eterna_recalculated.py

def eterna_recalculated(row,scale_max=2.3):
    """Helper method that recalculates the Eterna score for an entry from a dataframe. It will then put the score back into the row. Please note that there is not a 1:1 correspondence between the actual and recalculated scores"""
    assert len(row["target_structure"]) == len(row["sequence"])
    # sometimes there is a fingerprint sequence at the end of the sturcutre, If that is the case it needs to be removed
    sequence = re.sub("AAAGAAACAACAACAACAAC$","",row["sequence"])
    # data_len is the number of data points that will be reviewed
    data_len = min(
            len(row["target_structure"]),
            len(row["SHAPE_data"]), # can probably get rid of this one
            len(sequence),
            sum([1 for val in row["SHAPE_data"] if val > 0]) # making sure that the SHAPE is not 0
            )
    # with the index length figured out, we can get the score, scale_factor and unpaired_bound for use in the calculations
    score = 0
    scale_factor = scale_max/max(row["SHAPE_data"])
    unpaired_bound = min(0.25,row["threshold_SHAPE"])
    for index in range(data_len):
        # for each position, nee the secondary structure as well as the normalized shape and normalized shape error
        ss = row["target_structure"][index]
        shape = row["SHAPE_data"][index]*scale_factor
        error = row["SHAPE_error"][index]*scale_factor
        if ss == '.' and shape  + error > unpaired_bound:
            score += 1
        elif ss != '.' and shape - error < 2*unpaired_bound:
            score += 1
    # with the calculations done, can assign the score
    row["eterna_score_recalculated"] = score/data_len