This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| cutadapt -g ^GACTCATCCCATTTTTGAGTCCGATTTCGATTGTCTAACAG -o ${SAMPLE}_SL_R1.fq -p ${SAMPLE}_SL_R2.fq --untrimmed-output ${SAMPLE}_noSL_R1.fq --untrimmed-paired-output ${SAMPLE}_noSL_R2.fq ${SAMPLE}_BC_ATCATA_READ1.fq ${SAMPLE}_BC_ATCATA_READ2.fq |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| plate <- data.frame( Row = rep(LETTERS[1:16], 24) | |
| , Col = unlist(lapply(1:24, rep, 16))) | |
| plate$Row <- factor(plate$Row, levels=rev(levels(plate$Row))) | |
| set.seed(1) | |
| plate[001:096, "val"] <- rpois(96,10) | |
| plate[097:384, "val"] <- rpois(96, 6) | |
| # Plot with ggplot2 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| NOTE: this patch is not needed anymore, since NIST started to distribute | |
| the spike sequences at the following URL. | |
| https://www-s.nist.gov/srmors/certificates/documents/SRM2374_putative_T7_products_NoPolyA_v1.fasta | |
| Description: Adds linker sequences to ERCC (NIST SRM2374) spikes | |
| The U.S. National Institute of Standards and Technology (NIST) | |
| provides the sequence of the inserts that have been cloned | |
| into plasmids to create the External RNA Controls Consortium | |
| (ERCC) spikes. These spikes are commercially available as |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # Charles Plessy, RIKEN | |
| # https://creativecommons.org/publicdomain/zero/1.0/ | |
| # curl --silent https://gist.githubusercontent.com/charles-plessy/9dbc8bc98fb773bf71b6/raw | tee getAndParseGencode.bash | bash | |
| # Comments starting with ##!! signal Linux/OSX portability traps | |
| # Setup | |
| # ===== |