Created
July 5, 2021 12:09
-
-
Save cgpu/5067a3a870ceb7f4f8abaec9e5e89c2b to your computer and use it in GitHub Desktop.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
[ | |
{ | |
"acmg_annotation.classifications.user_explain": [ | |
"Null variant (frame-shift), in gene FOXO6, for which loss-of-function is a known mechanism of disease (gnomAD Loss-of-Function Observed/Expected = 0.213 is less than 0.763).", | |
"Variant not found in gnomAD exomes (unable to check gnomAD exomes coverage).", | |
"Pathogenic computational verdict based on 1 pathogenic prediction from phyloP vs no benign predictions." | |
], | |
"acmg_annotation.coding_impact": "frameshift", | |
"acmg_annotation.gene_id": 8339, | |
"acmg_annotation.gene_symbol": "FOXO6", | |
"acmg_annotation.verdict.ACMG_rules.approx_score": 80, | |
"acmg_annotation.verdict.ACMG_rules.benign_subscore": "Uncertain Significance", | |
"acmg_annotation.verdict.ACMG_rules.pathogenic_subscore": "Pathogenic", | |
"acmg_annotation.verdict.ACMG_rules.verdict": "Pathogenic", | |
"acmg_annotation.version_name": "9.4.6", | |
"Allelic balance": 0.918918918918919, | |
"all1": "GGCCCGCGCCGGGACGCCCGCCTACTTCGGCGGCTGCAAGGGCGGCGCCTACGGCGGGGGCGGGGGCTTCGGGCCGCCGGCGATGGGCGCTCTGCGCCGTCTGCCCATGCAGACCATCCAGGAGAACAAGCAGGCCAGCTTCGTGCCGGCCGCGGCGCCCTTCCGCCCTGGGGCGCTGCCCGCGCTGCTGCCGCCGCCGCC", | |
"all2": "CTT", | |
"alt": "C", | |
"amp_annotation.classifications": {}, | |
"amp_annotation.classifications.name": {}, | |
"amp_annotation.classifications.tier": {}, | |
"amp_annotation.classifications.user_explain.Tier I": {}, | |
"amp_annotation.classifications.user_explain.Tier II": {}, | |
"amp_annotation.classifications.user_explain.Tier III": {}, | |
"amp_annotation.classifications.user_explain.Tier IV": {}, | |
"amp_annotation.verdict": {}, | |
"amp_annotation.verdict.approx_score": {}, | |
"amp_annotation.verdict.tier": {}, | |
"amp_annotation.version_name": {}, | |
"cadd.cadd_score": {}, | |
"cancer_hotspots.biotype": {}, | |
"cancer_hotspots.cancer_name.key": {}, | |
"cancer_hotspots.canonical": {}, | |
"cancer_hotspots.total_samples": {}, | |
"cbio": {}, | |
"cbio_portal.ajcc_pathologic_tumor_stage.key": {}, | |
"cbio_portal.cancer_name.key": {}, | |
"cbio_portal.canonical": {}, | |
"cbio_portal.grade": {}, | |
"cbio_portal.hotspot": {}, | |
"chromosome": "chr5", | |
"Coverage": 37, | |
"cytobands": "1p34.2", | |
"dbnsfp_dbscsnv": {}, | |
"dbnsfp.aloft_confidence": {}, | |
"dbnsfp.aloft_pred": {}, | |
"dbnsfp.aloft_prob_dominant": {}, | |
"dbnsfp.aloft_prob_recessive": {}, | |
"dbnsfp.aloft_prob_tolerant": {}, | |
"dbnsfp.cadd_phred": {}, | |
"dbnsfp.cadd_raw": {}, | |
"dbnsfp.cadd_raw_rankscore": {}, | |
"dbnsfp.deogen2_pred": {}, | |
"dbnsfp.ensembl_proteinid": {}, | |
"dbnsfp.ensembl_transcriptid": {}, | |
"dbnsfp.fathmm_mkl_coding_pred": {}, | |
"dbnsfp.fathmm_pred": {}, | |
"dbnsfp.lrt_pred": {}, | |
"dbnsfp.metalr_pred": {}, | |
"dbnsfp.metasvm_pred": {}, | |
"dbnsfp.mutationassessor_pred": {}, | |
"dbnsfp.mutationtaster_pred": {}, | |
"dbnsfp.mutpred_score": {}, | |
"dbnsfp.phastcons100way_vertebrate": {}, | |
"dbnsfp.phastcons100way_vertebrate_rankscore": {}, | |
"dbnsfp.phylop100way_vertebrate": {}, | |
"dbnsfp.phylop100way_vertebrate_rankscore": {}, | |
"dbnsfp.polyphen2_hdiv_pred": {}, | |
"dbnsfp.polyphen2_hvar_pred": {}, | |
"dbnsfp.primateai_pred": {}, | |
"dbnsfp.provean_pred": {}, | |
"dbnsfp.revel_score": {}, | |
"dbnsfp.sift_pred": {}, | |
"dbnsfp.sift4g_pred": {}, | |
"ensembl_transcripts": { | |
"items": [ | |
{ | |
"canonical": true, | |
"coding_impact": "frameshift", | |
"coding_location": "336 of 492", | |
"ensembl_support_level": null, | |
"function": [ | |
"coding", | |
"splicing" | |
], | |
"gene_symbol": "FOXO6", | |
"hgvs": "c.1007_1008insGGGACGCCCGCCTACTTCGGCGGCTGCAAGGGCGGCGCCTACGGCGGGGGCGGGGGCTTCGGGCCGCCGGCGATGGGCGCTCTGCGCCGTCTGCCCATGCAGACCATCCAGGAGAACAAGCAGGCCAGCTTCGTGCCGGCCGCGGCGCCCTTCCGCCCTGGGGCGCTGCCCGCGCTGCTGCCGCCGCCGCCGCCCGCGCC", | |
"hgvs_p1": "R337Gfs*106", | |
"hgvs_p3": "p.Arg337GlyfsTer106", | |
"location": "exon 3 of 3 before position 9 of 477", | |
"name": "ENST00000641094.1", | |
"splice_distance": "9", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "5", | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "FOXO6", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 2 of 2 before position 595 of 1975", | |
"name": "ENST00000372591.1", | |
"splice_distance": "595", | |
"strand": "+" | |
} | |
], | |
"version": "103" | |
}, | |
"genotype": "1/1", | |
"gnomad_exomes.ac": {}, | |
"gnomad_exomes.ac_afr": {}, | |
"gnomad_exomes.ac_afr_female": {}, | |
"gnomad_exomes.ac_afr_male": {}, | |
"gnomad_exomes.ac_amr": {}, | |
"gnomad_exomes.ac_amr_female": {}, | |
"gnomad_exomes.ac_amr_male": {}, | |
"gnomad_exomes.ac_asj": {}, | |
"gnomad_exomes.ac_asj_female": {}, | |
"gnomad_exomes.ac_asj_male": {}, | |
"gnomad_exomes.ac_eas": {}, | |
"gnomad_exomes.ac_eas_female": {}, | |
"gnomad_exomes.ac_eas_jpn": {}, | |
"gnomad_exomes.ac_eas_kor": {}, | |
"gnomad_exomes.ac_eas_male": {}, | |
"gnomad_exomes.ac_eas_oea": {}, | |
"gnomad_exomes.ac_female": {}, | |
"gnomad_exomes.ac_fin": {}, | |
"gnomad_exomes.ac_fin_female": {}, | |
"gnomad_exomes.ac_fin_male": {}, | |
"gnomad_exomes.ac_male": {}, | |
"gnomad_exomes.ac_nfe": {}, | |
"gnomad_exomes.ac_nfe_bgr": {}, | |
"gnomad_exomes.ac_nfe_est": {}, | |
"gnomad_exomes.ac_nfe_female": {}, | |
"gnomad_exomes.ac_nfe_male": {}, | |
"gnomad_exomes.ac_nfe_nwe": {}, | |
"gnomad_exomes.ac_nfe_onf": {}, | |
"gnomad_exomes.ac_nfe_seu": {}, | |
"gnomad_exomes.ac_nfe_swe": {}, | |
"gnomad_exomes.ac_oth": {}, | |
"gnomad_exomes.ac_oth_female": {}, | |
"gnomad_exomes.ac_oth_male": {}, | |
"gnomad_exomes.ac_sas": {}, | |
"gnomad_exomes.ac_sas_female": {}, | |
"gnomad_exomes.ac_sas_male": {}, | |
"gnomad_exomes.af": {}, | |
"gnomad_genomes.ac": 132281, | |
"gnomad_genomes.ac_afr": 39538, | |
"gnomad_genomes.ac_afr_female": 21339, | |
"gnomad_genomes.ac_afr_male": 18199, | |
"gnomad_genomes.ac_ami": 862, | |
"gnomad_genomes.ac_ami_female": 446, | |
"gnomad_genomes.ac_ami_male": 416, | |
"gnomad_genomes.ac_amr": 12763, | |
"gnomad_genomes.ac_amr_female": 5506, | |
"gnomad_genomes.ac_amr_male": 7257, | |
"gnomad_genomes.ac_asj": 3128, | |
"gnomad_genomes.ac_asj_female": 1646, | |
"gnomad_genomes.ac_asj_male": 1482, | |
"gnomad_genomes.ac_eas": 2935, | |
"gnomad_genomes.ac_eas_female": 1373, | |
"gnomad_genomes.ac_eas_male": 1562, | |
"gnomad_genomes.ac_female": 68535, | |
"gnomad_genomes.ac_fin": 7682, | |
"gnomad_genomes.ac_fin_female": 1094, | |
"gnomad_genomes.ac_fin_male": 6588, | |
"gnomad_genomes.ac_male": 63746, | |
"gnomad_genomes.ac_nfe": 60498, | |
"gnomad_genomes.ac_nfe_female": 35568, | |
"gnomad_genomes.ac_nfe_male": 24930, | |
"gnomad_genomes.ac_oth": 1997, | |
"gnomad_genomes.ac_oth_female": 1027, | |
"gnomad_genomes.ac_oth_male": 970, | |
"gnomad_genomes.ac_sas": 2878, | |
"gnomad_genomes.ac_sas_female": 536, | |
"gnomad_genomes.ac_sas_male": 2342, | |
"gnomad_genomes.af": 0.9972182434979269, | |
"gwas.items.disease_or_trait": {}, | |
"gwas.items.initial_sample_size": {}, | |
"gwas.items.odds_ratio": {}, | |
"gwas.items.p_value": {}, | |
"gwas.items.pub_med_references": {}, | |
"ncbi_clinvar2.accessions.clinical_significance": {}, | |
"ncbi_clinvar2.accessions.date_created": {}, | |
"ncbi_clinvar2.accessions.diseases": {}, | |
"ncbi_clinvar2.accessions.drug_response": {}, | |
"ncbi_clinvar2.accessions.drug_response.names": {}, | |
"ncbi_clinvar2.accessions.drug_response.pub_med_references": {}, | |
"ncbi_clinvar2.accessions.review_date": {}, | |
"pos": "54645453", | |
"ref": "G", | |
"refseq_transcripts.items.gene_symbol": "FOXO6", | |
"refseq_transcripts.items.hgvs": "c.1008_1008+1insGGGACGCCCGCCTACTTCGGCGGCTGCAAGGGCGGCGCCTACGGCGGGGGCGGGGGCTTCGGGCCGCCGGCGATGGGCGCTCTGCGCCGTCTGCCCATGCAGACCATCCAGGAGAACAAGCAGGCCAGCTTCGTGCCGGCCGCGGCGCCCTTCCGCCCTGGGGCGCTGCCCGCGCTGCTGCCGCCGCCGCCGCCCGCGCC", | |
"regions.NCBI ClinVar CNVs": { | |
"11-May-2021": [ | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000138891", | |
"allele_id": 159714, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20120601, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000179329", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200326, | |
"finding": [ | |
{ | |
"names": [ | |
"Intellectual Disability" | |
], | |
"symbols": { | |
"HP": "HP:0001249" | |
} | |
} | |
], | |
"origin": "not provided", | |
"review_date": 20120601, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 1p36.11-34.2(chr1:24381206-41401517)x3 AND See cases", | |
"variation_id": 149963 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 159714, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210428, | |
"identifiers": { | |
"dbVar": "nsv916207" | |
}, | |
"last_evaluation": 20210428, | |
"names": [ | |
"GRCh38/hg38 1p36.11-34.2(chr1:24381206-41401517)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 149963 | |
}, | |
"chromo": "chr1", | |
"length": 17020311, | |
"position": 24381206 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000053805", | |
"allele_id": 74529, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000081168", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200801, | |
"finding": [ | |
{ | |
"names": [ | |
"Global Developmental Delay" | |
], | |
"symbols": { | |
"HP": "HP:0001263" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ISCA site 4" | |
} | |
], | |
"title": "GRCh38/hg38 1p34.3-34.2(chr1:38108665-42327551)x1 AND See cases", | |
"variation_id": 59934 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 74529, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20201126, | |
"identifiers": { | |
"dbVar": "nsv532464" | |
}, | |
"last_evaluation": 20201126, | |
"names": [ | |
"GRCh38/hg38 1p34.3-34.2(chr1:38108665-42327551)x1" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number loss", | |
"variation_id": 59934 | |
}, | |
"chromo": "chr1", | |
"length": 4218886, | |
"position": 38108665 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000051803", | |
"allele_id": 72655, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000079151", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200801, | |
"finding": [ | |
{ | |
"names": [ | |
"Global Developmental Delay" | |
], | |
"symbols": { | |
"HP": "HP:0001263" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ARUP Laboratories, Cytogenetics and Genomic Microarray,ARUP Laboratories" | |
} | |
], | |
"title": "GRCh38/hg38 1p34.3-34.1(chr1:38222737-45636176)x3 AND See cases", | |
"variation_id": 58060 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 72655, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210205, | |
"identifiers": { | |
"dbVar": "nssv578519" | |
}, | |
"last_evaluation": 20210205, | |
"names": [ | |
"GRCh38/hg38 1p34.3-34.1(chr1:38222737-45636176)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number gain", | |
"variation_id": 58060 | |
}, | |
"chromo": "chr1", | |
"length": 7413439, | |
"position": 38222737 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000053837", | |
"allele_id": 74561, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000081200", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200801, | |
"finding": [ | |
{ | |
"names": [ | |
"Developmental Delay and/or Other Significant Developmental or Morphological Phenotypes" | |
] | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ISCA site 15" | |
} | |
], | |
"title": "GRCh38/hg38 1p34.2-34.1(chr1:40462415-44668040)x1 AND See cases", | |
"variation_id": 59966 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 74561, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210204, | |
"identifiers": { | |
"dbVar": "nsv532504" | |
}, | |
"last_evaluation": 20210204, | |
"names": [ | |
"GRCh38/hg38 1p34.2-34.1(chr1:40462415-44668040)x1" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number loss", | |
"variation_id": 59966 | |
}, | |
"chromo": "chr1", | |
"length": 4205625, | |
"position": 40462415 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000050706", | |
"allele_id": 71688, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000078038", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200801, | |
"finding": [ | |
{ | |
"names": [ | |
"Global Developmental Delay" | |
], | |
"symbols": { | |
"HP": "HP:0001263" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "de novo", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ISCA site 4" | |
} | |
], | |
"title": "GRCh38/hg38 1p34.2-34.1(chr1:40693289-44514104)x1 AND See cases", | |
"variation_id": 57093 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 71688, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210204, | |
"identifiers": { | |
"dbVar": "nsv529323" | |
}, | |
"last_evaluation": 20210204, | |
"names": [ | |
"GRCh38/hg38 1p34.2-34.1(chr1:40693289-44514104)x1" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number loss", | |
"variation_id": 57093 | |
}, | |
"chromo": "chr1", | |
"length": 3820815, | |
"position": 40693289 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000142267", | |
"allele_id": 163893, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20140310, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000183564", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190423, | |
"finding": [ | |
{ | |
"names": [ | |
"Autism" | |
], | |
"symbols": { | |
"HP": "HP:0000717" | |
} | |
}, | |
{ | |
"names": [ | |
"Delayed Speech and Language Development" | |
], | |
"symbols": { | |
"HP": "HP:0000750" | |
} | |
}, | |
{ | |
"names": [ | |
"Intellectual Disability" | |
], | |
"symbols": { | |
"HP": "HP:0001249" | |
} | |
}, | |
{ | |
"names": [ | |
"Seizures" | |
], | |
"symbols": { | |
"HP": "HP:0001250" | |
} | |
}, | |
{ | |
"names": [ | |
"Spasticity" | |
], | |
"symbols": { | |
"HP": "HP:0001257" | |
} | |
}, | |
{ | |
"names": [ | |
"Global Developmental Delay" | |
], | |
"symbols": { | |
"HP": "HP:0001263" | |
} | |
}, | |
{ | |
"names": [ | |
"Flexion Contracture" | |
], | |
"symbols": { | |
"HP": "HP:0001371" | |
} | |
}, | |
{ | |
"names": [ | |
"Delayed Gross Motor Development" | |
], | |
"symbols": { | |
"HP": "HP:0002194" | |
} | |
} | |
], | |
"origin": "not provided", | |
"review_date": 20140310, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 1p34.2(chr1:40834404-43123071)x1 AND See cases", | |
"variation_id": 154142 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 163893, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20201225, | |
"identifiers": { | |
"dbVar": "nsv996134" | |
}, | |
"last_evaluation": 20201225, | |
"names": [ | |
"GRCh38/hg38 1p34.2(chr1:40834404-43123071)x1" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number loss", | |
"variation_id": 154142 | |
}, | |
"chromo": "chr1", | |
"length": 2288667, | |
"position": 40834404 | |
} | |
] | |
}, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Subcutaneous": 0.028860800000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Visceral (Omentum)": 0.037281800000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adrenal Gland": 0.03302460000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Aorta": 0.12018000000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Coronary": 0.06506330000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Tibial": 0.09259160000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Bladder": 0.10683500000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Amygdala": 0.08547630000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Anterior cingulate cortex (BA24)": 0.11726200000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Caudate (basal ganglia)": 0.15838100000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellar Hemisphere": 0.024616900000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellum": 0.027108600000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cortex": 0.07941370000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Frontal Cortex (BA9)": 0.07385739999999999, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hippocampus": 0.14780100000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hypothalamus": 0.18107600000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Nucleus accumbens (basal ganglia)": 0.18872400000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Putamen (basal ganglia)": 0.14221200000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Spinal cord (cervical c-1)": 0.036222500000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Substantia nigra": 0.045183200000000014, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Breast - Mammary Tissue": 0.05101930000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - Cultured fibroblasts": 0.006075950000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - EBV-transformed lymphocytes": 0.00405063, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Ectocervix": 0.12209900000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Endocervix": 0.11405200000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Sigmoid": 0.11066600000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Transverse": 0.04413060000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Gastroesophageal Junction": 0.13056, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Mucosa": 0.021265800000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Muscularis": 0.09666220000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Fallopian Tube": 0.19443000000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Atrial Appendage": 0.07088610000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Left Ventricle": 0.031775500000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Cortex": 0.029380400000000008, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Medulla": 0.08512320000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Liver": 0.007088610000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Lung": 0.0374684, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Minor Salivary Gland": 0.08353760000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Muscle - Skeletal": 0.049247200000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Nerve - Tibial": 0.07797470000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Ovary": 0.29179499999999997, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pancreas": 0.03180550000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pituitary": 0.623438, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Prostate": 0.145383, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Not Sun Exposed (Suprapubic)": 0.08790470000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Sun Exposed (Lower leg)": 0.07425720000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Small Intestine - Terminal Ileum": 0.027341800000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Spleen": 0.02835440000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Stomach": 0.050126600000000014, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Testis": 0.20610900000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Thyroid": 0.25519, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Uterus": 0.25848800000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Vagina": 0.09220520000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Whole Blood": 0.0015189900000000004, | |
"variant_type": "Insertion", | |
"vcf_barcode": "sample", | |
"zygosity": "Homozygous" | |
}, | |
{ | |
"acmg_annotation.classifications.user_explain": [ | |
"Null variant (nonsense), in gene TLR10, for which loss-of-function is a known mechanism of disease (gnomAD Loss-of-Function Observed/Expected = 0.677 is less than 0.763).", | |
[ | |
"GnomAD exomes allele count = 2 is less than 5 for gene TLR10 (unable to check gnomAD exomes coverage).", | |
"GnomAD genomes allele count = 1 is less than 5 for gene TLR10 (good gnomAD genomes coverage = 31.3)." | |
], | |
"Pathogenic computational verdict based on 4 pathogenic predictions from BayesDel_addAF, CADD, DANN and MutationTaster vs 2 benign predictions from EIGEN and FATHMM-MKL." | |
], | |
"acmg_annotation.coding_impact": "nonsense", | |
"acmg_annotation.gene_id": 33406, | |
"acmg_annotation.gene_symbol": "TLR10", | |
"acmg_annotation.verdict.ACMG_rules.approx_score": 80, | |
"acmg_annotation.verdict.ACMG_rules.benign_subscore": "Uncertain Significance", | |
"acmg_annotation.verdict.ACMG_rules.pathogenic_subscore": "Pathogenic", | |
"acmg_annotation.verdict.ACMG_rules.verdict": "Pathogenic", | |
"acmg_annotation.version_name": "9.4.6", | |
"Allelic balance": 0.46938775510204084, | |
"all1": "G", | |
"all2": "T", | |
"alt": "CTT", | |
"amp_annotation.classifications": {}, | |
"amp_annotation.classifications.name": {}, | |
"amp_annotation.classifications.tier": {}, | |
"amp_annotation.classifications.user_explain.Tier I": {}, | |
"amp_annotation.classifications.user_explain.Tier II": {}, | |
"amp_annotation.classifications.user_explain.Tier III": {}, | |
"amp_annotation.classifications.user_explain.Tier IV": {}, | |
"amp_annotation.verdict": {}, | |
"amp_annotation.verdict.approx_score": {}, | |
"amp_annotation.verdict.tier": {}, | |
"amp_annotation.version_name": {}, | |
"cadd.cadd_score": 35, | |
"cancer_hotspots.biotype": {}, | |
"cancer_hotspots.cancer_name.key": {}, | |
"cancer_hotspots.canonical": {}, | |
"cancer_hotspots.total_samples": {}, | |
"cbio": {}, | |
"cbio_portal.ajcc_pathologic_tumor_stage.key": {}, | |
"cbio_portal.cancer_name.key": {}, | |
"cbio_portal.canonical": {}, | |
"cbio_portal.grade": {}, | |
"cbio_portal.hotspot": {}, | |
"chromosome": "chr2", | |
"Coverage": 49, | |
"cytobands": "4p14", | |
"dbnsfp_dbscsnv": {}, | |
"dbnsfp.aloft_confidence": null, | |
"dbnsfp.aloft_pred": null, | |
"dbnsfp.aloft_prob_dominant": null, | |
"dbnsfp.aloft_prob_recessive": null, | |
"dbnsfp.aloft_prob_tolerant": null, | |
"dbnsfp.cadd_phred": null, | |
"dbnsfp.cadd_raw": null, | |
"dbnsfp.cadd_raw_rankscore": null, | |
"dbnsfp.deogen2_pred": null, | |
"dbnsfp.ensembl_proteinid": [ | |
"ENSP00000308925", | |
"ENSP00000478206", | |
"ENSP00000354459", | |
"ENSP00000478985", | |
"ENSP00000421483", | |
"ENSP00000424923" | |
], | |
"dbnsfp.ensembl_transcriptid": [ | |
"ENST00000308973", | |
"ENST00000613579", | |
"ENST00000361424", | |
"ENST00000622002", | |
"ENST00000506111", | |
"ENST00000508334" | |
], | |
"dbnsfp.fathmm_mkl_coding_pred": "N", | |
"dbnsfp.fathmm_pred": null, | |
"dbnsfp.lrt_pred": "U", | |
"dbnsfp.metalr_pred": null, | |
"dbnsfp.metasvm_pred": null, | |
"dbnsfp.mutationassessor_pred": null, | |
"dbnsfp.mutationtaster_pred": [ | |
"D", | |
"D", | |
"D", | |
"D" | |
], | |
"dbnsfp.mutpred_score": null, | |
"dbnsfp.phastcons100way_vertebrate": 0.014999999664723873, | |
"dbnsfp.phastcons100way_vertebrate_rankscore": 0.19115999341011047, | |
"dbnsfp.phylop100way_vertebrate": -0.9860000014305115, | |
"dbnsfp.phylop100way_vertebrate_rankscore": 0.03857000172138214, | |
"dbnsfp.polyphen2_hdiv_pred": null, | |
"dbnsfp.polyphen2_hvar_pred": null, | |
"dbnsfp.primateai_pred": null, | |
"dbnsfp.provean_pred": null, | |
"dbnsfp.revel_score": null, | |
"dbnsfp.sift_pred": null, | |
"dbnsfp.sift4g_pred": null, | |
"ensembl_transcripts": { | |
"items": [ | |
{ | |
"canonical": true, | |
"coding_impact": "nonsense", | |
"coding_location": "430 of 812", | |
"ensembl_support_level": "5", | |
"function": [ | |
"coding" | |
], | |
"gene_symbol": "TLR10", | |
"hgvs": "c.1290C>A", | |
"hgvs_p1": "Y430*", | |
"hgvs_p3": "p.Tyr430Ter", | |
"location": "exon 4 of 4 position 1352 of 3415", | |
"name": "ENST00000308973.9", | |
"splice_distance": "1352", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": "nonsense", | |
"coding_location": "430 of 812", | |
"ensembl_support_level": "1", | |
"function": [ | |
"coding" | |
], | |
"gene_symbol": "TLR10", | |
"hgvs": "c.1290C>A", | |
"hgvs_p1": "Y430*", | |
"hgvs_p3": "p.Tyr430Ter", | |
"location": "exon 2 of 2 position 1352 of 3414", | |
"name": "ENST00000361424.6", | |
"splice_distance": "1352", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": "nonsense", | |
"coding_location": "430 of 812", | |
"ensembl_support_level": "1", | |
"function": [ | |
"coding" | |
], | |
"gene_symbol": "TLR10", | |
"hgvs": "c.1290C>A", | |
"hgvs_p1": "Y430*", | |
"hgvs_p3": "p.Tyr430Ter", | |
"location": "exon 2 of 2 position 1352 of 3040", | |
"name": "ENST00000506111.1", | |
"splice_distance": "1352", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": "nonsense", | |
"coding_location": "430 of 812", | |
"ensembl_support_level": "1", | |
"function": [ | |
"coding" | |
], | |
"gene_symbol": "TLR10", | |
"hgvs": "c.1290C>A", | |
"hgvs_p1": "Y430*", | |
"hgvs_p3": "p.Tyr430Ter", | |
"location": "exon 2 of 2 position 1352 of 2528", | |
"name": "ENST00000508334.1", | |
"splice_distance": "1352", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": "nonsense", | |
"coding_location": "430 of 812", | |
"ensembl_support_level": "3", | |
"function": [ | |
"coding" | |
], | |
"gene_symbol": "TLR10", | |
"hgvs": "c.1290C>A", | |
"hgvs_p1": "Y430*", | |
"hgvs_p3": "p.Tyr430Ter", | |
"location": "exon 3 of 3 position 1352 of 3414", | |
"name": "ENST00000613579.4", | |
"splice_distance": "1352", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": "nonsense", | |
"coding_location": "430 of 812", | |
"ensembl_support_level": "3", | |
"function": [ | |
"coding" | |
], | |
"gene_symbol": "TLR10", | |
"hgvs": "c.1290C>A", | |
"hgvs_p1": "Y430*", | |
"hgvs_p3": "p.Tyr430Ter", | |
"location": "exon 3 of 3 position 1352 of 3414", | |
"name": "ENST00000622002.4", | |
"splice_distance": "1352", | |
"strand": "-" | |
} | |
], | |
"version": "103" | |
}, | |
"genotype": "0/1", | |
"gnomad_exomes.ac": 2, | |
"gnomad_exomes.ac_afr": {}, | |
"gnomad_exomes.ac_afr_female": {}, | |
"gnomad_exomes.ac_afr_male": {}, | |
"gnomad_exomes.ac_amr": {}, | |
"gnomad_exomes.ac_amr_female": {}, | |
"gnomad_exomes.ac_amr_male": {}, | |
"gnomad_exomes.ac_asj": {}, | |
"gnomad_exomes.ac_asj_female": {}, | |
"gnomad_exomes.ac_asj_male": {}, | |
"gnomad_exomes.ac_eas": {}, | |
"gnomad_exomes.ac_eas_female": {}, | |
"gnomad_exomes.ac_eas_jpn": {}, | |
"gnomad_exomes.ac_eas_kor": {}, | |
"gnomad_exomes.ac_eas_male": {}, | |
"gnomad_exomes.ac_eas_oea": {}, | |
"gnomad_exomes.ac_female": {}, | |
"gnomad_exomes.ac_fin": {}, | |
"gnomad_exomes.ac_fin_female": {}, | |
"gnomad_exomes.ac_fin_male": {}, | |
"gnomad_exomes.ac_male": 2, | |
"gnomad_exomes.ac_nfe": 2, | |
"gnomad_exomes.ac_nfe_bgr": {}, | |
"gnomad_exomes.ac_nfe_est": {}, | |
"gnomad_exomes.ac_nfe_female": {}, | |
"gnomad_exomes.ac_nfe_male": 2, | |
"gnomad_exomes.ac_nfe_nwe": {}, | |
"gnomad_exomes.ac_nfe_onf": 1, | |
"gnomad_exomes.ac_nfe_seu": 1, | |
"gnomad_exomes.ac_nfe_swe": {}, | |
"gnomad_exomes.ac_oth": {}, | |
"gnomad_exomes.ac_oth_female": {}, | |
"gnomad_exomes.ac_oth_male": {}, | |
"gnomad_exomes.ac_sas": {}, | |
"gnomad_exomes.ac_sas_female": {}, | |
"gnomad_exomes.ac_sas_male": {}, | |
"gnomad_exomes.af": 0.000008077544426494346, | |
"gnomad_genomes.ac": 1, | |
"gnomad_genomes.ac_afr": {}, | |
"gnomad_genomes.ac_afr_female": {}, | |
"gnomad_genomes.ac_afr_male": {}, | |
"gnomad_genomes.ac_ami": {}, | |
"gnomad_genomes.ac_ami_female": {}, | |
"gnomad_genomes.ac_ami_male": {}, | |
"gnomad_genomes.ac_amr": {}, | |
"gnomad_genomes.ac_amr_female": {}, | |
"gnomad_genomes.ac_amr_male": {}, | |
"gnomad_genomes.ac_asj": {}, | |
"gnomad_genomes.ac_asj_female": {}, | |
"gnomad_genomes.ac_asj_male": {}, | |
"gnomad_genomes.ac_eas": {}, | |
"gnomad_genomes.ac_eas_female": {}, | |
"gnomad_genomes.ac_eas_male": {}, | |
"gnomad_genomes.ac_female": {}, | |
"gnomad_genomes.ac_fin": {}, | |
"gnomad_genomes.ac_fin_female": {}, | |
"gnomad_genomes.ac_fin_male": {}, | |
"gnomad_genomes.ac_male": 1, | |
"gnomad_genomes.ac_nfe": 1, | |
"gnomad_genomes.ac_nfe_female": {}, | |
"gnomad_genomes.ac_nfe_male": 1, | |
"gnomad_genomes.ac_oth": {}, | |
"gnomad_genomes.ac_oth_female": {}, | |
"gnomad_genomes.ac_oth_male": {}, | |
"gnomad_genomes.ac_sas": {}, | |
"gnomad_genomes.ac_sas_female": {}, | |
"gnomad_genomes.ac_sas_male": {}, | |
"gnomad_genomes.af": 0.000006978464458680512, | |
"gwas.items.disease_or_trait": {}, | |
"gwas.items.initial_sample_size": {}, | |
"gwas.items.odds_ratio": {}, | |
"gwas.items.p_value": {}, | |
"gwas.items.pub_med_references": {}, | |
"ncbi_clinvar2.accessions.clinical_significance": {}, | |
"ncbi_clinvar2.accessions.date_created": {}, | |
"ncbi_clinvar2.accessions.diseases": {}, | |
"ncbi_clinvar2.accessions.drug_response": {}, | |
"ncbi_clinvar2.accessions.drug_response.names": {}, | |
"ncbi_clinvar2.accessions.drug_response.pub_med_references": {}, | |
"ncbi_clinvar2.accessions.review_date": {}, | |
"pos": "54645456", | |
"ref": "C", | |
"refseq_transcripts.items.gene_symbol": [ | |
"TLR10", | |
"TLR10", | |
"TLR10", | |
"TLR10", | |
"TLR10" | |
], | |
"refseq_transcripts.items.hgvs": [ | |
"c.1290C>A", | |
"c.1290C>A", | |
"c.1290C>A", | |
"c.1290C>A", | |
"c.1248C>A" | |
], | |
"regions.NCBI ClinVar CNVs": { | |
"11-May-2021": [ | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000137261", | |
"allele_id": 157937, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20110321, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000177477", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200326, | |
"finding": [ | |
{ | |
"names": [ | |
"Failure to Thrive" | |
], | |
"symbols": { | |
"HP": "HP:0001508" | |
} | |
} | |
], | |
"origin": "not provided", | |
"review_date": 20110321, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 4p16.3-12(chr4:36424-47491595)x3 AND See cases", | |
"variation_id": 148186 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 157937, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210422, | |
"identifiers": { | |
"dbVar": "nsv817183" | |
}, | |
"last_evaluation": 20210422, | |
"names": [ | |
"GRCh38/hg38 4p16.3-12(chr4:36424-47491595)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 148186 | |
}, | |
"chromo": "chr4", | |
"length": 47455171, | |
"position": 36424 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000133677", | |
"allele_id": 153946, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140829, | |
"review_date": 20100527, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000173068", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190424, | |
"review_date": 20100527, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ISCA site 4" | |
} | |
], | |
"title": "GRCh38/hg38 4p16.3-14(chr4:72555-39477144)x3 AND See cases", | |
"variation_id": 144195 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 153946, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210418, | |
"identifiers": { | |
"dbVar": "nssv3396846" | |
}, | |
"last_evaluation": 20210418, | |
"names": [ | |
"GRCh38/hg38 4p16.3-14(chr4:72555-39477144)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 144195 | |
}, | |
"chromo": "chr4", | |
"length": 39404589, | |
"position": 72555 | |
} | |
] | |
}, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Subcutaneous": 0.0043050300000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Visceral (Omentum)": 0.007615700000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adrenal Gland": 0.004100760000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Aorta": 0.0025128700000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Coronary": 0.004100760000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Tibial": 0.0014645600000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Bladder": 0.0043936700000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Amygdala": 0.030462800000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Anterior cingulate cortex (BA24)": 0.020049, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Caudate (basal ganglia)": 0.022496400000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellar Hemisphere": 0.006151140000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellum": 0.004100760000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cortex": 0.013508600000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Frontal Cortex (BA9)": 0.016696000000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hippocampus": 0.025776200000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hypothalamus": 0.03470230000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Nucleus accumbens (basal ganglia)": 0.022407700000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Putamen (basal ganglia)": 0.016403000000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Spinal cord (cervical c-1)": 0.04393670000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Substantia nigra": 0.045644100000000014, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Breast - Mammary Tissue": 0.00501033, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - Cultured fibroblasts": 0.0005858230000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - EBV-transformed lymphocytes": 2.8018499999999995, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Ectocervix": 0.0029291200000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Endocervix": 0.0038078500000000015, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Sigmoid": 0.0026824500000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Transverse": 0.012997900000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Gastroesophageal Junction": 0.0017574700000000008, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Mucosa": 0.011284800000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Muscularis": 0.0017574700000000008, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Fallopian Tube": 0.007615700000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Atrial Appendage": 0.0017574700000000008, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Left Ventricle": 0.00117165, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Cortex": 0.004100760000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Medulla": 0.009519630000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Liver": 0.005272410000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Lung": 0.023432900000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Minor Salivary Gland": 0.012302300000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Muscle - Skeletal": 0.0005858230000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Nerve - Tibial": 0.008201520000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Ovary": 0.0017574700000000008, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pancreas": 0.0029291200000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pituitary": 0.006151140000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Prostate": 0.008787350000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Not Sun Exposed (Suprapubic)": 0.0032220300000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Sun Exposed (Lower leg)": 0.0029291200000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Small Intestine - Terminal Ileum": 0.16157500000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Spleen": 0.8664280000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Stomach": 0.005272410000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Testis": 0.00117165, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Thyroid": 0.003514940000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Uterus": 0.0023432900000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Vagina": 0.004100760000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Whole Blood": 0.11879500000000004, | |
"variant_type": "SNV", | |
"vcf_barcode": "sample", | |
"zygosity": "Heterozygous" | |
}, | |
{ | |
"acmg_annotation.classifications.user_explain": [ | |
"Null variant (intronic within ±2 of splice site), in gene TPP1, for which loss-of-function is a known mechanism of disease (gnomAD Loss-of-Function Observed/Expected = 0.508 is less than 0.763), associated with Ceroid lipofuscinosis, neuronal, 2 and Spinocerebellar ataxia, autosomal recessive 7.", | |
[ | |
"GnomAD exomes homozygous allele count = 0 is less than 3 for recessive gene TPP1 (unable to check gnomAD exomes coverage).", | |
"Variant not found in gnomAD genomes (good gnomAD genomes coverage = 31.0)." | |
], | |
[ | |
"ClinVar classifies this variant as Pathogenic, rated 2 stars, multiple submissions with no conflicts.", | |
"Using strength Moderate because of the evidence presented by ClinVar." | |
], | |
"Pathogenic computational verdict based on 7 pathogenic predictions from BayesDel_addAF, CADD, DANN, EIGEN, FATHMM-MKL, MutationTaster and scSNV-Splicing vs no benign predictions." | |
], | |
"acmg_annotation.coding_impact": "non coding", | |
"acmg_annotation.gene_id": 34014, | |
"acmg_annotation.gene_symbol": "TPP1", | |
"acmg_annotation.verdict.ACMG_rules.approx_score": 100, | |
"acmg_annotation.verdict.ACMG_rules.benign_subscore": "Uncertain Significance", | |
"acmg_annotation.verdict.ACMG_rules.pathogenic_subscore": "Pathogenic", | |
"acmg_annotation.verdict.ACMG_rules.verdict": "Pathogenic", | |
"acmg_annotation.version_name": "9.4.6", | |
"Allelic balance": 0.6176470588235294, | |
"all1": "C", | |
"all2": "T", | |
"alt": "GGGTTGGAGAGAGGATGCCTTTGGCA", | |
"amp_annotation.classifications": {}, | |
"amp_annotation.classifications.name": {}, | |
"amp_annotation.classifications.tier": {}, | |
"amp_annotation.classifications.user_explain.Tier I": {}, | |
"amp_annotation.classifications.user_explain.Tier II": {}, | |
"amp_annotation.classifications.user_explain.Tier III": {}, | |
"amp_annotation.classifications.user_explain.Tier IV": {}, | |
"amp_annotation.verdict": {}, | |
"amp_annotation.verdict.approx_score": {}, | |
"amp_annotation.verdict.tier": {}, | |
"amp_annotation.version_name": {}, | |
"cadd.cadd_score": 33, | |
"cancer_hotspots.biotype": "protein_coding", | |
"cancer_hotspots.cancer_name.key": "Hepatocellular Carcinoma", | |
"cancer_hotspots.canonical": true, | |
"cancer_hotspots.total_samples": 1, | |
"cbio": {}, | |
"cbio_portal.ajcc_pathologic_tumor_stage.key": "STAGE II", | |
"cbio_portal.cancer_name.key": "Hepatocellular Carcinoma", | |
"cbio_portal.canonical": true, | |
"cbio_portal.grade": { | |
"key": "G3", | |
"value": 2 | |
}, | |
"cbio_portal.hotspot": false, | |
"chromosome": "chr2", | |
"Coverage": 34, | |
"cytobands": "11p15.4", | |
"dbnsfp_dbscsnv": { | |
"ada_score": [ | |
0.9999882578849792 | |
], | |
"rf_score": [ | |
0.9380000233650208 | |
], | |
"version": "v1.1" | |
}, | |
"dbnsfp.aloft_confidence": null, | |
"dbnsfp.aloft_pred": null, | |
"dbnsfp.aloft_prob_dominant": null, | |
"dbnsfp.aloft_prob_recessive": null, | |
"dbnsfp.aloft_prob_tolerant": null, | |
"dbnsfp.cadd_phred": null, | |
"dbnsfp.cadd_raw": null, | |
"dbnsfp.cadd_raw_rankscore": null, | |
"dbnsfp.deogen2_pred": null, | |
"dbnsfp.ensembl_proteinid": [ | |
"ENSP00000299427", | |
"ENSP00000495895", | |
"ENSP00000493574" | |
], | |
"dbnsfp.ensembl_transcriptid": [ | |
"ENST00000299427", | |
"ENST00000644810", | |
"ENST00000644218" | |
], | |
"dbnsfp.fathmm_mkl_coding_pred": "D", | |
"dbnsfp.fathmm_pred": null, | |
"dbnsfp.lrt_pred": null, | |
"dbnsfp.metalr_pred": null, | |
"dbnsfp.metasvm_pred": null, | |
"dbnsfp.mutationassessor_pred": null, | |
"dbnsfp.mutationtaster_pred": [ | |
"D", | |
"D" | |
], | |
"dbnsfp.mutpred_score": null, | |
"dbnsfp.phastcons100way_vertebrate": 1, | |
"dbnsfp.phastcons100way_vertebrate_rankscore": 0.7163800001144409, | |
"dbnsfp.phylop100way_vertebrate": 4.607999801635742, | |
"dbnsfp.phylop100way_vertebrate_rankscore": 0.6084700226783752, | |
"dbnsfp.polyphen2_hdiv_pred": null, | |
"dbnsfp.polyphen2_hvar_pred": null, | |
"dbnsfp.primateai_pred": null, | |
"dbnsfp.provean_pred": null, | |
"dbnsfp.revel_score": null, | |
"dbnsfp.sift_pred": null, | |
"dbnsfp.sift4g_pred": null, | |
"ensembl_transcripts": { | |
"items": [ | |
{ | |
"canonical": true, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "1", | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": "c.509-1G>A", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 5 of 12 position 147 of 147", | |
"name": "ENST00000299427.12", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 4 of 4 position 275 of 367", | |
"name": "ENST00000428886.7", | |
"splice_distance": "275", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "4", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": "c.310+147G>A", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 3 of 5 position 147 of 1226", | |
"name": "ENST00000436873.7", | |
"splice_distance": "147", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 4 of 5 position 275 of 454", | |
"name": "ENST00000524788.2", | |
"splice_distance": "-180", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "4", | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 3 of 4 position 275 of 454", | |
"name": "ENST00000524903.2", | |
"splice_distance": "-180", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "4", | |
"function": [ | |
"3'flank" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "54 bp after transcription end site", | |
"name": "ENST00000528571.6", | |
"splice_distance": null, | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 2 position 147 of 147", | |
"name": "ENST00000528807.2", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 5 of 5 position 205 of 855", | |
"name": "ENST00000530040.2", | |
"splice_distance": "205", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "1", | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": "c.-221-1G>A", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 4 of 11 position 147 of 147", | |
"name": "ENST00000533371.6", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "4", | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 5 of 5 position 200 of 200", | |
"name": "ENST00000534644.6", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": "c.-221-1G>A", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 4 of 11 position 200 of 200", | |
"name": "ENST00000642892.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 4 of 11 position 147 of 147", | |
"name": "ENST00000643439.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 5 of 11 position 147 of 147", | |
"name": "ENST00000643479.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": "c.394+147G>A", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 3 of 8 position 147 of 797", | |
"name": "ENST00000643516.1", | |
"splice_distance": "147", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 3 of 4 position 275 of 454", | |
"name": "ENST00000644151.1", | |
"splice_distance": "-180", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": "c.509-1G>A", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 5 of 11 position 147 of 147", | |
"name": "ENST00000644218.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 5 of 12 position 205 of 205", | |
"name": "ENST00000644683.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": "c.230-1G>A", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 3 of 10 position 1622 of 1622", | |
"name": "ENST00000644810.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 5 of 12 position 275 of 454", | |
"name": "ENST00000644831.1", | |
"splice_distance": "-180", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 4 of 12 position 147 of 147", | |
"name": "ENST00000644933.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 4 of 4 position 275 of 882", | |
"name": "ENST00000645020.1", | |
"splice_distance": "275", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 3 of 10 position 147 of 147", | |
"name": "ENST00000645285.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 4 of 8 position 623 of 802", | |
"name": "ENST00000645331.1", | |
"splice_distance": "-180", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": "c.-221-1G>A", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 4 of 11 position 205 of 205", | |
"name": "ENST00000645620.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 5 of 11 position 275 of 454", | |
"name": "ENST00000646777.1", | |
"splice_distance": "-180", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 2 of 9 position 275 of 454", | |
"name": "ENST00000647016.1", | |
"splice_distance": "-180", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": "c.-221-1G>A", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 3 of 10 position 147 of 147", | |
"name": "ENST00000647152.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 5 of 12 position 147 of 147", | |
"name": "ENST00000647209.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": null, | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "TPP1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 4 of 11 position 147 of 147", | |
"name": "ENST00000647346.1", | |
"splice_distance": "-1", | |
"strand": "-" | |
} | |
], | |
"version": "103" | |
}, | |
"genotype": "0/1", | |
"gnomad_exomes.ac": 3, | |
"gnomad_exomes.ac_afr": {}, | |
"gnomad_exomes.ac_afr_female": {}, | |
"gnomad_exomes.ac_afr_male": {}, | |
"gnomad_exomes.ac_amr": {}, | |
"gnomad_exomes.ac_amr_female": {}, | |
"gnomad_exomes.ac_amr_male": {}, | |
"gnomad_exomes.ac_asj": {}, | |
"gnomad_exomes.ac_asj_female": {}, | |
"gnomad_exomes.ac_asj_male": {}, | |
"gnomad_exomes.ac_eas": {}, | |
"gnomad_exomes.ac_eas_female": {}, | |
"gnomad_exomes.ac_eas_jpn": {}, | |
"gnomad_exomes.ac_eas_kor": {}, | |
"gnomad_exomes.ac_eas_male": {}, | |
"gnomad_exomes.ac_eas_oea": {}, | |
"gnomad_exomes.ac_female": 2, | |
"gnomad_exomes.ac_fin": {}, | |
"gnomad_exomes.ac_fin_female": {}, | |
"gnomad_exomes.ac_fin_male": {}, | |
"gnomad_exomes.ac_male": 1, | |
"gnomad_exomes.ac_nfe": 3, | |
"gnomad_exomes.ac_nfe_bgr": {}, | |
"gnomad_exomes.ac_nfe_est": {}, | |
"gnomad_exomes.ac_nfe_female": 2, | |
"gnomad_exomes.ac_nfe_male": 1, | |
"gnomad_exomes.ac_nfe_nwe": 2, | |
"gnomad_exomes.ac_nfe_onf": 1, | |
"gnomad_exomes.ac_nfe_seu": {}, | |
"gnomad_exomes.ac_nfe_swe": {}, | |
"gnomad_exomes.ac_oth": {}, | |
"gnomad_exomes.ac_oth_female": {}, | |
"gnomad_exomes.ac_oth_male": {}, | |
"gnomad_exomes.ac_sas": {}, | |
"gnomad_exomes.ac_sas_female": {}, | |
"gnomad_exomes.ac_sas_male": {}, | |
"gnomad_exomes.af": 0.000011934883276841553, | |
"gnomad_genomes.ac": {}, | |
"gnomad_genomes.ac_afr": {}, | |
"gnomad_genomes.ac_afr_female": {}, | |
"gnomad_genomes.ac_afr_male": {}, | |
"gnomad_genomes.ac_ami": {}, | |
"gnomad_genomes.ac_ami_female": {}, | |
"gnomad_genomes.ac_ami_male": {}, | |
"gnomad_genomes.ac_amr": {}, | |
"gnomad_genomes.ac_amr_female": {}, | |
"gnomad_genomes.ac_amr_male": {}, | |
"gnomad_genomes.ac_asj": {}, | |
"gnomad_genomes.ac_asj_female": {}, | |
"gnomad_genomes.ac_asj_male": {}, | |
"gnomad_genomes.ac_eas": {}, | |
"gnomad_genomes.ac_eas_female": {}, | |
"gnomad_genomes.ac_eas_male": {}, | |
"gnomad_genomes.ac_female": {}, | |
"gnomad_genomes.ac_fin": {}, | |
"gnomad_genomes.ac_fin_female": {}, | |
"gnomad_genomes.ac_fin_male": {}, | |
"gnomad_genomes.ac_male": {}, | |
"gnomad_genomes.ac_nfe": {}, | |
"gnomad_genomes.ac_nfe_female": {}, | |
"gnomad_genomes.ac_nfe_male": {}, | |
"gnomad_genomes.ac_oth": {}, | |
"gnomad_genomes.ac_oth_female": {}, | |
"gnomad_genomes.ac_oth_male": {}, | |
"gnomad_genomes.ac_sas": {}, | |
"gnomad_genomes.ac_sas_female": {}, | |
"gnomad_genomes.ac_sas_male": {}, | |
"gnomad_genomes.af": {}, | |
"gwas.items.disease_or_trait": {}, | |
"gwas.items.initial_sample_size": {}, | |
"gwas.items.odds_ratio": {}, | |
"gwas.items.p_value": {}, | |
"gwas.items.pub_med_references": {}, | |
"ncbi_clinvar2.accessions.clinical_significance": [ | |
"Pathogenic", | |
"Pathogenic", | |
"Pathogenic" | |
], | |
"ncbi_clinvar2.accessions.date_created": [ | |
20180316, | |
20180804, | |
20150807 | |
], | |
"ncbi_clinvar2.accessions.diseases": [ | |
{ | |
"disease_mechanism": "loss of function", | |
"names": [ | |
"Neuronal Ceroid Lipofuscinosis", | |
"Ceroid Storage Disease", | |
"Lipofuscin Storage Disease" | |
], | |
"pub_med": [ | |
19084560 | |
], | |
"symbols": { | |
"medgen": "C0027877", | |
"mondo": "MONDO:0016295", | |
"omim": "256730", | |
"orphanet": "79263" | |
} | |
}, | |
{ | |
"names": [ | |
"Ceroid Lipofuscinosis Neuronal 2", | |
"TPP1-Related Neuronal Ceroid-Lipofuscinosis" | |
], | |
"symbols": { | |
"medgen": "C1876161", | |
"mondo": "MONDO:0008769", | |
"omim": "204500", | |
"orphanet": "79264" | |
} | |
}, | |
{ | |
"symbols": { | |
"medgen": "CN517202" | |
} | |
} | |
], | |
"ncbi_clinvar2.accessions.drug_response": [ | |
{}, | |
{}, | |
{} | |
], | |
"ncbi_clinvar2.accessions.drug_response.names": [ | |
{}, | |
{}, | |
{} | |
], | |
"ncbi_clinvar2.accessions.drug_response.pub_med_references": [ | |
{}, | |
{}, | |
{} | |
], | |
"ncbi_clinvar2.accessions.review_date": [ | |
20191025, | |
20180406, | |
20170518 | |
], | |
"pos": "1789757", | |
"ref": "G", | |
"refseq_transcripts.items.gene_symbol": "TPP1", | |
"refseq_transcripts.items.hgvs": "c.509-1G>A", | |
"regions.NCBI ClinVar CNVs": { | |
"11-May-2021": [ | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000139987", | |
"allele_id": 161014, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20110430, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000180647", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20210227, | |
"finding": [ | |
{ | |
"names": [ | |
"Developmental Delay and/or Other Significant Developmental or Morphological Phenotypes" | |
] | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110430, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "GeneDx" | |
} | |
], | |
"title": "GRCh38/hg38 11p15.5-15.4(chr11:61793-10727969)x3 AND See cases", | |
"variation_id": 151263 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 161014, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210428, | |
"identifiers": { | |
"dbVar": "nsv931147" | |
}, | |
"last_evaluation": 20210428, | |
"names": [ | |
"GRCh38/hg38 11p15.5-15.4(chr11:61793-10727969)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 151263 | |
}, | |
"chromo": "chr11", | |
"length": 10666176, | |
"position": 61793 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000053613", | |
"allele_id": 74342, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000080976", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200801, | |
"finding": [ | |
{ | |
"names": [ | |
"Hypotension" | |
], | |
"symbols": { | |
"HP": "HP:0002615" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ARUP Laboratories, Cytogenetics and Genomic Microarray,ARUP Laboratories" | |
} | |
], | |
"title": "GRCh38/hg38 11p15.5-13(chr11:202758-31726224)x3 AND See cases", | |
"variation_id": 59747 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 74342, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210428, | |
"identifiers": { | |
"dbVar": "nsv532276" | |
}, | |
"last_evaluation": 20210428, | |
"names": [ | |
"GRCh38/hg38 11p15.5-13(chr11:202758-31726224)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number gain", | |
"variation_id": 59747 | |
}, | |
"chromo": "chr11", | |
"length": 31523466, | |
"position": 202758 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000133997", | |
"allele_id": 154266, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140829, | |
"review_date": 20100430, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000173419", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190803, | |
"finding": [ | |
{ | |
"names": [ | |
"Global Developmental Delay" | |
], | |
"symbols": { | |
"HP": "HP:0001263" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20100430, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ISCA site 4" | |
} | |
], | |
"title": "GRCh38/hg38 11p15.5-15.1(chr11:446754-18904742)x3 AND See cases", | |
"variation_id": 144515 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 154266, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210428, | |
"identifiers": { | |
"dbVar": "nsv492062" | |
}, | |
"last_evaluation": 20210428, | |
"names": [ | |
"GRCh38/hg38 11p15.5-15.1(chr11:446754-18904742)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 144515 | |
}, | |
"chromo": "chr11", | |
"length": 18457988, | |
"position": 446754 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000053616", | |
"allele_id": 74345, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000080979", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200801, | |
"finding": [ | |
{ | |
"names": [ | |
"Abnormal Facial Shape" | |
], | |
"symbols": { | |
"HP": "HP:0001999" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ARUP Laboratories, Cytogenetics and Genomic Microarray,ARUP Laboratories" | |
} | |
], | |
"title": "GRCh38/hg38 11p15.4(chr11:3745061-7846057)x3 AND See cases", | |
"variation_id": 59750 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 74345, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210312, | |
"identifiers": { | |
"dbVar": "nsv532279" | |
}, | |
"last_evaluation": 20210312, | |
"names": [ | |
"GRCh38/hg38 11p15.4(chr11:3745061-7846057)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number gain", | |
"variation_id": 59750 | |
}, | |
"chromo": "chr11", | |
"length": 4100996, | |
"position": 3745061 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000136804", | |
"allele_id": 157392, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20100130, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000176928", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190424, | |
"finding": [ | |
{ | |
"names": [ | |
"Global Developmental Delay" | |
], | |
"symbols": { | |
"HP": "HP:0001263" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "maternal", | |
"review_date": 20100130, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ISCA site 8" | |
} | |
], | |
"title": "GRCh38/hg38 11p15.4(chr11:6261582-6637999)x3 AND See cases", | |
"variation_id": 147641 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 157392, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20200820, | |
"identifiers": { | |
"dbVar": "nssv582166" | |
}, | |
"last_evaluation": 20200820, | |
"names": [ | |
"GRCh38/hg38 11p15.4(chr11:6261582-6637999)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 147641 | |
}, | |
"chromo": "chr11", | |
"length": 376417, | |
"position": 6261582 | |
} | |
] | |
}, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Subcutaneous": 1.04547, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Visceral (Omentum)": 1.15676, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adrenal Gland": 2.63114, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Aorta": 1.13968, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Coronary": 1.0455199999999998, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Tibial": 1.01884, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Bladder": 1.01168, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Amygdala": 0.6450270000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Anterior cingulate cortex (BA24)": 0.7139750000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Caudate (basal ganglia)": 0.915111, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellar Hemisphere": 0.45232400000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellum": 0.48487100000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cortex": 0.7377410000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Frontal Cortex (BA9)": 0.795763, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hippocampus": 0.502261, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hypothalamus": 0.556211, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Nucleus accumbens (basal ganglia)": 0.825064, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Putamen (basal ganglia)": 0.6681830000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Spinal cord (cervical c-1)": 0.853234, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Substantia nigra": 0.590337, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Breast - Mammary Tissue": 0.8340770000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - Cultured fibroblasts": 2.33538, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - EBV-transformed lymphocytes": 1.32466, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Ectocervix": 0.776577, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Endocervix": 0.989146, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Sigmoid": 0.872566, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Transverse": 0.932457, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Gastroesophageal Junction": 0.876565, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Mucosa": 0.559066, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Muscularis": 0.828918, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Fallopian Tube": 0.755362, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Atrial Appendage": 0.6396650000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Left Ventricle": 0.42512500000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Cortex": 0.584917, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Medulla": 0.48987100000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Liver": 0.266056, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Lung": 1.25809, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Minor Salivary Gland": 0.8122250000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Muscle - Skeletal": 0.3415260000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Nerve - Tibial": 0.7525210000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Ovary": 0.8986200000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pancreas": 0.360451, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pituitary": 0.795096, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Prostate": 0.502101, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Not Sun Exposed (Suprapubic)": 0.568369, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Sun Exposed (Lower leg)": 0.6244490000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Small Intestine - Terminal Ileum": 1.2711599999999998, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Spleen": 1.4552199999999997, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Stomach": 0.6166820000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Testis": 0.30912400000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Thyroid": 0.83057, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Uterus": 1.1535199999999999, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Vagina": 0.6977890000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Whole Blood": 1.30646, | |
"variant_type": "SNV", | |
"vcf_barcode": "sample", | |
"zygosity": "Heterozygous" | |
}, | |
{ | |
"acmg_annotation.classifications.user_explain": [ | |
"Null variant (intronic within ±2 of splice site), in gene MORF4L1, for which loss-of-function is a known mechanism of disease (gnomAD Loss-of-Function Observed/Expected = 0.0841 is less than 0.763).", | |
"Variant not found in gnomAD exomes (unable to check gnomAD exomes coverage).", | |
"Benign computational verdict based on 1 benign prediction from CADD vs no pathogenic predictions and the position is not strongly conserved (CSH phyloP100way = -1.97 is less than 5)." | |
], | |
"acmg_annotation.coding_impact": "non coding", | |
"acmg_annotation.gene_id": 17129, | |
"acmg_annotation.gene_symbol": "MORF4L1", | |
"acmg_annotation.verdict.ACMG_rules.approx_score": 69, | |
"acmg_annotation.verdict.ACMG_rules.benign_subscore": "Uncertain Significance", | |
"acmg_annotation.verdict.ACMG_rules.pathogenic_subscore": "Likely Pathogenic", | |
"acmg_annotation.verdict.ACMG_rules.verdict": "Likely Pathogenic", | |
"acmg_annotation.version_name": "9.4.6", | |
"Allelic balance": 0.46153846153846156, | |
"all1": "T", | |
"all2": "G", | |
"alt": "A", | |
"amp_annotation.classifications": {}, | |
"amp_annotation.classifications.name": {}, | |
"amp_annotation.classifications.tier": {}, | |
"amp_annotation.classifications.user_explain.Tier I": {}, | |
"amp_annotation.classifications.user_explain.Tier II": {}, | |
"amp_annotation.classifications.user_explain.Tier III": {}, | |
"amp_annotation.classifications.user_explain.Tier IV": {}, | |
"amp_annotation.verdict": {}, | |
"amp_annotation.verdict.approx_score": {}, | |
"amp_annotation.verdict.tier": {}, | |
"amp_annotation.version_name": {}, | |
"cadd.cadd_score": 2.5510001182556152, | |
"cancer_hotspots.biotype": {}, | |
"cancer_hotspots.cancer_name.key": {}, | |
"cancer_hotspots.canonical": {}, | |
"cancer_hotspots.total_samples": {}, | |
"cbio": {}, | |
"cbio_portal.ajcc_pathologic_tumor_stage.key": {}, | |
"cbio_portal.cancer_name.key": {}, | |
"cbio_portal.canonical": {}, | |
"cbio_portal.grade": {}, | |
"cbio_portal.hotspot": {}, | |
"chromosome": "chr4", | |
"Coverage": 39, | |
"cytobands": "15q25.1", | |
"dbnsfp_dbscsnv": { | |
"ada_score": [ | |
0.00006838911940576509 | |
], | |
"rf_score": [ | |
0.0020000000949949026 | |
], | |
"version": "v1.1" | |
}, | |
"dbnsfp.aloft_confidence": {}, | |
"dbnsfp.aloft_pred": {}, | |
"dbnsfp.aloft_prob_dominant": {}, | |
"dbnsfp.aloft_prob_recessive": {}, | |
"dbnsfp.aloft_prob_tolerant": {}, | |
"dbnsfp.cadd_phred": {}, | |
"dbnsfp.cadd_raw": {}, | |
"dbnsfp.cadd_raw_rankscore": {}, | |
"dbnsfp.deogen2_pred": {}, | |
"dbnsfp.ensembl_proteinid": {}, | |
"dbnsfp.ensembl_transcriptid": {}, | |
"dbnsfp.fathmm_mkl_coding_pred": {}, | |
"dbnsfp.fathmm_pred": {}, | |
"dbnsfp.lrt_pred": {}, | |
"dbnsfp.metalr_pred": {}, | |
"dbnsfp.metasvm_pred": {}, | |
"dbnsfp.mutationassessor_pred": {}, | |
"dbnsfp.mutationtaster_pred": {}, | |
"dbnsfp.mutpred_score": {}, | |
"dbnsfp.phastcons100way_vertebrate": {}, | |
"dbnsfp.phastcons100way_vertebrate_rankscore": {}, | |
"dbnsfp.phylop100way_vertebrate": {}, | |
"dbnsfp.phylop100way_vertebrate_rankscore": {}, | |
"dbnsfp.polyphen2_hdiv_pred": {}, | |
"dbnsfp.polyphen2_hvar_pred": {}, | |
"dbnsfp.primateai_pred": {}, | |
"dbnsfp.provean_pred": {}, | |
"dbnsfp.revel_score": {}, | |
"dbnsfp.sift_pred": {}, | |
"dbnsfp.sift4g_pred": {}, | |
"ensembl_transcripts": { | |
"items": [ | |
{ | |
"canonical": true, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "1", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": "c.40+63T>G", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 12 position 63 of 5155", | |
"name": "ENST00000331268.9", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": "c.116-5093T>G", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 2 of 12 position 32445 of 37537", | |
"name": "ENST00000379535.8", | |
"splice_distance": "-5093", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "1", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": "c.40+63T>G", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 11 position 63 of 5155", | |
"name": "ENST00000426013.7", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 3 position 63 of 5155", | |
"name": "ENST00000557961.5", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "3", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": "c.-110+63T>G", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 9 position 63 of 13083", | |
"name": "ENST00000558502.5", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 5 position 63 of 5155", | |
"name": "ENST00000558522.5", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "3", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": "c.40+63T>G", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 9 position 63 of 5155", | |
"name": "ENST00000558746.5", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "3", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": "c.-178+63T>G", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 7 position 63 of 7454", | |
"name": "ENST00000558830.5", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "1", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 6 position 63 of 5155", | |
"name": "ENST00000558893.5", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 7 position 63 of 5155", | |
"name": "ENST00000559258.5", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"5'utr" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": "c.-323T>G", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 1 of 12 (5'UTR) position 116 of 214", | |
"name": "ENST00000559345.5", | |
"splice_distance": "-99", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 4 position 63 of 5155", | |
"name": "ENST00000559619.5", | |
"splice_distance": "63", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "5", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 3 position 25039 of 30131", | |
"name": "ENST00000559697.5", | |
"splice_distance": "-5093", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "4", | |
"function": [ | |
"intronic", | |
"splicing", | |
"splicing-ACMG" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": "c.-225+2T>G", | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 7 position 2 of 5094", | |
"name": "ENST00000559930.5", | |
"splice_distance": "2", | |
"strand": "+" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "MORF4L1", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 1 of 6 position 63 of 5155", | |
"name": "ENST00000561171.5", | |
"splice_distance": "63", | |
"strand": "+" | |
} | |
], | |
"version": "103" | |
}, | |
"genotype": "0/1", | |
"gnomad_exomes.ac": {}, | |
"gnomad_exomes.ac_afr": {}, | |
"gnomad_exomes.ac_afr_female": {}, | |
"gnomad_exomes.ac_afr_male": {}, | |
"gnomad_exomes.ac_amr": {}, | |
"gnomad_exomes.ac_amr_female": {}, | |
"gnomad_exomes.ac_amr_male": {}, | |
"gnomad_exomes.ac_asj": {}, | |
"gnomad_exomes.ac_asj_female": {}, | |
"gnomad_exomes.ac_asj_male": {}, | |
"gnomad_exomes.ac_eas": {}, | |
"gnomad_exomes.ac_eas_female": {}, | |
"gnomad_exomes.ac_eas_jpn": {}, | |
"gnomad_exomes.ac_eas_kor": {}, | |
"gnomad_exomes.ac_eas_male": {}, | |
"gnomad_exomes.ac_eas_oea": {}, | |
"gnomad_exomes.ac_female": {}, | |
"gnomad_exomes.ac_fin": {}, | |
"gnomad_exomes.ac_fin_female": {}, | |
"gnomad_exomes.ac_fin_male": {}, | |
"gnomad_exomes.ac_male": {}, | |
"gnomad_exomes.ac_nfe": {}, | |
"gnomad_exomes.ac_nfe_bgr": {}, | |
"gnomad_exomes.ac_nfe_est": {}, | |
"gnomad_exomes.ac_nfe_female": {}, | |
"gnomad_exomes.ac_nfe_male": {}, | |
"gnomad_exomes.ac_nfe_nwe": {}, | |
"gnomad_exomes.ac_nfe_onf": {}, | |
"gnomad_exomes.ac_nfe_seu": {}, | |
"gnomad_exomes.ac_nfe_swe": {}, | |
"gnomad_exomes.ac_oth": {}, | |
"gnomad_exomes.ac_oth_female": {}, | |
"gnomad_exomes.ac_oth_male": {}, | |
"gnomad_exomes.ac_sas": {}, | |
"gnomad_exomes.ac_sas_female": {}, | |
"gnomad_exomes.ac_sas_male": {}, | |
"gnomad_exomes.af": {}, | |
"gnomad_genomes.ac": 14, | |
"gnomad_genomes.ac_afr": {}, | |
"gnomad_genomes.ac_afr_female": {}, | |
"gnomad_genomes.ac_afr_male": {}, | |
"gnomad_genomes.ac_ami": {}, | |
"gnomad_genomes.ac_ami_female": {}, | |
"gnomad_genomes.ac_ami_male": {}, | |
"gnomad_genomes.ac_amr": {}, | |
"gnomad_genomes.ac_amr_female": {}, | |
"gnomad_genomes.ac_amr_male": {}, | |
"gnomad_genomes.ac_asj": 1, | |
"gnomad_genomes.ac_asj_female": {}, | |
"gnomad_genomes.ac_asj_male": 1, | |
"gnomad_genomes.ac_eas": {}, | |
"gnomad_genomes.ac_eas_female": {}, | |
"gnomad_genomes.ac_eas_male": {}, | |
"gnomad_genomes.ac_female": 5, | |
"gnomad_genomes.ac_fin": {}, | |
"gnomad_genomes.ac_fin_female": {}, | |
"gnomad_genomes.ac_fin_male": {}, | |
"gnomad_genomes.ac_male": 9, | |
"gnomad_genomes.ac_nfe": 13, | |
"gnomad_genomes.ac_nfe_female": 5, | |
"gnomad_genomes.ac_nfe_male": 8, | |
"gnomad_genomes.ac_oth": {}, | |
"gnomad_genomes.ac_oth_female": {}, | |
"gnomad_genomes.ac_oth_male": {}, | |
"gnomad_genomes.ac_sas": {}, | |
"gnomad_genomes.ac_sas_female": {}, | |
"gnomad_genomes.ac_sas_male": {}, | |
"gnomad_genomes.af": 0.00009839337672012706, | |
"gwas.items.disease_or_trait": {}, | |
"gwas.items.initial_sample_size": {}, | |
"gwas.items.odds_ratio": {}, | |
"gwas.items.p_value": {}, | |
"gwas.items.pub_med_references": {}, | |
"ncbi_clinvar2.accessions.clinical_significance": {}, | |
"ncbi_clinvar2.accessions.date_created": {}, | |
"ncbi_clinvar2.accessions.diseases": {}, | |
"ncbi_clinvar2.accessions.drug_response": {}, | |
"ncbi_clinvar2.accessions.drug_response.names": {}, | |
"ncbi_clinvar2.accessions.drug_response.pub_med_references": {}, | |
"ncbi_clinvar2.accessions.review_date": {}, | |
"pos": "11232249", | |
"ref": "A", | |
"refseq_transcripts.items.gene_symbol": [ | |
"MORF4L1", | |
"MORF4L1", | |
"MORF4L1", | |
"MORF4L1", | |
"MORF4L1" | |
], | |
"refseq_transcripts.items.hgvs": [ | |
"c.40+63T>G", | |
"c.40+63T>G", | |
"c.-110+63T>G", | |
"c.-323T>G", | |
"c.-225+2T>G" | |
], | |
"regions.NCBI ClinVar CNVs": { | |
"11-May-2021": [ | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000142915", | |
"allele_id": 164602, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20121024, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000179305", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190803, | |
"finding": [ | |
{ | |
"names": [ | |
"Micrognathia" | |
], | |
"symbols": { | |
"HP": "HP:0000347" | |
} | |
}, | |
{ | |
"names": [ | |
"Abnormal Facial Shape" | |
], | |
"symbols": { | |
"HP": "HP:0002260" | |
} | |
} | |
], | |
"origin": "not provided", | |
"review_date": 20121024, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 15q22.2-26.3(chr15:59828460-101920998)x3 AND See cases", | |
"variation_id": 154848 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 164602, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210428, | |
"identifiers": { | |
"dbVar": "nsv916182" | |
}, | |
"last_evaluation": 20210428, | |
"names": [ | |
"GRCh38/hg38 15q22.2-26.3(chr15:59828460-101920998)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 154848 | |
}, | |
"chromo": "chr15", | |
"length": 42092538, | |
"position": 59828460 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000143019", | |
"allele_id": 164706, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20120910, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000179959", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190803, | |
"finding": [ | |
{ | |
"names": [ | |
"Syndactyly" | |
], | |
"symbols": { | |
"HP": "HP:0001159" | |
} | |
}, | |
{ | |
"names": [ | |
"Polyhydramnios" | |
], | |
"symbols": { | |
"HP": "HP:0001561" | |
} | |
}, | |
{ | |
"names": [ | |
"Ventricular Septal Defect" | |
], | |
"symbols": { | |
"HP": "HP:0001629" | |
} | |
}, | |
{ | |
"names": [ | |
"Premature Rupture of Membranes" | |
], | |
"symbols": { | |
"HP": "HP:0001788" | |
} | |
}, | |
{ | |
"names": [ | |
"Duodenal Atresia" | |
], | |
"symbols": { | |
"HP": "HP:0002247" | |
} | |
}, | |
{ | |
"names": [ | |
"Abnormal Facial Shape" | |
], | |
"symbols": { | |
"HP": "HP:0002260" | |
} | |
}, | |
{ | |
"names": [ | |
"Abnormality of the Vertebrae" | |
], | |
"symbols": { | |
"HP": "HP:0003468" | |
} | |
} | |
], | |
"origin": "not provided", | |
"review_date": 20120910, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 15q23-26.3(chr15:72154949-101920998)x3 AND See cases", | |
"variation_id": 154952 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 164706, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210428, | |
"identifiers": { | |
"dbVar": "nsv916864" | |
}, | |
"last_evaluation": 20210428, | |
"names": [ | |
"GRCh38/hg38 15q23-26.3(chr15:72154949-101920998)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 154952 | |
}, | |
"chromo": "chr15", | |
"length": 29766049, | |
"position": 72154949 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000137079", | |
"allele_id": 157730, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20101222, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000177270", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190423, | |
"finding": [ | |
{ | |
"names": [ | |
"Developmental Delay and/or Other Significant Developmental or Morphological Phenotypes" | |
] | |
} | |
], | |
"origin": "not provided", | |
"review_date": 20101222, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 15q24.2-25.1(chr15:76006154-79982417)x1 AND See cases", | |
"variation_id": 147979 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 157730, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210113, | |
"identifiers": { | |
"dbVar": "nsv534493" | |
}, | |
"last_evaluation": 20210113, | |
"names": [ | |
"GRCh38/hg38 15q24.2-25.1(chr15:76006154-79982417)x1" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number loss", | |
"variation_id": 147979 | |
}, | |
"chromo": "chr15", | |
"length": 3976263, | |
"position": 76006154 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000052347", | |
"allele_id": 73171, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000079699", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200801, | |
"finding": [ | |
{ | |
"names": [ | |
"Developmental Delay and/or Other Significant Developmental or Morphological Phenotypes" | |
] | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ARUP Laboratories, Cytogenetics and Genomic Microarray,ARUP Laboratories" | |
} | |
], | |
"title": "GRCh38/hg38 15q24.3-26.3(chr15:77543797-101843411)x3 AND See cases", | |
"variation_id": 58576 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 73171, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210428, | |
"identifiers": { | |
"dbVar": "nsv531059" | |
}, | |
"last_evaluation": 20210428, | |
"names": [ | |
"GRCh38/hg38 15q24.3-26.3(chr15:77543797-101843411)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number gain", | |
"variation_id": 58576 | |
}, | |
"chromo": "chr15", | |
"length": 24299614, | |
"position": 77543797 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000139779", | |
"allele_id": 160745, | |
"clinical_significance": [ | |
"Likely benign" | |
], | |
"date_created": 20140830, | |
"review_date": 20130125, | |
"review_description": "Likely benign", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000180377", | |
"clinical_significance": [ | |
"Likely benign" | |
], | |
"date_updated": 20190423, | |
"finding": [ | |
{ | |
"names": [ | |
"Cleft Palate" | |
], | |
"symbols": { | |
"HP": "HP:0000175" | |
} | |
} | |
], | |
"origin": "maternal", | |
"review_date": 20130125, | |
"review_description": "Likely benign", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 15q25.1(chr15:78198708-78912913)x3 AND See cases", | |
"variation_id": 150994 | |
} | |
], | |
"acmg_class": "Likely Benign", | |
"allele_id": 160745, | |
"clinical_significance": [ | |
"Likely Benign" | |
], | |
"date_created": 20210113, | |
"identifiers": { | |
"dbVar": "nsv917303" | |
}, | |
"last_evaluation": 20210113, | |
"names": [ | |
"GRCh38/hg38 15q25.1(chr15:78198708-78912913)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 150994 | |
}, | |
"chromo": "chr15", | |
"length": 714205, | |
"position": 78198708 | |
} | |
] | |
}, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Subcutaneous": 0.6685580000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Visceral (Omentum)": 0.5622550000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adrenal Gland": 0.556433, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Aorta": 0.823868, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Coronary": 0.6854730000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Tibial": 0.9078350000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Bladder": 0.520227, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Amygdala": 0.409796, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Anterior cingulate cortex (BA24)": 0.536429, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Caudate (basal ganglia)": 0.416285, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellar Hemisphere": 0.8336400000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellum": 0.47487200000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cortex": 0.457229, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Frontal Cortex (BA9)": 0.6810030000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hippocampus": 0.36111400000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hypothalamus": 0.596561, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Nucleus accumbens (basal ganglia)": 0.44833400000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Putamen (basal ganglia)": 0.33435300000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Spinal cord (cervical c-1)": 0.572918, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Substantia nigra": 0.470179, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Breast - Mammary Tissue": 0.592313, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - Cultured fibroblasts": 0.9328590000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - EBV-transformed lymphocytes": 1.08633, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Ectocervix": 0.538315, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Endocervix": 0.540409, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Sigmoid": 0.6110850000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Transverse": 0.46533800000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Gastroesophageal Junction": 0.5768390000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Mucosa": 0.289533, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Muscularis": 0.577343, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Fallopian Tube": 0.513277, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Atrial Appendage": 0.48396100000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Left Ventricle": 0.3599260000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Cortex": 0.38526200000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Medulla": 0.5349740000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Liver": 0.14351900000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Lung": 0.504039, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Minor Salivary Gland": 0.3886780000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Muscle - Skeletal": 0.6683790000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Nerve - Tibial": 0.55976, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Ovary": 0.607476, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pancreas": 0.17377, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pituitary": 0.40231100000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Prostate": 0.34109500000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Not Sun Exposed (Suprapubic)": 0.3059280000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Sun Exposed (Lower leg)": 0.34394700000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Small Intestine - Terminal Ileum": 0.42152800000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Spleen": 0.3493520000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Stomach": 0.32505600000000007, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Testis": 1.05073, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Thyroid": 0.457467, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Uterus": 0.5941250000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Vagina": 0.43483400000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Whole Blood": 0.263871, | |
"variant_type": "SNV", | |
"vcf_barcode": "sample", | |
"zygosity": "Heterozygous" | |
}, | |
{ | |
"acmg_annotation.classifications.user_explain": [ | |
"Null variant (nonsense), in gene LILRA6, for which loss-of-function is a known mechanism of disease (gnomAD Loss-of-Function Observed/Expected = 0.537 is less than 0.763).", | |
"Variant not found in gnomAD exomes (unable to check gnomAD exomes coverage).", | |
"Benign computational verdict based on 1 benign prediction from CADD vs no pathogenic predictions and the position is not strongly conserved (CSH phyloP100way = -3.76 is less than 5)." | |
], | |
"acmg_annotation.coding_impact": "nonsense", | |
"acmg_annotation.gene_id": 12957, | |
"acmg_annotation.gene_symbol": "LILRA6", | |
"acmg_annotation.verdict.ACMG_rules.approx_score": 69, | |
"acmg_annotation.verdict.ACMG_rules.benign_subscore": "Uncertain Significance", | |
"acmg_annotation.verdict.ACMG_rules.pathogenic_subscore": "Likely Pathogenic", | |
"acmg_annotation.verdict.ACMG_rules.verdict": "Likely Pathogenic", | |
"acmg_annotation.version_name": "9.4.6", | |
"Allelic balance": 0.3333333333333333, | |
"all1": "G", | |
"all2": "A", | |
"alt": "T", | |
"amp_annotation.classifications": {}, | |
"amp_annotation.classifications.name": {}, | |
"amp_annotation.classifications.tier": {}, | |
"amp_annotation.classifications.user_explain.Tier I": {}, | |
"amp_annotation.classifications.user_explain.Tier II": {}, | |
"amp_annotation.classifications.user_explain.Tier III": {}, | |
"amp_annotation.classifications.user_explain.Tier IV": {}, | |
"amp_annotation.verdict": {}, | |
"amp_annotation.verdict.approx_score": {}, | |
"amp_annotation.verdict.tier": {}, | |
"amp_annotation.version_name": {}, | |
"cadd.cadd_score": 22.200000762939453, | |
"cancer_hotspots.biotype": {}, | |
"cancer_hotspots.cancer_name.key": {}, | |
"cancer_hotspots.canonical": {}, | |
"cancer_hotspots.total_samples": {}, | |
"cbio": {}, | |
"cbio_portal.ajcc_pathologic_tumor_stage.key": {}, | |
"cbio_portal.cancer_name.key": {}, | |
"cbio_portal.canonical": {}, | |
"cbio_portal.grade": {}, | |
"cbio_portal.hotspot": {}, | |
"chromosome": "chr19", | |
"Coverage": 21, | |
"cytobands": "19q13.42", | |
"dbnsfp_dbscsnv": {}, | |
"dbnsfp.aloft_confidence": null, | |
"dbnsfp.aloft_pred": null, | |
"dbnsfp.aloft_prob_dominant": null, | |
"dbnsfp.aloft_prob_recessive": null, | |
"dbnsfp.aloft_prob_tolerant": null, | |
"dbnsfp.cadd_phred": null, | |
"dbnsfp.cadd_raw": null, | |
"dbnsfp.cadd_raw_rankscore": null, | |
"dbnsfp.deogen2_pred": null, | |
"dbnsfp.ensembl_proteinid": [ | |
"ENSP00000379651", | |
"ENSP00000245621" | |
], | |
"dbnsfp.ensembl_transcriptid": [ | |
"ENST00000396365", | |
"ENST00000245621" | |
], | |
"dbnsfp.fathmm_mkl_coding_pred": null, | |
"dbnsfp.fathmm_pred": null, | |
"dbnsfp.lrt_pred": null, | |
"dbnsfp.metalr_pred": null, | |
"dbnsfp.metasvm_pred": null, | |
"dbnsfp.mutationassessor_pred": null, | |
"dbnsfp.mutationtaster_pred": null, | |
"dbnsfp.mutpred_score": null, | |
"dbnsfp.phastcons100way_vertebrate": 0, | |
"dbnsfp.phastcons100way_vertebrate_rankscore": 0.06391000002622604, | |
"dbnsfp.phylop100way_vertebrate": -3.755000114440918, | |
"dbnsfp.phylop100way_vertebrate_rankscore": 0.004209999926388264, | |
"dbnsfp.polyphen2_hdiv_pred": null, | |
"dbnsfp.polyphen2_hvar_pred": null, | |
"dbnsfp.primateai_pred": null, | |
"dbnsfp.provean_pred": null, | |
"dbnsfp.revel_score": null, | |
"dbnsfp.sift_pred": null, | |
"dbnsfp.sift4g_pred": null, | |
"ensembl_transcripts": { | |
"items": [ | |
{ | |
"canonical": true, | |
"coding_impact": "nonsense", | |
"coding_location": "350 of 482", | |
"ensembl_support_level": "1", | |
"function": [ | |
"NMD", | |
"coding" | |
], | |
"gene_symbol": "LILRA6", | |
"hgvs": "c.1048C>T", | |
"hgvs_p1": "Q350*", | |
"hgvs_p3": "p.Gln350Ter", | |
"location": "exon 6 of 8 position 93 of 303", | |
"name": "ENST00000396365.6", | |
"splice_distance": "93", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": "nonsense", | |
"coding_location": "350 of 465", | |
"ensembl_support_level": "5", | |
"function": [ | |
"NMD", | |
"coding" | |
], | |
"gene_symbol": "LILRA6", | |
"hgvs": "c.1048C>T", | |
"hgvs_p1": "Q350*", | |
"hgvs_p3": "p.Gln350Ter", | |
"location": "exon 6 of 7 position 93 of 303", | |
"name": "ENST00000245621.6", | |
"splice_distance": "93", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "1", | |
"function": [ | |
"non-coding exon" | |
], | |
"gene_symbol": "LILRA6", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "exon 6 of 10 position 93 of 303", | |
"name": "ENST00000430421.5", | |
"splice_distance": "93", | |
"strand": "-" | |
}, | |
{ | |
"canonical": false, | |
"coding_impact": null, | |
"coding_location": null, | |
"ensembl_support_level": "2", | |
"function": [ | |
"intronic" | |
], | |
"gene_symbol": "RPS9", | |
"hgvs": null, | |
"hgvs_p1": null, | |
"hgvs_p3": null, | |
"location": "intron 4 of 4 position 8548 of 15155", | |
"name": "ENST00000448962.5", | |
"splice_distance": "-6608", | |
"strand": "+" | |
} | |
], | |
"version": "103" | |
}, | |
"genotype": "0/1", | |
"gnomad_exomes.ac": {}, | |
"gnomad_exomes.ac_afr": {}, | |
"gnomad_exomes.ac_afr_female": {}, | |
"gnomad_exomes.ac_afr_male": {}, | |
"gnomad_exomes.ac_amr": {}, | |
"gnomad_exomes.ac_amr_female": {}, | |
"gnomad_exomes.ac_amr_male": {}, | |
"gnomad_exomes.ac_asj": {}, | |
"gnomad_exomes.ac_asj_female": {}, | |
"gnomad_exomes.ac_asj_male": {}, | |
"gnomad_exomes.ac_eas": {}, | |
"gnomad_exomes.ac_eas_female": {}, | |
"gnomad_exomes.ac_eas_jpn": {}, | |
"gnomad_exomes.ac_eas_kor": {}, | |
"gnomad_exomes.ac_eas_male": {}, | |
"gnomad_exomes.ac_eas_oea": {}, | |
"gnomad_exomes.ac_female": {}, | |
"gnomad_exomes.ac_fin": {}, | |
"gnomad_exomes.ac_fin_female": {}, | |
"gnomad_exomes.ac_fin_male": {}, | |
"gnomad_exomes.ac_male": {}, | |
"gnomad_exomes.ac_nfe": {}, | |
"gnomad_exomes.ac_nfe_bgr": {}, | |
"gnomad_exomes.ac_nfe_est": {}, | |
"gnomad_exomes.ac_nfe_female": {}, | |
"gnomad_exomes.ac_nfe_male": {}, | |
"gnomad_exomes.ac_nfe_nwe": {}, | |
"gnomad_exomes.ac_nfe_onf": {}, | |
"gnomad_exomes.ac_nfe_seu": {}, | |
"gnomad_exomes.ac_nfe_swe": {}, | |
"gnomad_exomes.ac_oth": {}, | |
"gnomad_exomes.ac_oth_female": {}, | |
"gnomad_exomes.ac_oth_male": {}, | |
"gnomad_exomes.ac_sas": {}, | |
"gnomad_exomes.ac_sas_female": {}, | |
"gnomad_exomes.ac_sas_male": {}, | |
"gnomad_exomes.af": {}, | |
"gnomad_genomes.ac": 479, | |
"gnomad_genomes.ac_afr": 27, | |
"gnomad_genomes.ac_afr_female": 8, | |
"gnomad_genomes.ac_afr_male": 19, | |
"gnomad_genomes.ac_ami": 3, | |
"gnomad_genomes.ac_ami_female": 1, | |
"gnomad_genomes.ac_ami_male": 2, | |
"gnomad_genomes.ac_amr": 58, | |
"gnomad_genomes.ac_amr_female": 23, | |
"gnomad_genomes.ac_amr_male": 35, | |
"gnomad_genomes.ac_asj": 12, | |
"gnomad_genomes.ac_asj_female": 4, | |
"gnomad_genomes.ac_asj_male": 8, | |
"gnomad_genomes.ac_eas": 3, | |
"gnomad_genomes.ac_eas_female": 2, | |
"gnomad_genomes.ac_eas_male": 1, | |
"gnomad_genomes.ac_female": 245, | |
"gnomad_genomes.ac_fin": 60, | |
"gnomad_genomes.ac_fin_female": 25, | |
"gnomad_genomes.ac_fin_male": 35, | |
"gnomad_genomes.ac_male": 234, | |
"gnomad_genomes.ac_nfe": 300, | |
"gnomad_genomes.ac_nfe_female": 173, | |
"gnomad_genomes.ac_nfe_male": 127, | |
"gnomad_genomes.ac_oth": 11, | |
"gnomad_genomes.ac_oth_female": 7, | |
"gnomad_genomes.ac_oth_male": 4, | |
"gnomad_genomes.ac_sas": 5, | |
"gnomad_genomes.ac_sas_female": 2, | |
"gnomad_genomes.ac_sas_male": 3, | |
"gnomad_genomes.af": 0.005055942579691788, | |
"gwas.items.disease_or_trait": {}, | |
"gwas.items.initial_sample_size": {}, | |
"gwas.items.odds_ratio": {}, | |
"gwas.items.p_value": {}, | |
"gwas.items.pub_med_references": {}, | |
"ncbi_clinvar2.accessions.clinical_significance": {}, | |
"ncbi_clinvar2.accessions.date_created": {}, | |
"ncbi_clinvar2.accessions.diseases": {}, | |
"ncbi_clinvar2.accessions.drug_response": {}, | |
"ncbi_clinvar2.accessions.drug_response.names": {}, | |
"ncbi_clinvar2.accessions.drug_response.pub_med_references": {}, | |
"ncbi_clinvar2.accessions.review_date": {}, | |
"pos": "80750600", | |
"ref": "G", | |
"refseq_transcripts.items.gene_symbol": [ | |
"LILRA6", | |
"LILRA6" | |
], | |
"refseq_transcripts.items.hgvs": [ | |
"c.1048C>T", | |
null | |
], | |
"regions.NCBI ClinVar CNVs": { | |
"11-May-2021": [ | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000052914", | |
"allele_id": 73711, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000080268", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20210227, | |
"finding": [ | |
{ | |
"names": [ | |
"Developmental Delay and/or Other Significant Developmental or Morphological Phenotypes" | |
] | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "GeneDx" | |
} | |
], | |
"title": "GRCh38/hg38 19q13.33-13.43(chr19:47908540-58539965)x3 AND See cases", | |
"variation_id": 59116 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 73711, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210424, | |
"identifiers": { | |
"dbVar": "nsv531628" | |
}, | |
"last_evaluation": 20210424, | |
"names": [ | |
"GRCh38/hg38 19q13.33-13.43(chr19:47908540-58539965)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number gain", | |
"variation_id": 59116 | |
}, | |
"chromo": "chr19", | |
"length": 10631425, | |
"position": 47908540 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000052915", | |
"allele_id": 73712, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000080269", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20210227, | |
"finding": [ | |
{ | |
"names": [ | |
"Seizure" | |
], | |
"symbols": { | |
"HP": "HP:0001250" | |
} | |
}, | |
{ | |
"names": [ | |
"Abnormal Facial Shape" | |
], | |
"symbols": { | |
"HP": "HP:0001999" | |
} | |
}, | |
{ | |
"names": [ | |
"Failure to Thrive" | |
], | |
"symbols": { | |
"HP": "HP:0001508" | |
} | |
}, | |
{ | |
"names": [ | |
"Global Developmental Delay" | |
], | |
"symbols": { | |
"HP": "HP:0001263" | |
} | |
}, | |
{ | |
"names": [ | |
"Cleft Upper Lip" | |
], | |
"symbols": { | |
"HP": "HP:0000204" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "GeneDx" | |
} | |
], | |
"title": "GRCh38/hg38 19q13.33-13.43(chr19:47929575-58572206)x3 AND See cases", | |
"variation_id": 59117 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 73712, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210424, | |
"identifiers": { | |
"dbVar": "nsv531629" | |
}, | |
"last_evaluation": 20210424, | |
"names": [ | |
"GRCh38/hg38 19q13.33-13.43(chr19:47929575-58572206)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number gain", | |
"variation_id": 59117 | |
}, | |
"chromo": "chr19", | |
"length": 10642631, | |
"position": 47929575 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000052925", | |
"allele_id": 73721, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000080279", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200801, | |
"finding": [ | |
{ | |
"names": [ | |
"Developmental Delay and/or Other Significant Developmental or Morphological Phenotypes" | |
] | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ISCA site 15" | |
} | |
], | |
"title": "GRCh38/hg38 19q13.33-13.43(chr19:49907832-58557889)x3 AND See cases", | |
"variation_id": 59126 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 73721, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210307, | |
"identifiers": { | |
"dbVar": "nsv531638" | |
}, | |
"last_evaluation": 20210307, | |
"names": [ | |
"GRCh38/hg38 19q13.33-13.43(chr19:49907832-58557889)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number gain", | |
"variation_id": 59126 | |
}, | |
"chromo": "chr19", | |
"length": 8650057, | |
"position": 49907832 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000135843", | |
"allele_id": 156330, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20101019, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000175847", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200326, | |
"finding": [ | |
{ | |
"names": [ | |
"Abnormal Facial Shape" | |
], | |
"symbols": { | |
"HP": "HP:0001999" | |
} | |
}, | |
{ | |
"names": [ | |
"Global Developmental Delay" | |
], | |
"symbols": { | |
"HP": "HP:0001263" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20101019, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ISCA site 8" | |
} | |
], | |
"title": "GRCh38/hg38 19q13.33-13.43(chr19:50152520-58581203)x3 AND See cases", | |
"variation_id": 146579 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 156330, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210307, | |
"identifiers": { | |
"dbVar": "nsv533121" | |
}, | |
"last_evaluation": 20210307, | |
"names": [ | |
"GRCh38/hg38 19q13.33-13.43(chr19:50152520-58581203)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 146579 | |
}, | |
"chromo": "chr19", | |
"length": 8428683, | |
"position": 50152520 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000050883", | |
"allele_id": 71814, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000078216", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20200801, | |
"finding": [ | |
{ | |
"names": [ | |
"Developmental Delay and/or Other Significant Developmental or Morphological Phenotypes" | |
] | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "ISCA site 4" | |
} | |
], | |
"title": "GRCh38/hg38 19q13.33-13.43(chr19:50191219-58535818)x3 AND See cases", | |
"variation_id": 57219 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 71814, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210307, | |
"identifiers": { | |
"dbVar": "nsv529462" | |
}, | |
"last_evaluation": 20210307, | |
"names": [ | |
"GRCh38/hg38 19q13.33-13.43(chr19:50191219-58535818)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number gain", | |
"variation_id": 57219 | |
}, | |
"chromo": "chr19", | |
"length": 8344599, | |
"position": 50191219 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000052926", | |
"allele_id": 73722, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20130802, | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000080280", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20210227, | |
"finding": [ | |
{ | |
"names": [ | |
"Posteriorly Rotated Ears" | |
], | |
"symbols": { | |
"HP": "HP:0000358" | |
} | |
} | |
], | |
"method": "clinical testing", | |
"origin": "not provided", | |
"review_date": 20110812, | |
"review_description": "Pathogenic", | |
"review_status": "criteria provided, single submitter", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20140621, | |
"submitter_name": "GeneDx" | |
} | |
], | |
"title": "GRCh38/hg38 19q13.41-13.43(chr19:51141518-58539965)x3 AND See cases", | |
"variation_id": 59127 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 73722, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210307, | |
"identifiers": { | |
"dbVar": "nssv578813" | |
}, | |
"last_evaluation": 20210307, | |
"names": [ | |
"GRCh38/hg38 19q13.41-13.43(chr19:51141518-58539965)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 1, | |
"review_status": "criteria provided, single submitter", | |
"type": "copy number gain", | |
"variation_id": 59127 | |
}, | |
"chromo": "chr19", | |
"length": 7398447, | |
"position": 51141518 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000142008", | |
"allele_id": 163472, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140830, | |
"review_date": 20130819, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000183142", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190423, | |
"finding": [ | |
{ | |
"names": [ | |
"Seizures" | |
], | |
"symbols": { | |
"HP": "HP:0001250" | |
} | |
}, | |
{ | |
"names": [ | |
"Global Developmental Delay" | |
], | |
"symbols": { | |
"HP": "HP:0001263" | |
} | |
} | |
], | |
"origin": "not provided", | |
"review_date": 20130819, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 19q13.41-13.43(chr19:52143873-58445521)x3 AND See cases", | |
"variation_id": 153721 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 163472, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210307, | |
"identifiers": { | |
"dbVar": "nsv995715" | |
}, | |
"last_evaluation": 20210307, | |
"names": [ | |
"GRCh38/hg38 19q13.41-13.43(chr19:52143873-58445521)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 153721 | |
}, | |
"chromo": "chr19", | |
"length": 6301648, | |
"position": 52143873 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000134174", | |
"allele_id": 154513, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140829, | |
"review_date": 20100819, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000173688", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190423, | |
"finding": [ | |
{ | |
"names": [ | |
"Developmental Delay and/or Other Significant Developmental or Morphological Phenotypes" | |
] | |
} | |
], | |
"origin": "not provided", | |
"review_date": 20100819, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 19q13.41-13.43(chr19:52612432-58581203)x3 AND See cases", | |
"variation_id": 144762 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 154513, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210307, | |
"identifiers": { | |
"dbVar": "nsv492295" | |
}, | |
"last_evaluation": 20210307, | |
"names": [ | |
"GRCh38/hg38 19q13.41-13.43(chr19:52612432-58581203)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 144762 | |
}, | |
"chromo": "chr19", | |
"length": 5968771, | |
"position": 52612432 | |
}, | |
{ | |
"ClinVarRegionJson": { | |
"accessions": [ | |
{ | |
"accession_id": "RCV000134139", | |
"allele_id": 154460, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20140829, | |
"review_date": 20100818, | |
"review_description": "Pathogenic", | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submissions": [ | |
{ | |
"accession_id": "SCV000173632", | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_updated": 20190423, | |
"finding": [ | |
{ | |
"names": [ | |
"Developmental Delay and/or Other Significant Developmental or Morphological Phenotypes" | |
] | |
} | |
], | |
"origin": "not provided", | |
"review_date": 20100818, | |
"review_description": "Pathogenic", | |
"review_status": "no assertion criteria provided", | |
"submission_description": [ | |
"" | |
], | |
"submitter_date": 20170926, | |
"submitter_name": "ISCA site 1" | |
} | |
], | |
"title": "GRCh38/hg38 19q13.41-13.43(chr19:52955056-58581203)x3 AND See cases", | |
"variation_id": 144709 | |
} | |
], | |
"acmg_class": "Pathogenic", | |
"allele_id": 154460, | |
"clinical_significance": [ | |
"Pathogenic" | |
], | |
"date_created": 20210307, | |
"identifiers": { | |
"dbVar": "nsv492226" | |
}, | |
"last_evaluation": 20210307, | |
"names": [ | |
"GRCh38/hg38 19q13.41-13.43(chr19:52955056-58581203)x3" | |
], | |
"num_submissions": 1, | |
"num_submitters": 1, | |
"review_stars": 0, | |
"review_status": "no assertion criteria provided", | |
"type": "copy number gain", | |
"variation_id": 144709 | |
}, | |
"chromo": "chr19", | |
"length": 5626147, | |
"position": 52955056 | |
} | |
] | |
}, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Subcutaneous": 0.241575, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adipose - Visceral (Omentum)": 0.3245180000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Adrenal Gland": 0.135574, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Aorta": 0.13739800000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Coronary": 0.18175700000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Artery - Tibial": 0.046465200000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Bladder": 0.09753340000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Amygdala": 0.016219400000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Anterior cingulate cortex (BA24)": 0.009879280000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Caudate (basal ganglia)": 0.013765900000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellar Hemisphere": 0.00503735, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cerebellum": 0.006600660000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Cortex": 0.013201300000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Frontal Cortex (BA9)": 0.0066875100000000015, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hippocampus": 0.011290600000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Hypothalamus": 0.018325500000000005, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Nucleus accumbens (basal ganglia)": 0.011203800000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Putamen (basal ganglia)": 0.011855100000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Spinal cord (cervical c-1)": 0.04972210000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Brain - Substantia nigra": 0.021669300000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Breast - Mammary Tissue": 0.09588330000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - Cultured fibroblasts": 0.0005645310000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cells - EBV-transformed lymphocytes": 0.012571700000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Ectocervix": 0.0477245, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Cervix - Endocervix": 0.06409590000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Sigmoid": 0.09484110000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Colon - Transverse": 0.08852270000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Gastroesophageal Junction": 0.08732850000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Mucosa": 0.026836900000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Esophagus - Muscularis": 0.101659, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Fallopian Tube": 0.265503, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Atrial Appendage": 0.0808581, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Heart - Left Ventricle": 0.05743010000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Cortex": 0.05836370000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Kidney - Medulla": 0.073758, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Liver": 0.0648775, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Lung": 0.903834, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Minor Salivary Gland": 0.07779660000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Muscle - Skeletal": 0.027271100000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Nerve - Tibial": 0.09814140000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Ovary": 0.03241710000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pancreas": 0.027683700000000006, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Pituitary": 0.04503210000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Prostate": 0.05315270000000002, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Not Sun Exposed (Suprapubic)": 0.021213300000000004, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Skin - Sun Exposed (Lower leg)": 0.027097400000000008, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Small Intestine - Terminal Ileum": 0.08893520000000003, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Spleen": 1.76381, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Stomach": 0.043512200000000015, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Testis": 0.03265590000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Thyroid": 0.05845060000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Uterus": 0.04757250000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Vagina": 0.04118900000000001, | |
"regions.NIH GTEx.v8.GTExJsonData.expressions.Whole Blood": 8.201669999999998, | |
"variant_type": "SNV", | |
"vcf_barcode": "sample", | |
"zygosity": "Heterozygous" | |
} | |
] |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment