The Baylor-09, Baylor-10, and Baylor-11 samples have been uploaded to SRA, but need to be organized. The following workflow was created for this task.
First, download the metadata file with SRA accessions from https://submit.ncbi.nlm.nih.gov
Then, run the following bash command to parse out the identifiers from the files. As long as you use a unique identifier, such as sample_name, and only search through the downloaded files, the following command will work:
This writeup will provide instruction and a template to follow when creating submissions to the SRA archive.
You must have a NCBI account before beginning. Note that if you have an existing account from another institution, you may use that account, but be advised that it may be better to register for a new account that links you to your current institution.
Login to NCBI. From the home page, if you click the submission wizard link, it will show you all of the possible submissions. If you select Sequence Read Archive, it will take you to a help page.
This is the first of a series of write-ups that demonstrate using Bash tricks to solve an Informatics Problem.
The format is the Overview section briefly describes the Problem, and describes pitfalls and difficulties.
The Method section describes any relevant background and CS theory, note it may be blank.
The Solution section describes how to solve the described problem.
This problem involves one approach to fix a malformed fasta file. Briefly, a fasta file must have the format:
>some_header Spaces allowed
AATTCCGGAACCGGAACCAA
This markdown file contains the steps involved in configuring a new computer, runnning Ubuntu 16.04, to run ONT Guppy GPU basecalling.
Given a Peptide Array with region R of l columns and w rows, what is the probability that a randomly selected l * r region is indicative of contamination?
N = Number of tested regions, where each tested region is defined as a Bernoulli trial r = success, where success is defined as above a contamination threshold p = probability of contamination, for example, 4 positive luminescent values within a total possible 10 values would be 4/10 = 0.4
This gist provides the steps to take when setting up CUDA on Ubuntu 16.04, along with comments and advice. Before starting, it is critical to both read through this guide, and to research what NVIDIA drivers are required for your GPU. Do not rely on the installer to do this for you, and in the event of a conflict between the driver that you looked up and the driver that is suggested by the installer, always go with what you looked up.
There are two main ways to install CUDA on Ubuntu.
This is the first of a series of write-ups that demonstrate using Bash tricks to solve an Informatics Problem.
The format is the Overview section briefly describes the Problem, and describes pitfalls and difficulties.
The Method section describes any relevant background and CS theory, note it may be blank.
The Solution section describes how to solve the described problem.
A BAM file is suspected of being corrupted, due to EOF errors in an analysis. The file was re-downloaded, but the same EOF/truncated error appeared at the end of the analysis, and caused the command to fail.
Two steps will be taken to validate the BAM file: re-verify the checksum, and scanning the file in depth.
The former can be done quickly, while the latter will be time and computing intensive. Both will be described here.
Outliers are a common problem in statistical analysis. It is critical to ensure that bias is not accidentally introduced when any dataset is filtered for datapoints that are outside of an expected range. Generally speaking, removing outliers follows a guideline that datapoints may be removed if they incorrectly influence the analysis in a way that is not consistent with the experimental design. Criteria for filtering should always be established ahead of time, and never be changed after the fact.
Several methods exist for filtering. One is Cook's Test, or Cook's Distance, which measures the affect outlier datapoints have on the remaining datapoints, and if that change is outside a predetermined threshold. Cook's Distance can be implemented in R, Graphpad Prism, and other statistical analysis software.
In this instance, the dataset was being tested for normalcy as part of a larger workflow. A [QQ-plot](https://stats.sta
Applescript has a long and somewhat storied history with Apple. It dates back to OS 'Classic', and has been intermittently updated and forgotten over the decades. Although elements of AppleScript can be seen in Swift, and Objective-C to a degree, AppleScript shares very little in common syntactically with either.
Particularly with the advent of Swift, AppleScript has fallen to the wayside, although it is still extremely useful in certain situations, such as automation, or an interface with Bash and the Apple GUI.
Let's say you want to run more advanced tasks, like clicking a button or link on a webpage.
Building from the previous gist on AppleScript, create an AppleScript file with the following function:
Applescript has a long and somewhat storied history with Apple. It dates back to OS 'Classic', and has been intermittently updated and forgotten over the decades. Although elements of AppleScript can be seen in Swift, and Objective-C to a degree, AppleScript shares very little in common syntactically with either.
Particularly with the advent of Swift, AppleScript has fallen to the wayside, although it is still extremely useful in certain situations, such as automation, or an interface with Bash and the Apple GUI.
The basic usage via Bash (or Terminal) is:
osascript OPTION [COMMAND || SCRIPTNAME]