fpopic
/ signals.tsv
Last active
August 1, 2017 22:42
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| timestamp | rssi | stations_id | distributed_tags_id | |
|---|---|---|---|---|
| 2016-06-11 10:03:38 | -79 | 58 | 837 | |
| 2016-06-11 10:03:42 | -86 | 58 | 837 | |
| 2016-06-11 10:03:43 | -78 | 58 | 837 | |
| 2016-06-11 10:03:45 | -79 | 58 | 837 | |
| 2016-06-11 10:03:45 | -80 | 58 | 837 | |
| 2016-06-11 10:03:46 | -78 | 58 | 837 | |
| 2016-06-11 10:03:49 | -79 | 58 | 837 | |
| 2016-06-11 10:03:49 | -79 | 58 | 837 | |
| 2016-06-11 10:03:50 | -81 | 58 | 837 |
fpopic
/ gist:62881238ba1657cc9af61a23ebdbbbfd
Created
July 9, 2017 11:46
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| hdfs dfs -copyFromLocal /home/rovkp/fpopic/movielens-ratings-small.csv.formated.indexed /user/rovkp/fpopic/movielens-ratings-small.csv.formated.indexed | |
| hdfs dfs -copyFromLocal /home/rovkp/fpopic/abcd.csv.indexed /user/rovkp/fpopic/abcd.csv.indexed | |
| spark2-submit --class hr.fer.ztel.thesis.Main --master yarn --deploy-mode cluster --driver-memory 5530m --executor-memory 5530m --conf spark.dynamicAllocation.maxExecutors=28 --conf spark.executor.heartbeatInterval=20s --conf spark.network.timeout=240s --conf spark.locality.wait=6s --conf spark.yarn.maxAppAttempts=1 /home/rovkp/fpopic/spark-recommender-assembly-1.0.jar blocks hdfs:///user/rovkp/fpopic/ movielens-ratings-small.csv.formated.indexed abcd.csv.indexed llr true movielens_llr_true_2048 5 2048 | |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| package hr.fer.ztel.thesis | |
| import breeze.linalg.argtopk | |
| import hr.fer.ztel.thesis.spark.MLlibBlockMatrixMultiplyVersion220._ | |
| import org.apache.log4j.{Level, Logger} | |
| import org.apache.spark.mllib.linalg.MLlibBreezeConversions._ | |
| import org.apache.spark.mllib.linalg.distributed.{CoordinateMatrix, MatrixEntry} | |
| import org.apache.spark.sql.SparkSession | |
| import org.scalatest.{BeforeAndAfter, FlatSpec, Matchers} |
fpopic
/ MainActivity.java
Last active
March 1, 2017 15:45
— forked from pillona/MainActivity.java
main class
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| package com.demo.youtubeinvideoviewdemo; | |
| import android.content.Intent; | |
| import android.os.Bundle; | |
| import android.os.Environment; | |
| import android.os.StrictMode; | |
| import android.util.Log; | |
| import android.view.Menu; | |
| import android.view.MenuItem; | |
| import android.widget.Toast; |
fpopic
/ gist:4e5685312506310da6501df69af5b561
Created
January 29, 2017 14:14
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Je li možete provjeriti jesu li testni primjeri #8 #9 unutar zadanih dimenzija iz upute: | |
| R, S (1 ≤ R,S ≤ 1000) | |
| N, Ri, Si (1 ≤ N ≤ 1000, 1 ≤ Ri,Si ≤ 100) | |
| jer samo ta dva padaju na memorijskom ograničenju? | |
| Moja računica za najgori slucaj i 64bitne velicine podatka: | |
| R x S x sizeof(char) = 1000 x 1000 x 2B = 2 x 10^6 = 8 MB // velicina matrice |
fpopic
/ gist:d3c21196edeea4bb0b963de0a51d4b4e
Last active
January 16, 2017 09:02
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| cmake --build cmake-build-debug --target debruijn.exe -- -j 4 | |
| cmake --build cmake-build-debug --target debruijn_tests.exe -- -j 4 | |
| // pokretanje ogirinalne | |
| ./a1.x input.fa izlaz kfile.txt | |
| // pokretanje aplikacije | |
| ./debruijn.exe test/res/input/ecoli_1x1e6.fasta test/res/input/10.k A1 test/res/output/ecoli_1x1e6 | |
| //pokretanje njihovog |
fpopic
/ hash_pair_ints.cpp
Last active
January 14, 2017 11:00
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| // to enable O(1) lookup for unordered containers | |
| // XOR (^) and SHIFT (<<,>>) operations will make (5,3) != (3,5) | |
| namespace std { | |
| template<typename T, typename U> | |
| class hash<pair<T, U>> { | |
| public : | |
| size_t operator()(const pair<T, U>& p) const { | |
| size_t seed = 0; | |
| seed ^= p.first + 0x9e3779b9 + (seed << 6) + (seed >> 2); | |
| seed ^= p.second + 0x9e3779b9 + (seed << 6) + (seed >> 2); |
fpopic
/ gist:066dc3d2d67cce4ff1f2725e71c0ccc4
Created
January 13, 2017 21:21
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| digraph G { | |
| 0 [label="2,11:5"] | |
| 0 -> 5 | |
| 0 -> 2 | |
| 1 [label="6,7,8:3"] | |
| 1 -> 3 | |
| 1 -> 1 | |
| 1 -> 1 | |
| 2 [label="14:5"] | |
| 3 [label="9:4"] |
fpopic
/ gist:9579fde0cbea46e1dc5f377a9b91079c
Created
January 12, 2017 19:14
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >1 | |
| AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC | |
| TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA | |
| TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC | |
| ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG | |
| CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA | |
| GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC | |
| AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTG | |
| AAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTT | |
| GACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTT |
fpopic
/ gist:8d5e6a5c79dfad0e03d4c4e0c2536838
Created
January 8, 2017 00:01
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Skip to content | |
| Search… | |
| All gists | |
| GitHub | |
| New gist @fpopic | |
| Star 0 | |
| Fork 0 | |
| @azuzulazuzul/gist:abd429728d0fb085897e63d77b02b4a8 Secret |