Skip to content

Instantly share code, notes, and snippets.

View davfre's full-sized avatar

David Fredman davfre

View GitHub Profile
@davfre
davfre / extend.json
Created April 1, 2022 05:51 — forked from 39aldo39/extend.json
Karabiner-Elements extend
{
"title": "Extend",
"rules": [
{
"description": "Extend",
"manipulators": [
{
"type": "basic",
"from": {
"key_code": "1",
@davfre
davfre / jgi2gtf.pl
Last active August 29, 2015 14:04
Convert JGI gtf-like annotation file to GTF2.2 format
#!/usr/bin/perl -w
use strict;
use warnings;
=head1
Author: [email protected]
This script converts a JGI gtf-like file:
scaffold_1 JGI exon 46078 46218 . + . name "gw.1.597.1"; transcriptId 65742
@davfre
davfre / filterById.pl
Last active August 29, 2015 14:04
Filter a textfile to output only the lines where a given identifier is present.
#!/usr/bin/perl
use strict;
my $usage = "cat input.gtf | $! idlist.txt > filtered.gtf\n";
my %ids;
my $FN_idlist = $ARGV[0];
open my $FH_idlist, "<", $FN_idlist or die $usage;
# read id list to memory
@davfre
davfre / bamfilter_oneliners.md
Last active December 9, 2025 09:48
SAM and BAM filtering oneliners
@davfre
davfre / git_cheat-sheet.md
Last active May 3, 2026 16:43
git commandline cheat-sheet
@davfre
davfre / IBM Tivoli 6.4.0 Installation on Ubuntu 12.10.md
Last active August 29, 2022 18:42
Installation procedure for the IBM Tivoli 6.4.0 client for Ubuntu 12.10.

The procedure below documents how to install the IBM Tivoli client on the Ubuntu linux distribution. The steps involve unpacking the distributed RPMs, removing and renaming a few files in the resulting folders, and editing and adding a few configuration text files, followed by packaging .deb files for installation.

Adapted from http://adsm.org/forum/showthread.php?21143-How-To-Install-TSM-Client-552-on-Ubuntu-10.04-amd64

Current versions: IBM Tivoli 6.4.0 Ubuntu 12.10

@davfre
davfre / .tmux.conf
Created December 5, 2012 10:06
tmux config
#go to last active window (hit C-b twice)
bind-key C-b last-window
#split windows key bindings
unbind %
bind | split-window -h
bind - split-window -v
#status bar
set -g status-bg black
set -g status-fg white
set -g status-left '#[fg=green]#H'
@davfre
davfre / Pattern.t
Created November 14, 2012 07:25
Test script for AppliedProgramming course, Exercise 6
use Test::More tests => 15;
use Pattern;
use Restriction;
use strict;
use warnings;
# sequences for testing
my $testsequence0 = "AAAAAAAAAACGATCTAAAAAAA" ; #should not match
my $testsequence1 = "AAAAAAAAAAAGATCCAAAAAAA" ; #should match
my $testsequence2 = "AAAAAAAAAAGGATCTAAAAAAA" ; #should match
@davfre
davfre / MultiPipingExamples.md
Created October 31, 2012 12:50
# Multiple pipes to/from one process
@davfre
davfre / .screenrc
Created October 22, 2012 07:06
screenrc
escape ^Tt
caption string "%?%F%{= Bk}%? %C%A %D %d-%m-%Y %{= kB} %t%= %?%F%{= Bk}%:%{= wk}%? %n "
shell bash
defscrollback 10000
hardstatus on
hardstatus alwayslastline
hardstatus string '%{= kG}[ %{G}%H %{g}][%= %{= kw}%?%-Lw%?%{r}(%{W}%n*%f%t%?(%u)%?%{r})%{w}%?%+Lw%?%?%= %{g}][%{B} %d/%m %{W}%c %{g}]'
vbell off