Skip to content

Instantly share code, notes, and snippets.

@even4void
Created January 7, 2022 19:31
Show Gist options
  • Select an option

  • Save even4void/eaf85cec81c52b64db69f91586fa73d8 to your computer and use it in GitHub Desktop.

Select an option

Save even4void/eaf85cec81c52b64db69f91586fa73d8 to your computer and use it in GitHub Desktop.
Fast Fasta TUI viewer
#!/usr/bin/env python3
import os
import statistics
import sys
from Bio import SeqIO
term_width = os.get_terminal_size().columns
term_height = os.get_terminal_size().lines
id_width = 15
default_color = "\033[0m"
bold_color = "\033[1m"
underline_color = "\033[4m"
orange_color = "\033[33m"
sep = " ... "
def gc(x):
"""Compute GC content."""
val = sum([x.seq.count(k) for k in ["g", "c"]]) / len(x.seq) * 100
return val
def process(file):
records = list(SeqIO.parse(file, "fasta"))
nr = len(records)
avg_len = round(statistics.mean([len(r.seq) for r in records]), 1)
avg_gc = round(statistics.mean([gc(r) for r in records]), 1)
trunc = False
if nr > term_height - 2:
records = (
records[: int((term_height - 1) / 2)]
+ records[-(int((term_height - 1) / 2)) :]
)
trunc = True
nr_trunc = len(records)
opt = "(" + str(nr_trunc) + " displayed) " if trunc else ""
header = (
underline_color
+ str(nr)
+ " seq. "
+ opt
+ "avg length: "
+ str(avg_len)
+ " GC: "
+ str(avg_gc)
+ "%"
+ default_color
)
print(header)
for r in records:
if len(str(r.id)) < id_width:
id = str(r.id).ljust(id_width)
else:
id = str(r.id)[: id_width - 1].ljust(id_width)
seq = str(r.seq).lower()
seq_width = int((term_width - id_width - len(sep)) / 2)
lineout = (
bold_color + id + default_color + seq[:seq_width] + sep + seq[-seq_width:]
)
print(lineout)
if __name__ == "__main__":
process(sys.argv[1])
@even4void

even4void commented Jan 7, 2022

Copy link
Copy Markdown
Author

Homemade previewer for Fasta files (require Biopython). There are better alternatives.

Preview:

~ % fasview tmp/aa.fasta                                                                                                                                                                                   
7 seq. avg length: 514.7 GC: 0.0%
S_Podospora_an agggatcattaaagagttgcaagactcccacaaaccatcgcgaaccgaacccctgagcagttgcttcggcgggccggccccccaccgcggggcg ... tcacctcgctgcggagtggcgcgggcgcctgccgtgaaacccccgacccccaaaggttgacctcggatcaggtaggaatacccgctgaacttaa
CBS112042_Podo agggatcattaaagagttgcaagactcccacaaaccatcgcgaaccgaacccctgagcagttgcttcggcgggccggccccccaccgcggggcg ... tcacctcgctgcggagtggcgcgggcgcctgccgtgaaacccccgacccccaaaggttgacctcggatcaggtaggaatacccgctgaacttaa
T_Podospora_co agggatcattaaagagttgcaaaactcccacaaaccatcgcgaaccaaacccctgagcagttgcttcggcgggccggccccccaccgcggggcg ... acctcgctgcggagtggcgcgggcgcctgccgtgaaacccccgacccccccaaaggttgacctcggatcaggtaggaatacccgctgaacttaa
CBS411.78_Podo agggatcattaaagagttgcaagactcccacaaaccatcgcgaaccgaacccctgagcagttgcttcggcgggccggccccccaccgcggggcg ... tcacctcgctgcggagtggcgcgggcgcctgccgtgaaacccccgaccaccaaaggttgacctcggatcaggtaggaatacccgctgaacttaa
CBS237-71_Podo agggatcattaaagagttgcaagactcccacaaaccatcgcgaaccgaacccctgagcagttgcttcggcgggccggccccccaccgcggggcg ... tcacctcgctgcggagtggcgcgggcgcctgccgtgaaacccccgacccccaaaggttgacctcggatcaggtaggaatacccgctgaacttaa
CBS253.71_Podo agggatcattaaagagttgcaagactcccacaaaccatcgcgaaccgaacccctgagcagttgcttcggcgggccggccccccaccgcggggcg ... tcacctcgctgcggagtggcgcgggcgcctgccgtgaaacccccgaccaccaaaggttgacctcggatcaggtaggaatacccgctgaacttaa
CBS415.72_Podo agggatcattaaagagttgcaagactcccacaaaccatcgcgaaccgaacccctgagcagttgcttcggcgggccggccccccaccgcggggcg ... cacctcgctgcggagtggcgcgggcgcctgccgtgaaacccccgaccccccaaaggttgacctcggatcaggtaggaatacccgctgaacttaa
~

(Bold syntax and underline rendered in terminal only.)

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment