| import * as Octokit from '@octokit/rest' | |
| const client = new Octokit() | |
| export default class GithubClient { | |
| public static async authenticate({username, password, twoFactorCode}: any) { | |
| client.authenticate({ | |
| type: 'basic', | |
| username: username, |
| ... | |
| # Prometheus | |
| config :prometheus, MyApp.PhoenixInstrumenter, | |
| controller_call_labels: [:controller, :action], | |
| duration_buckets: [10, 25, 50, 100, 250, 500, 1000, 2500, 5000, | |
| 10_000, 25_000, 50_000, 100_000, 250_000, 500_000, | |
| 1_000_000, 2_500_000, 5_000_000, 10_000_000], | |
| registry: :default, | |
| duration_unit: :microseconds |
| - name: Disallow password authentication | |
| lineinfile: | |
| dest: /etc/ssh/sshd_config | |
| regexp: "^PasswordAuthentication" | |
| line: "PasswordAuthentication no" | |
| state: present | |
| notify: Restart ssh | |
| - name: Disallow root SSH access | |
| lineinfile: |
| +---------+ +-------+ +-----+ +---------+ +---------------+ | |
| | GitHub | | Slack | | CI | | Jenkins | | ArtifactRepo | | |
| +---------+ +-------+ +-----+ +---------+ +---------------+ | |
| -----------------------\ | | | | | | |
| | Pull Request opened. |-| | |
As APIs evolve due to changing software requirements, it becomes necessary to version them so as to not break consumers' usage. This specification defines how API versions are specified for APIs built at RentPath and how requests not conforming to this specification are to be handled.
The key words "MUST", "MUST NOT", "REQUIRED", "SHALL", "SHALL NOT", "SHOULD", "SHOULD NOT", "RECOMMENDED", "MAY", and "OPTIONAL" in this document are to be interpreted as described in IETF RFC 2119.
| ----------------------------------------------- | |
| -- Auto Config Reload | |
| ----------------------------------------------- | |
| function reloadConfig(files) | |
| doReload = false | |
| for _,file in pairs(files) do | |
| if file:sub(-4) == ".lua" then | |
| doReload = true | |
| end | |
| end |
| defmodule DNA do | |
| @doc ~S""" | |
| Count the respective number of times that the symbols 'A', 'C', 'G', and 'T' in a given string. | |
| Returns the count as four integers separated by spaces, representing occureneces of "A", "C", "G", and "T" respectively. | |
| ## Examples | |
| iex> DNA.count("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") | |
| "20 12 17 21" |
| defmodule Foo.Plugs.CopyReqBody do | |
| import Plug.Conn | |
| def init(mount: "/" <> mount), do: mount | |
| def call(conn = %Plug.Conn{path_info: [mount | _rest]}, mount) do | |
| put_private(conn, :req_body, read_body(conn)) | |
| end | |
| def call(conn, _), do: conn |
| source 'https://rubygems.org' | |
| # Bundle edge Rails instead: gem 'rails', github: 'rails/rails' | |
| gem 'rails', '4.2.2' | |
| # Use sqlite3 as the database for Active Record | |
| gem 'sqlite3' | |
| # Use SCSS for stylesheets | |
| gem 'sass-rails', '~> 5.0' | |
| # Use Uglifier as compressor for JavaScript assets |
| server { | |
| listen 80 default_server; | |
| rewrite ^ https://$server_name$request_uri? permanent; | |
| } | |
| server { | |
| listen 443 ssl default_server; | |
| ssl_certificate /etc/nginx/ssl/ssl-bundle.crt; |