| { | |
| "title": "Extend", | |
| "rules": [ | |
| { | |
| "description": "Extend", | |
| "manipulators": [ | |
| { | |
| "type": "basic", | |
| "from": { | |
| "key_code": "1", |
| #!/usr/bin/perl -w | |
| use strict; | |
| use warnings; | |
| =head1 | |
| Author: [email protected] | |
| This script converts a JGI gtf-like file: | |
| scaffold_1 JGI exon 46078 46218 . + . name "gw.1.597.1"; transcriptId 65742 |
| #!/usr/bin/perl | |
| use strict; | |
| my $usage = "cat input.gtf | $! idlist.txt > filtered.gtf\n"; | |
| my %ids; | |
| my $FN_idlist = $ARGV[0]; | |
| open my $FH_idlist, "<", $FN_idlist or die $usage; | |
| # read id list to memory |
SAM and BAM filtering one-liners
@author: David Fredman, [email protected] (sans poly-A tail)
@dependencies: http://sourceforge.net/projects/bamtools/ and http://samtools.sourceforge.net/
Please extend with additional/faster/better solutions via a pull request!
BWA mapping (using piping for minimal disk I/O)
The git command-line utility has plenty of inconsistencies http://steveko.wordpress.com/2012/02/24/10-things-i-hate-about-git/
A GUI like http://sourcetreeapp.com is often helpful, but staying on the command line usually quicker. This is a list of the commands I use most frequently, listed by functional category:
git status list which (unstaged) files have changed
The procedure below documents how to install the IBM Tivoli client on the Ubuntu linux distribution. The steps involve unpacking the distributed RPMs, removing and renaming a few files in the resulting folders, and editing and adding a few configuration text files, followed by packaging .deb files for installation.
Adapted from http://adsm.org/forum/showthread.php?21143-How-To-Install-TSM-Client-552-on-Ubuntu-10.04-amd64
Current versions: IBM Tivoli 6.4.0 Ubuntu 12.10
| #go to last active window (hit C-b twice) | |
| bind-key C-b last-window | |
| #split windows key bindings | |
| unbind % | |
| bind | split-window -h | |
| bind - split-window -v | |
| #status bar | |
| set -g status-bg black | |
| set -g status-fg white | |
| set -g status-left '#[fg=green]#H' |
| use Test::More tests => 15; | |
| use Pattern; | |
| use Restriction; | |
| use strict; | |
| use warnings; | |
| # sequences for testing | |
| my $testsequence0 = "AAAAAAAAAACGATCTAAAAAAA" ; #should not match | |
| my $testsequence1 = "AAAAAAAAAAAGATCCAAAAAAA" ; #should match | |
| my $testsequence2 = "AAAAAAAAAAGGATCTAAAAAAA" ; #should match |
Sending one datastream to a unix command is made by piping (e.g. zcat seq1.fq.gz | seqs). These examples demonstrate how to pipe multiple data streams to one *nix command.
Credit and additional examples:
This works in bash and zsh, but not csh shells.
| escape ^Tt | |
| caption string "%?%F%{= Bk}%? %C%A %D %d-%m-%Y %{= kB} %t%= %?%F%{= Bk}%:%{= wk}%? %n " | |
| shell bash | |
| defscrollback 10000 | |
| hardstatus on | |
| hardstatus alwayslastline | |
| hardstatus string '%{= kG}[ %{G}%H %{g}][%= %{= kw}%?%-Lw%?%{r}(%{W}%n*%f%t%?(%u)%?%{r})%{w}%?%+Lw%?%?%= %{g}][%{B} %d/%m %{W}%c %{g}]' | |
| vbell off |