Skip to content

Instantly share code, notes, and snippets.

@danaj
Created October 11, 2011 04:50
Show Gist options
  • Select an option

  • Save danaj/1277319 to your computer and use it in GitHub Desktop.

Select an option

Save danaj/1277319 to your computer and use it in GitHub Desktop.
A faster fasta
# The Computer Language Benchmarks game
# http://shootout.alioth.debian.org/
#
# contributed by David Pyke
# tweaked by Danny Sauer
# optimized by Steffen Mueller
# tweaked by Kuang-che Wu
# optimized by Rodrigo de Oliveira
# modified by Dana Jacobsen
use strict;
use warnings;
use constant IM => 139968;
use constant IA => 3877;
use constant IC => 29573;
use constant LINELENGTH => 60;
use constant TSIZE => 512;
my $iub = [
[ 'a', 0.27 ],
[ 'c', 0.12 ],
[ 'g', 0.12 ],
[ 't', 0.27 ],
[ 'B', 0.02 ],
[ 'D', 0.02 ],
[ 'H', 0.02 ],
[ 'K', 0.02 ],
[ 'M', 0.02 ],
[ 'N', 0.02 ],
[ 'R', 0.02 ],
[ 'S', 0.02 ],
[ 'V', 0.02 ],
[ 'W', 0.02 ],
[ 'Y', 0.02 ]
];
my $homosapiens = [
[ 'a', 0.3029549426680 ],
[ 'c', 0.1979883004921 ],
[ 'g', 0.1975473066391 ],
[ 't', 0.3015094502008 ]
];
my $alu =
'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
my $LAST = 42;
sub gen_random {
return map { ($LAST = ($LAST * IA + IC) % IM) / IM} (1 .. $_[0]);
}
sub makeCumulative {
my $genelist = shift;
my $cp = 0.0;
$_->[1] = $cp += $_->[1] foreach @$genelist;
}
sub makeRandomFasta {
my ($id, $desc, $n, $genelist) = @_;
print ">", $id, " ", $desc, "\n";
my @chars = map { $_->[0] } @$genelist;
my @probs = map { $_->[1] } @$genelist;
# $tab[$x] is defined if all FP in the interval [$x/TSIZE, ($x+1)/TSIZE]
# map to a single gene.
my @tab;
foreach my $i (0 .. TSIZE-1) {
my $ldiv = 0.0 + $i / TSIZE;
my $udiv = 0.0 + ($i+1) / TSIZE;
my $lidx = scalar grep { $_ < $ldiv } @probs;
my $uidx = scalar grep { $_ < $udiv } @probs;
$tab[$i] = $chars[$lidx] if $lidx == $uidx;
}
# print whole lines
foreach (1 .. int($n / LINELENGTH) ) {
my @r = gen_random(LINELENGTH);
my $s = '';
foreach my $r (@r) {
$s .= $tab[int($r*TSIZE)] || $chars[ scalar grep { $_ < $r } @probs ];
}
print $s, "\n";
}
# print remaining line (if required)
if ($n % LINELENGTH) {
my @r = gen_random($n % LINELENGTH);
my $s = '';
foreach my $r (@r) {
$s .= $tab[int($r*TSIZE)] || $chars[ scalar grep { $_ < $r } @probs ];
}
print $s, "\n";
}
}
sub makeRepeatFasta {
my ($id, $desc, $s, $n) = @_;
print ">", $id, " ", $desc, "\n";
my $r = length $s;
my $ss = $s . $s . substr($s, 0, $n % $r);
for my $j(0..int($n / LINELENGTH)-1) {
my $i = $j*LINELENGTH % $r;
print substr($ss, $i, LINELENGTH), "\n";
}
if ($n % LINELENGTH) {
print substr($ss, -($n % LINELENGTH)), "\n";
}
}
######################################################################
#main
my $n = $ARGV[0] || 1000;
makeCumulative($iub);
makeCumulative($homosapiens);
makeRepeatFasta ('ONE', 'Homo sapiens alu', $alu, $n*2);
makeRandomFasta ('TWO', 'IUB ambiguity codes', $n*3, $iub);
makeRandomFasta ('THREE', 'Homo sapiens frequency', $n*6, $homosapiens);
@danaj

danaj commented Oct 11, 2011

Copy link
Copy Markdown
Author

Note that Rodrigo's version is much faster, but relies on the particular random number generator having a very short cycle. This version does not cache any random numbers and does not rely on the particular generator. This code is in fact, much more like perl #4 than Rodrigo's, but because his code gave me ideas, I chose to view his as the direct ancestor.

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment