAACTTCTGTTCGGCATCG |
baobabprince
/ DB10.071_microbiome_data.csv
Created
September 12, 2022 13:15
Microbiome data for sample: DB10.071 . ASV column represent the sequence of specific bacteria. thanthere is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel.
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "","ASV","Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","link" | |
| "1","TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.17673118865867,0.0646793890123089,"http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG" | |
| "2","TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG","k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides",NA,0.104007633587786,0.0185463269872382,"http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTG |
baobabprince
/ DB10.077_microbiome_data.csv
Created
September 12, 2022 13:23
Microbiome data for sample: DB10.077 . ASV column represent the sequence of specific bacteria. thanthere is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel.
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "","ASV","Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","link" | |
| "1","TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.538720538720539,0.131456045391647,"http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG" | |
| "2","TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.116863075196409,0.0541314022363053,"http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGA |
OlderNewer