Skip to content

Instantly share code, notes, and snippets.

View biocyberman's full-sized avatar

Vang Le biocyberman

  • Novo Nordisk
  • Aalborg, Denmark
  • 14:30 (UTC +02:00)
View GitHub Profile
@zetas
zetas / default.json
Created June 13, 2018 06:00
iTerm2 Byobu Keybind Profile.
{
"Ansi 5 Color" : {
"Green Component" : 0.4117647111415863,
"Blue Component" : 0.78823530673980713,
"Red Component" : 0.55686277151107788
},
"Working Directory" : "\/Users\/david",
"Prompt Before Closing 2" : 0,
"Selected Text Color" : {
"Green Component" : 0.729411780834198,
@joffilyfe
joffilyfe / README.md
Last active April 3, 2023 01:38
GITEA + Drone (0.7|0.8)

Compose file to setup and host a Gitea and Drone environment

This environment is dependent off a common network for docker/git plugin and gitea-server, so for this work fine in closed networks we have to create a custom network before run this composefile.

First create your network:

docker network create gitea-network
diff --git lisp/term/xterm.el lisp/term/xterm.el
index 19eb37a..6298d88 100644
--- lisp/term/xterm.el
+++ lisp/term/xterm.el
@@ -917,6 +917,15 @@ versions of xterm."
;; are more colors to support, compute them now.
(when (> ncolors 0)
(cond
+ ((= (display-color-cells (selected-frame)) 16777216) ; 24-bit xterm
+ (let ((idx (length xterm-standard-colors)))
@Changaco
Changaco / btrfs-undelete
Last active September 13, 2026 15:16
btrfs-undelete
#!/bin/bash
# btrfs-undelete
# Copyright (C) 2013 Jörg Walter <info@syntax-k.de>
# This program is free software; you can redistribute it and/or modify it under
# the term of the GNU General Public License as published by the Free Software
# Foundation; either version 2 of the License, or any later version.
if [ ! -b "$1" -o -z "$2" -o -z "$3" ]; then
echo "Usage: $0 <dev> <file/dir> <dest>" 1>&2
echo
@PirateGrunt
PirateGrunt / Makefile
Created March 28, 2015 01:01
Basic makefile
####################
# Makefile
# Copyright Brian A. Fannin 2015
####################
RDIR = .
DATA_DIR = $(RDIR)/data
GATHER_DIR = $(DATA_DIR)/gather
GATHER_SOURCE = $(wildcard $(GATHER_DIR)/*.Rmd)
@mtw
mtw / bam2fastq_cutadapt.sh
Last active February 7, 2017 22:56
Raw NGS data is often shipped as unaligned BAM files. This shell script converts raw reads to FASTQ format and trims Illumina adapters with cutadapt. Quality Control is performed with FastQC.
#!/bin/bash
cutadapt=`which cutadapt`
fastqc=`which fastqc`
bam2fastq=`which bam2fastq`
gzip=`which gzip`
origdir="."
results="cutadapt"
fastqcdir="${results}/FastQC"
adapter5="CTACACTCTTTCCCTACACGACGCTCTTCCGATCT"
@evgenius
evgenius / onchange.sh
Last active December 15, 2018 22:17 — forked from senko/onchange.sh
#!/bin/bash
#
# Watch current directory (recursively) for file changes, and execute
# a command when a file or directory is created, modified or deleted.
#
# Written by: Senko Rasic <senko.rasic@dobarkod.hr>
#
# Requires Linux, bash and inotifywait (from inotify-tools package).
#
# To avoid executing the command multiple times when a sequence of
@melpomene
melpomene / wordcollector.py
Created October 11, 2011 11:33
Wordlist generating script that parses websites for words.
#!/usr/bin/env python2.7
''' Creates wordlists from web scraping. BeautifulSoup requierd (pip install beautifulsoup) '''
import sys
import os
import robotparser
from BeautifulSoup import BeautifulSoup as bs
import urllib2
from urlparse import urlparse
@lindenb
lindenb / bam2wig.c
Created February 15, 2011 15:59
Transforms a BAM file to WIG
/*
Author:
Pierre Lindenbaum PhD
WWW:
http://plindenbaum.blogspot.com
contact:
plindenbaum@yahoo.fr
Motivation:
creates a WIG file from a BAM file