Created
November 23, 2018 13:45
-
-
Save giorgiosironi/361fbd4eacc52ee6e46078d386ddd2e7 to your computer and use it in GitHub Desktop.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| { | |
| "journal": { | |
| "id": "eLife", | |
| "title": "eLife", | |
| "issn": "2050-084X" | |
| }, | |
| "snippet": { | |
| "-meta": { | |
| "location": "/home/giorgio/code/bot-lax-adaptor/elife-00666-v1.xml" | |
| }, | |
| "-history": { | |
| "received": "2016-03-01T00:00:00Z", | |
| "accepted": "2016-04-01T00:00:00Z" | |
| }, | |
| "status": "vor", | |
| "id": "00666", | |
| "version": 1, | |
| "type": "research-article", | |
| "doi": "10.7554/eLife.00666", | |
| "authorLine": "Melissa Harrison Jnr et al.", | |
| "title": "The eLife research article", | |
| "published": "2016-04-25T00:00:00Z", | |
| "versionDate": "2016-04-25T00:00:00Z", | |
| "volume": 5, | |
| "elocationId": "e00666", | |
| "pdf": "https://cdn.elifesciences.org/articles/00666/elife-00666-v1.pdf", | |
| "xml": "https://cdn.elifesciences.org/articles/00666/elife-00666-v1.xml", | |
| "figuresPdf": "https://cdn.elifesciences.org/articles/00666/elife-00666-figures-v1.pdf", | |
| "subjects": [ | |
| { | |
| "id": "cell-biology", | |
| "name": "Cell Biology" | |
| }, | |
| { | |
| "id": "plant-biology", | |
| "name": "Plant Biology" | |
| } | |
| ], | |
| "researchOrganisms": [ | |
| "Human", | |
| "Machine" | |
| ], | |
| "abstract": { | |
| "content": [ | |
| { | |
| "text": "This is the abstract. This article will describe the eLife article and the process. An abstract can contain any formatting, such as <i>italics</i>, <b>bold</b>, <sup>superscript</sup>, <sub>subscript</sub> or <span class=\"small-caps\">small caps</span>. MathML is also allowed: <math> <mrow> <munder> <mo/> <mi>m</mi> </munder> <mrow> <msub> <mover accent=\"true\"> <mi>p</mi> <mo/> </mover> <mi>m</mi> </msub> <mo>=</mo> <mn>0</mn> </mrow> </mrow> </math> .", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "eLife does not structure abstracts into sub headings expect in a clinical trial article, but the abstract can have multiple paragarahs. The sub DOI is always .001 as it is the first asset in any article. I have added an unmatched > bracket as this has been an issue for PubMed deposits in the past.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "If this was a clinical trial the clinical trial details would be listed at the end of the abstract:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Clinical trial Registration: EudraCT2004-000446-20.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.001" | |
| }, | |
| "copyright": { | |
| "license": "CC-BY-4.0", | |
| "holder": "Harrison et al.", | |
| "statement": "This article is distributed under the terms of the <a href=\"http://creativecommons.org/licenses/by/4.0/\">Creative\n Commons Attribution License</a>, which permits unrestricted use\n and redistribution provided that the original author and source are\n credited." | |
| }, | |
| "authors": [ | |
| { | |
| "additionalInformation": [ | |
| " This footnote text must work in isolation as nothing is processed on the html view to make it \"work\"" | |
| ], | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "Department of Production", | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "competingInterests": "Chair of JATS4R", | |
| "contribution": "Completed the XML mapping exercise and wrote this XML example", | |
| "deceased": true, | |
| "emailAddresses": [ | |
| "m.harrison@elifesciences.org" | |
| ], | |
| "equalContributionGroups": [ | |
| 1 | |
| ], | |
| "name": { | |
| "index": "Harrison, Melissa, Jnr", | |
| "preferred": "Melissa Harrison Jnr" | |
| }, | |
| "orcid": "0000-0003-3523-4408", | |
| "postalAddresses": [ | |
| { | |
| "components": { | |
| "streetAddress": [ | |
| " Department of Wellcome Trust, Sanger Institute, London, United Kingdom" | |
| ] | |
| }, | |
| "formatted": [ | |
| " Department of Wellcome Trust, Sanger Institute, London, United Kingdom" | |
| ] | |
| } | |
| ], | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "Department of Production", | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "competingInterests": "No competing interests declared", | |
| "contribution": "Contributed to the XML mapping exercise and quality checked all the tagging and content", | |
| "equalContributionGroups": [ | |
| 1 | |
| ], | |
| "name": { | |
| "index": "Gilbert, James F", | |
| "preferred": "James F Gilbert" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "Department of Production", | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "competingInterests": "No competing interests declared", | |
| "contribution": "Reviewed the PDF product", | |
| "equalContributionGroups": [ | |
| 2 | |
| ], | |
| "groups": { | |
| "Editing group": [ | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Chan, Wei Mun", | |
| "preferred": "Wei Mun Chan" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Drury, Hannah", | |
| "preferred": "Hannah Drury" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Guerreiro, Maria", | |
| "preferred": "Maria Guerreiro" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Richmond, Susanna", | |
| "preferred": "Susanna Richmond" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "Writing group": [ | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Shearer, Alistair", | |
| "preferred": "Alistair Shearer" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| }, | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife Institute" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Caton, Hannah", | |
| "preferred": "Hannah Caton" | |
| }, | |
| "type": "person" | |
| } | |
| ] | |
| }, | |
| "name": "eLife Editorial Production Group", | |
| "type": "group" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "Department of Technology", | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "competingInterests": "Graham Nott is not an eLife employee", | |
| "contribution": "Chris Wilkinson, Performed the XML mapping exercise and generated the JSON Schema Graham Nott, Wrote the JATSscraper Luke Skibinski, Identified missing components from the JATSscraper", | |
| "emailAddresses": [ | |
| "c.wilkinson@elifesciences.org" | |
| ], | |
| "equalContributionGroups": [ | |
| 2 | |
| ], | |
| "name": "eLife Technology Group", | |
| "people": [ | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "Canada", | |
| "locality": [ | |
| "Victoria" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Victoria", | |
| "Canada" | |
| ] | |
| }, | |
| "name": [ | |
| "Graham Nott Enterprises" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Nott, Graham", | |
| "preferred": "Graham Nott" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Wilkinson, Chris", | |
| "preferred": "Chris Wilkinson" | |
| }, | |
| "orcid": "0000-0003-4921-6155", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Skibinski, Luke", | |
| "preferred": "Luke Skibinski" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "type": "group" | |
| }, | |
| { | |
| "onBehalfOf": "for the eLife Staff Team", | |
| "type": "on-behalf-of" | |
| } | |
| ], | |
| "reviewers": [ | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom" | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Harrison, Melissa", | |
| "preferred": "Melissa Harrison" | |
| }, | |
| "role": "Senior Editor", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom" | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife Sciences" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Collings, Andy", | |
| "preferred": "Andy Collings" | |
| }, | |
| "role": "Reviewing Editor", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom" | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife Sciences" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Collings, Andrew", | |
| "preferred": "Andrew Collings" | |
| }, | |
| "role": "Reviewing Editor", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United States" | |
| }, | |
| "formatted": [ | |
| "United States" | |
| ] | |
| }, | |
| "name": [ | |
| "Stanford University" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Darian-Smith, Corinna ", | |
| "preferred": "Corinna Darian-Smith" | |
| }, | |
| "role": "Reviewer", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom" | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "John Innes Centre" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Smith, Alison M.", | |
| "preferred": "Alison M. Smith" | |
| }, | |
| "role": "Reviewer", | |
| "type": "person" | |
| } | |
| ], | |
| "ethics": [ | |
| { | |
| "text": "Human subjects: If Research Ethics Committee and Institutional Review Board approval was required for this article the details would be listed here.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Animal subjects: If there were animal subjects involved in the study the approval number for the research along with protocol approval would be listed here.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "If this article was part of a clinical trial the Clinical trial registry and ID would be listed here, for example:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Clinical trial Registry: EudraCT.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Registration ID: EudraCT2004-000446-20.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "funding": { | |
| "awards": [ | |
| { | |
| "awardId": "F32 GM089018", | |
| "id": "fund1", | |
| "recipients": [ | |
| { | |
| "name": { | |
| "index": "Harrison, Melissa", | |
| "preferred": "Melissa Harrison" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "source": { | |
| "funderId": "10.13039/100000011", | |
| "name": [ | |
| "Howard Hughes Medical Institute" | |
| ] | |
| } | |
| }, | |
| { | |
| "id": "fund2", | |
| "recipients": [ | |
| { | |
| "name": "\n<string-name>eLife Technology Group</string-name>\n", | |
| "type": "group" | |
| } | |
| ], | |
| "source": { | |
| "name": [ | |
| "Laura and John Arnold Foundation" | |
| ] | |
| } | |
| } | |
| ], | |
| "statement": "The funders had no role in study design; collection, analysis,\n and interpretation of data; writing the article; and or the decision to submit\n to the journal." | |
| }, | |
| "additionalFiles": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "A file containing underlying data.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.019", | |
| "filename": "elife-00666-supp1.csv", | |
| "id": "supp1", | |
| "label": "Supplementary file 1", | |
| "mediaType": "application/csv", | |
| "title": "This is the title of the supplementary file 1.", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-supp1.csv" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.020", | |
| "filename": "elife-00666-data1.xlsx", | |
| "id": "sdata1", | |
| "label": "Source data 1", | |
| "mediaType": "application/xlsx", | |
| "title": "This is the title of the source data that is not attached to a specific figure, but to the article as a whole.", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-data1.xlsx" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.021", | |
| "filename": "elife-00666-code1.xml", | |
| "id": "scode1", | |
| "label": "Source code 1", | |
| "mediaType": "application/xml", | |
| "title": "This is the title of the source code that is not attached to a specific figure, but to the article as a whole.", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-code1.xml" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.034", | |
| "filename": "elife-00666-repstand1.pdf", | |
| "id": "repstand1", | |
| "label": "Consort checklist and flow diagram", | |
| "mediaType": "application/pdf", | |
| "title": "CONSORT checklist", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-repstand1.pdf" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.022", | |
| "filename": "elife-00666-transrepform.pdf", | |
| "id": "transrepform", | |
| "label": "Transparent reporting form", | |
| "mediaType": "application/pdf", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-transrepform.pdf" | |
| } | |
| ], | |
| "dataSets": { | |
| "availability": [ | |
| { | |
| "text": "A data availability statement will generally describe how the authors have provided the source data for their work. This can list the source data files accompanying their figures, supplementary files, and/or external dataasets. Hyperlinks can be included here, for example: <a href=\"https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE102999\">https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE102999</a>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "generated": [ | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "D\u00fcsterwald, KM", | |
| "preferred": "KM D\u00fcsterwald" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Currin, CB", | |
| "preferred": "CB Currin" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Burman, RJ", | |
| "preferred": "RJ Burman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Akerman, CJ", | |
| "preferred": "CJ Akerman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Kay, AR", | |
| "preferred": "AR Kay" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Raimondo, JV", | |
| "preferred": "JV Raimondo" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2018", | |
| "details": "Data from: Biophysical models reveal the relative importance of transporter proteins\n and impermeant anions in chloride homeostasis", | |
| "doi": "10.5061/dryad.kj1f3v4", | |
| "id": "dataset1", | |
| "title": "Dryad Digital Repository" | |
| } | |
| ], | |
| "used": [ | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Rau, CD", | |
| "preferred": "CD Rau" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Wang, J", | |
| "preferred": "J Wang" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Wang, Y", | |
| "preferred": "Y Wang" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Lusis, AJ", | |
| "preferred": "AJ Lusis" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2013", | |
| "details": "Transcriptomes of the hybrid mouse diversity panel subjected to\n Isoproterenol challenge", | |
| "id": "dataset2", | |
| "title": "NCBI Gene Expression Omnibus", | |
| "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE48760" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Garcia, Miguel A", | |
| "preferred": "Miguel A Garcia" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2018", | |
| "details": "Shear Manuscript", | |
| "id": "dataset3", | |
| "title": "Open Science Framework", | |
| "uri": "https://osf.io/kvu5j/" | |
| } | |
| ] | |
| }, | |
| "impactStatement": "How to tag an eLife article using JATS XML." | |
| }, | |
| "article": { | |
| "-meta": { | |
| "location": "/home/giorgio/code/bot-lax-adaptor/elife-00666-v1.xml", | |
| "patched": true | |
| }, | |
| "-history": { | |
| "received": "2016-03-01T00:00:00Z", | |
| "accepted": "2016-04-01T00:00:00Z" | |
| }, | |
| "status": "vor", | |
| "id": "00666", | |
| "version": 1, | |
| "type": "research-article", | |
| "doi": "10.7554/eLife.00666", | |
| "authorLine": "Melissa Harrison Jnr et al.", | |
| "title": "The eLife research article", | |
| "published": "2016-04-25T00:00:00Z", | |
| "versionDate": "2016-04-25T00:00:00Z", | |
| "volume": 5, | |
| "elocationId": "e00666", | |
| "pdf": "https://cdn.elifesciences.org/articles/00666/elife-00666-v1.pdf", | |
| "xml": "https://cdn.elifesciences.org/articles/00666/elife-00666-v1.xml", | |
| "figuresPdf": "https://cdn.elifesciences.org/articles/00666/elife-00666-figures-v1.pdf", | |
| "subjects": [ | |
| { | |
| "id": "cell-biology", | |
| "name": "Cell Biology" | |
| }, | |
| { | |
| "id": "plant-biology", | |
| "name": "Plant Biology" | |
| } | |
| ], | |
| "researchOrganisms": [ | |
| "Human", | |
| "Machine" | |
| ], | |
| "abstract": { | |
| "content": [ | |
| { | |
| "text": "This is the abstract. This article will describe the eLife article and the process. An abstract can contain any formatting, such as <i>italics</i>, <b>bold</b>, <sup>superscript</sup>, <sub>subscript</sub> or <span class=\"small-caps\">small caps</span>. MathML is also allowed: <math> <mrow> <munder> <mo/> <mi>m</mi> </munder> <mrow> <msub> <mover accent=\"true\"> <mi>p</mi> <mo/> </mover> <mi>m</mi> </msub> <mo>=</mo> <mn>0</mn> </mrow> </mrow> </math> .", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "eLife does not structure abstracts into sub headings expect in a clinical trial article, but the abstract can have multiple paragarahs. The sub DOI is always .001 as it is the first asset in any article. I have added an unmatched > bracket as this has been an issue for PubMed deposits in the past.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "If this was a clinical trial the clinical trial details would be listed at the end of the abstract:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Clinical trial Registration: EudraCT2004-000446-20.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.001" | |
| }, | |
| "copyright": { | |
| "license": "CC-BY-4.0", | |
| "holder": "Harrison et al.", | |
| "statement": "This article is distributed under the terms of the <a href=\"http://creativecommons.org/licenses/by/4.0/\">Creative\n Commons Attribution License</a>, which permits unrestricted use\n and redistribution provided that the original author and source are\n credited." | |
| }, | |
| "authors": [ | |
| { | |
| "additionalInformation": [ | |
| " This footnote text must work in isolation as nothing is processed on the html view to make it \"work\"" | |
| ], | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "Department of Production", | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "competingInterests": "Chair of JATS4R", | |
| "contribution": "Completed the XML mapping exercise and wrote this XML example", | |
| "deceased": true, | |
| "emailAddresses": [ | |
| "m.harrison@elifesciences.org" | |
| ], | |
| "equalContributionGroups": [ | |
| 1 | |
| ], | |
| "name": { | |
| "index": "Harrison, Melissa, Jnr", | |
| "preferred": "Melissa Harrison Jnr" | |
| }, | |
| "orcid": "0000-0003-3523-4408", | |
| "postalAddresses": [ | |
| { | |
| "components": { | |
| "streetAddress": [ | |
| " Department of Wellcome Trust, Sanger Institute, London, United Kingdom" | |
| ] | |
| }, | |
| "formatted": [ | |
| " Department of Wellcome Trust, Sanger Institute, London, United Kingdom" | |
| ] | |
| } | |
| ], | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "Department of Production", | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "competingInterests": "No competing interests declared", | |
| "contribution": "Contributed to the XML mapping exercise and quality checked all the tagging and content", | |
| "equalContributionGroups": [ | |
| 1 | |
| ], | |
| "name": { | |
| "index": "Gilbert, James F", | |
| "preferred": "James F Gilbert" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "Department of Production", | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "competingInterests": "No competing interests declared", | |
| "contribution": "Reviewed the PDF product", | |
| "equalContributionGroups": [ | |
| 2 | |
| ], | |
| "groups": { | |
| "Editing group": [ | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Chan, Wei Mun", | |
| "preferred": "Wei Mun Chan" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Drury, Hannah", | |
| "preferred": "Hannah Drury" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Guerreiro, Maria", | |
| "preferred": "Maria Guerreiro" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Richmond, Susanna", | |
| "preferred": "Susanna Richmond" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "Writing group": [ | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Shearer, Alistair", | |
| "preferred": "Alistair Shearer" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| }, | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife Institute" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Caton, Hannah", | |
| "preferred": "Hannah Caton" | |
| }, | |
| "type": "person" | |
| } | |
| ] | |
| }, | |
| "name": "eLife Editorial Production Group", | |
| "type": "group" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "Department of Technology", | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "competingInterests": "Graham Nott is not an eLife employee", | |
| "contribution": "Chris Wilkinson, Performed the XML mapping exercise and generated the JSON Schema Graham Nott, Wrote the JATSscraper Luke Skibinski, Identified missing components from the JATSscraper", | |
| "emailAddresses": [ | |
| "c.wilkinson@elifesciences.org" | |
| ], | |
| "equalContributionGroups": [ | |
| 2 | |
| ], | |
| "name": "eLife Technology Group", | |
| "people": [ | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "Canada", | |
| "locality": [ | |
| "Victoria" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Victoria", | |
| "Canada" | |
| ] | |
| }, | |
| "name": [ | |
| "Graham Nott Enterprises" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Nott, Graham", | |
| "preferred": "Graham Nott" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Wilkinson, Chris", | |
| "preferred": "Chris Wilkinson" | |
| }, | |
| "orcid": "0000-0003-4921-6155", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom", | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge", | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Skibinski, Luke", | |
| "preferred": "Luke Skibinski" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "type": "group" | |
| }, | |
| { | |
| "onBehalfOf": "for the eLife Staff Team", | |
| "type": "on-behalf-of" | |
| } | |
| ], | |
| "reviewers": [ | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom" | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Harrison, Melissa", | |
| "preferred": "Melissa Harrison" | |
| }, | |
| "role": "Senior Editor", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom" | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife Sciences" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Collings, Andy", | |
| "preferred": "Andy Collings" | |
| }, | |
| "role": "Reviewing Editor", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom" | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "eLife Sciences" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Collings, Andrew", | |
| "preferred": "Andrew Collings" | |
| }, | |
| "role": "Reviewing Editor", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United States" | |
| }, | |
| "formatted": [ | |
| "United States" | |
| ] | |
| }, | |
| "name": [ | |
| "Stanford University" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Darian-Smith, Corinna ", | |
| "preferred": "Corinna Darian-Smith" | |
| }, | |
| "role": "Reviewer", | |
| "type": "person" | |
| }, | |
| { | |
| "affiliations": [ | |
| { | |
| "address": { | |
| "components": { | |
| "country": "United Kingdom" | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "John Innes Centre" | |
| ] | |
| } | |
| ], | |
| "name": { | |
| "index": "Smith, Alison M.", | |
| "preferred": "Alison M. Smith" | |
| }, | |
| "role": "Reviewer", | |
| "type": "person" | |
| } | |
| ], | |
| "ethics": [ | |
| { | |
| "text": "Human subjects: If Research Ethics Committee and Institutional Review Board approval was required for this article the details would be listed here.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Animal subjects: If there were animal subjects involved in the study the approval number for the research along with protocol approval would be listed here.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "If this article was part of a clinical trial the Clinical trial registry and ID would be listed here, for example:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Clinical trial Registry: EudraCT.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Registration ID: EudraCT2004-000446-20.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "funding": { | |
| "awards": [ | |
| { | |
| "awardId": "F32 GM089018", | |
| "id": "fund1", | |
| "recipients": [ | |
| { | |
| "name": { | |
| "index": "Harrison, Melissa", | |
| "preferred": "Melissa Harrison" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "source": { | |
| "funderId": "10.13039/100000011", | |
| "name": [ | |
| "Howard Hughes Medical Institute" | |
| ] | |
| } | |
| }, | |
| { | |
| "id": "fund2", | |
| "recipients": [ | |
| { | |
| "name": "\n<string-name>eLife Technology Group</string-name>\n", | |
| "type": "group" | |
| } | |
| ], | |
| "source": { | |
| "name": [ | |
| "Laura and John Arnold Foundation" | |
| ] | |
| } | |
| } | |
| ], | |
| "statement": "The funders had no role in study design; collection, analysis,\n and interpretation of data; writing the article; and or the decision to submit\n to the journal." | |
| }, | |
| "additionalFiles": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "A file containing underlying data.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.019", | |
| "filename": "elife-00666-supp1.csv", | |
| "id": "supp1", | |
| "label": "Supplementary file 1", | |
| "mediaType": "application/csv", | |
| "title": "This is the title of the supplementary file 1.", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-supp1.csv" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.020", | |
| "filename": "elife-00666-data1.xlsx", | |
| "id": "sdata1", | |
| "label": "Source data 1", | |
| "mediaType": "application/xlsx", | |
| "title": "This is the title of the source data that is not attached to a specific figure, but to the article as a whole.", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-data1.xlsx" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.021", | |
| "filename": "elife-00666-code1.xml", | |
| "id": "scode1", | |
| "label": "Source code 1", | |
| "mediaType": "application/xml", | |
| "title": "This is the title of the source code that is not attached to a specific figure, but to the article as a whole.", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-code1.xml" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.034", | |
| "filename": "elife-00666-repstand1.pdf", | |
| "id": "repstand1", | |
| "label": "Consort checklist and flow diagram", | |
| "mediaType": "application/pdf", | |
| "title": "CONSORT checklist", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-repstand1.pdf" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.022", | |
| "filename": "elife-00666-transrepform.pdf", | |
| "id": "transrepform", | |
| "label": "Transparent reporting form", | |
| "mediaType": "application/pdf", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-transrepform.pdf" | |
| } | |
| ], | |
| "dataSets": { | |
| "availability": [ | |
| { | |
| "text": "A data availability statement will generally describe how the authors have provided the source data for their work. This can list the source data files accompanying their figures, supplementary files, and/or external dataasets. Hyperlinks can be included here, for example: <a href=\"https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE102999\">https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE102999</a>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "generated": [ | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "D\u00fcsterwald, KM", | |
| "preferred": "KM D\u00fcsterwald" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Currin, CB", | |
| "preferred": "CB Currin" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Burman, RJ", | |
| "preferred": "RJ Burman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Akerman, CJ", | |
| "preferred": "CJ Akerman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Kay, AR", | |
| "preferred": "AR Kay" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Raimondo, JV", | |
| "preferred": "JV Raimondo" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2018", | |
| "details": "Data from: Biophysical models reveal the relative importance of transporter proteins\n and impermeant anions in chloride homeostasis", | |
| "doi": "10.5061/dryad.kj1f3v4", | |
| "id": "dataset1", | |
| "title": "Dryad Digital Repository" | |
| } | |
| ], | |
| "used": [ | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Rau, CD", | |
| "preferred": "CD Rau" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Wang, J", | |
| "preferred": "J Wang" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Wang, Y", | |
| "preferred": "Y Wang" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Lusis, AJ", | |
| "preferred": "AJ Lusis" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2013", | |
| "details": "Transcriptomes of the hybrid mouse diversity panel subjected to\n Isoproterenol challenge", | |
| "id": "dataset2", | |
| "title": "NCBI Gene Expression Omnibus", | |
| "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE48760" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Garcia, Miguel A", | |
| "preferred": "Miguel A Garcia" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2018", | |
| "details": "Shear Manuscript", | |
| "id": "dataset3", | |
| "title": "Open Science Framework", | |
| "uri": "https://osf.io/kvu5j/" | |
| } | |
| ] | |
| }, | |
| "impactStatement": "How to tag an eLife article using JATS XML.", | |
| "keywords": [ | |
| "XML", | |
| "Housestyle", | |
| "eLife", | |
| "\n<i>formatting</i>\n" | |
| ], | |
| "-related-articles-internal": [], | |
| "-related-articles-external": [], | |
| "digest": { | |
| "content": [ | |
| { | |
| "text": "eLife digest are now optional and not every research article will contain one. These are layman abstracts, designed for non-specialists in this field to be able to understand this article, as well as the general public.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Here is paragraph 2 of the digest.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.002" | |
| }, | |
| "body": [ | |
| { | |
| "content": [ | |
| { | |
| "text": "This article is a guide to the tagging and display of eLife articles and will encompass all the elements that can possibly be contained in an eLife article. It will also include information from the author guide. For this reason, it is colloquially known as the eLife 'kitchen sink'.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "eLife publishes the most highly influential research across the life sciences and biomedicine. Before you submit your work, please note that eLife is a very selective journal that aims to publish work of the highest scientific standards and importance. Leading academic researchers evaluate new submissions and approximately two-thirds are returned to the authors without further peer review. See <a href=\"#bib12\">DeLano (2002)</a> and <a href=\"#bib13\"> Department of Education and Morgan (2016)</a>. Approximately half of the articles that are selected for peer review go on to be published (<a href=\"#bib5\">Brettar et al., 2004a</a>). If other researchers publish similar findings after submission, this will not be a reason for rejection. The eLife editorial process broadly occurs in three phases (<a href=\"#bib48\">Turlings and W\u00e4ckers, 2004a</a>; <a href=\"#bib49\">Turlings and W\u00e4ckers, 2004b</a>; <a href=\"#bib51\"> Wolski et al., 2008</a>; <a href=\"#bib50\">Walker, 1994</a>; <a href=\"#bib44\">Tanaka et al., 2016</a>). If you are interested in submitting your work to eLife, please review the guidelines relating to initial submissions. If you have received an encouraging response to your initial submission, please review the guidelines relating to full submissions. If your full submission has been peer reviewed and you have been asked to make revisions, please review our guidelines for revised submissions (<a href=\"#bib6\">Brettar et al., 2004b</a>).", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "eLife publishes research of the very highest (<a href=\"#bib7\">Bricogne et al., 2011</a>) standard and significance, so many manuscripts are returned to the authors without in-depth peer review. During the initial submission phase, members of eLife\u2019s senior editorial team rapidly assess new submissions, often in consultation with members of the Board of Reviewing Editors or with external guest editors where necessary, to identify the ones that are appropriate for in-depth peer review (<a href=\"#bib8\">Card\u00e9 and Millar, 2004</a>; <a href=\"#bib9\">Cartwright, 2016</a>; <a href=\"#bib10\">Chmeil, 2008</a>). To simplify the submission process, authors should submit their full manuscript as a single PDF. Limited additional information is collected via the submission screen questions to complete the submission (<a href=\"#bib6\">Brettar et al., 2004b</a>).", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s1-1-1", | |
| "title": "Initial submission (level 3 heading)", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "For manuscripts that are invited for in-depth peer review, see <a href=\"#bib11\">Coyne and Orr (1989)</a> and <a href=\"#bib14\">Du et al. (2014)</a>, we request detailed information about the work to support the peer review process, to ensure that the work meets appropriate standards for the reporting of new findings, and, if accepted, to assist in rapid publication and further dissemination of the work in relevant indexes and repositories. Authors are asked to agree to publish their work under the terms of the Creative Commons Attribution license (PDF of the agreement), or the Creative Commons CC0 public domain dedication (PDF of the agreement) if one or more authors are US-government employees (<a href=\"#bib23\">Hubbard and Thornton, 1993</a>; <a href=\"#bib19\">GlaxoSmithKline UK, 2016</a>; <a href=\"#bib24\">Jain et al., 2010</a>).", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s1-1-2", | |
| "title": "Full submission (level 3 heading)", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "We will require a response to the essential revision requirements outlined in the decision letter. A response to minor comments is optional. In the event of acceptance, the substantive revision requests and the authors\u2019 response will be published, under the terms of the Creative Commons Attribution license. In preparation for submission, authors should ensure they have all the materials and information necessary to expedite the submission and assessment of their work (<a href=\"#bib15\">Eisen, 2016</a>; <a href=\"#bib16\">Ferry et al., 2014</a>; <a href=\"#bib18\">Gavrilov et al., 2014</a>; <a href=\"#bib20\">Goodstadt, 2010</a>; <a href=\"#bib21\">Hoang et al., 2015</a>).", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s1-1-3", | |
| "title": "Revised submission (level 3 heading)", | |
| "type": "section" | |
| } | |
| ], | |
| "id": "s1-1", | |
| "title": "The eLife editorial process (level 2 heading)", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "content": [ | |
| { | |
| "text": "On acceptance an eLife article can be published in accepted manuscript form immediately. The mean time from acceptance to publication at this stage is 1 day. Using SQl, basic metadata is exported from the submission system to an AWS bucket as CSV files. The author files are exported to another AWS bucket and an eLife process generates a package of this information and the author files to deliver to the online platform, Continuum.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s1-2-1", | |
| "title": "Immediate publication (accepted manuscript) (level 3 heading)", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "The production process includes an author proofing cycle, the output of which is the final full text version of the article online, as well as a typeset PDF.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s1-2-2", | |
| "title": "Publication of the full version (version of record) (level 3 heading)", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "eLife allows the publication of updates to an article after the full version has been produced. These are treated as new versions of the article. All previous versions of the article will continue to exist online and will be accessible from the latest live version.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "eLife allows up to four levels of headings and no more. This is a demonstration of a level 4 heading.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s1-2-3-1", | |
| "title": "level 4 heading", | |
| "type": "section" | |
| } | |
| ], | |
| "id": "s1-2-3", | |
| "title": "Publication of versions (level 3 heading)", | |
| "type": "section" | |
| } | |
| ], | |
| "id": "s1-2", | |
| "title": "The eLife production process (level 2 heading)", | |
| "type": "section" | |
| } | |
| ], | |
| "id": "s1", | |
| "title": "Introduction (Level 1 heading)", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This section will be used to demostrate the majority of eLife XML tagging and editorial policies. However, the Introduction section was used to demostrate heading levels. See <a href=\"#s8-1\">Appendix 1.1</a> and <a href=\"#s9\">2</a>.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "eLife has no strict requirements for the display of lists. Below we will show examples of how to present lists. See <a href=\"#fig2s1\">Figure 2\u2014figure supplement 1</a> for the representation of the Major Subject Areas, Research Organisms and author keywords on the eLife HTML page (<a href=\"#bib45\">The <i>Shigella</i> Genome Sequencing Consortium, 2015a</a>).", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This is an example of a list where the prefix character is a lowercase roman numeral. eLife Article Types are taken from a controlled list:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "items": [ | |
| [ | |
| { | |
| "text": "Research article", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Short Report", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Tools and Resources", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Research Advance", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Registered Report", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Replication Study", | |
| "type": "paragraph" | |
| } | |
| ] | |
| ], | |
| "prefix": "roman-lower", | |
| "type": "list" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This is an example of a list where the prefix character is a uppercase roman numeral. This is a controlled list from the JATS DTD", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "items": [ | |
| [ | |
| { | |
| "text": "article-commentary (used for Insights)", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "correction", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "discussion (used for Feature 1 and Feature 2)", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "editorial", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "research-article (all reseasrch content)", | |
| "type": "paragraph" | |
| } | |
| ] | |
| ], | |
| "prefix": "roman-upper", | |
| "type": "list" | |
| }, | |
| { | |
| "text": "Nested lists are allowed and these are very common in Registered Peports. Below is an example of a nested list to 3 levels.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Genus: Plasmodium; following species are known to infect humans", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "items": [ | |
| [ | |
| { | |
| "items": [ | |
| [ | |
| { | |
| "text": "<i>P. falciparum</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>P. vivax</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>P. ovale</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>P. malariae</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>P. knowlesi</i>", | |
| "type": "paragraph" | |
| } | |
| ] | |
| ], | |
| "prefix": "roman-lower", | |
| "type": "list" | |
| }, | |
| { | |
| "text": "Genus: Leishmania. There are 3 subgenus of Leishmania:", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "items": [ | |
| [ | |
| { | |
| "text": "Leishmania", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Sauroleishmania", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Viannia", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Within Viannia subgenus, there are 11 species:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "items": [ | |
| [ | |
| { | |
| "text": "<i>L. braziliensis</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. colombiensis</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. equatorensis</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. guyanensis</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. lainsoni</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. naiffi</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. panamensis</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. peruviana</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. pifanoi</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. shawi</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>L. utingensis</i>", | |
| "type": "paragraph" | |
| } | |
| ] | |
| ], | |
| "prefix": "bullet", | |
| "type": "list" | |
| } | |
| ] | |
| ], | |
| "prefix": "roman-lower", | |
| "type": "list" | |
| } | |
| ] | |
| ], | |
| "prefix": "roman-upper", | |
| "type": "list" | |
| } | |
| ], | |
| "id": "s2-1-1-1", | |
| "title": "Article types (XML only, not display) (level 4 heading)", | |
| "type": "section" | |
| } | |
| ], | |
| "id": "s2-1-1", | |
| "title": "Article types", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This is an example of a bulleted list. eLife Major subject areas are taken from a controlled list:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "items": [ | |
| [ | |
| { | |
| "text": "Biochemistry", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Biophysics and Structural Biology", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Cell Biology", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Computational and Systems Biology", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Developmental Biology and Stem Cells", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Ecology", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Epidemiology and Global Health", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Genes and Chromosomes", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Genomics and Evolutionary Biology", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Human Biology and Medicine", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Immunology", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Microbiology and Infectious Disease", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Neuroscience", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Plant Biology", | |
| "type": "paragraph" | |
| } | |
| ] | |
| ], | |
| "prefix": "bullet", | |
| "type": "list" | |
| } | |
| ], | |
| "id": "s2-1-2", | |
| "title": "Major Subject Areas", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "items": [ | |
| [ | |
| { | |
| "text": "Here is an example of a list with multiple paragraphs and equations.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "A discrete three-dimensional model space was generated (represented as a three-dimensional matrix; <a href=\"#fig2s1\">Figure 2\u2014figure supplement 1A</a>, left), with dimensions corresponding to population \u00b5, population \u03c3, and f value. Any given value in the matrix indicates P(f|\u03bc,\u03c3), that\u00a0is, the probability of a given frequency given a particular \u03bc and \u03c3. The columns (all f values for a given \u03bc and \u03c3 combination; <a href=\"#fig2s1\">Figure 2\u2014figure supplement 1</a>, upper-right) thus constitute the forward model (by which stimuli are generated), and the planes (all combinations of \u03bc and \u03c3 for a given f value; <a href=\"#fig2s1\">Figure 2\u2014figure supplement 1</a>, lower-middle) constitute the inverse model (by which hidden parameters can be estimated from observed f values).", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "2) For each segment, the model was inverted for its particular f value, yielding a two-dimensional probability distribution for the hidden parameters (<a href=\"#fig2s1\">Figure 2\u2014figure supplement 1</a>, lower-middle). Steps 3-6 were then worked through for each stimulus segment in order, starting at the beginning of the stimulus.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "These probability distributions, for each segment subsequent to the most recent estimated population change (as defined later), were multiplied together, and scaled to a sum of 1. The resulting probability distribution (<a href=\"#fig2s1\">Figure 2\u2014figure supplement 1</a>, lower-right) thus reflects parameter probabilities taking into account all relevant f values", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "This combined parameter probability distribution was then scalar multiplied with the full model space, in order to weight each of the forward model columns (each corresponding to a particular parameter combination) by the probability of that parameter combination being in effect. The resulting weighted model space was then averaged across parameter dimensions, to yield a one-dimensional (forward) probability distribution, constituting an optimal prediction about the f value of the next stimulus segment, provided a population change did not occur before then. A probability distribution applicable if a population change were to occur was calculated the same way, but without weighting the forward model columns (so as to encompass every possible parameter combination).", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "It was assumed that a population change occurred immediately prior to the first stimulus segment. To infer subsequent population changes, for each segment the probability of observing the present f value was compared for the two probability distributions (the distribution assuming a population change, and the distribution assuming no change), that\u00a0is, P(f|c) and P(f|~c), respectively, with c denoting a population change. The probabilities were compared, in conjunction with the known prior probability of a population change (1/8), using Bayes\u2019 rule, as stated in Equation 2:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "id": "equ1", | |
| "label": "(1)", | |
| "mathml": "<math><mrow><mi>P</mi><mo>(</mo><mi>c</mi><mo>|</mo><mi>f</mi><mo>)</mo><mo>=</mo><mfrac><mrow><mi>P</mi><mrow><mo>(</mo><mrow><mi>f</mi><mtext>|</mtext><mi>c</mi></mrow><mo>)</mo></mrow><mi>P</mi><mo>(</mo><mi>c</mi><mo>)</mo></mrow><mrow><mi>P</mi><mo>(</mo><mi>f</mi><mo>)</mo></mrow></mfrac></mrow></math>", | |
| "type": "mathml" | |
| }, | |
| { | |
| "text": "Here, P(c|f) is the chance that a population change occurred at that particular time. Given that P(c) is known to be 1/8, and P(f), the total probability of the observed f value, can be rewritten P(f|c)P(c)+P(f|~c)(1-P(c)), the above equation can be rewritten as Equation 3:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "id": "equ2", | |
| "label": "(2)", | |
| "mathml": "<math><mrow><mi>P</mi><mrow><mo>(</mo><mrow><mi>c</mi><mtext>|</mtext><mi>f</mi></mrow><mo>)</mo></mrow><mo>=</mo><mfrac><mn>1</mn><mrow><mn>1</mn><mo>+</mo><mfrac><mrow><mn>7</mn><mi>P</mi><mo>(</mo><mi>f</mi><mo>|</mo><mo>~</mo><mi>c</mi><mo>)</mo></mrow><mrow><mi>P</mi><mo>(</mo><mi>f</mi><mo>|</mo><mi>c</mi><mo>)</mo></mrow></mfrac></mrow></mfrac></mrow></math>", | |
| "type": "mathml" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "For each segment, the above calculation of P(c|f) was made not only with respect to the immediately preceding segment, but also a number of segments preceding that, up to a maximum of 4. Therefore, for segment t, it was possible to conclude that a population change had occurred immediately prior to t, t-1, t-2, t-3, or none of the above. A population change was judged to have occurred at the time point with the highest value of P(c|f), provided this value was greater than 0.5. Using more than 4 lags did not appreciably alter the estimates obtained by model inversion. Importantly, any retrospective inference of population changes did not retrospectively alter any prior predictions generated by the model (e.g. at time t, if a population change were inferred to have occurred at time t-3 then the priors for t-2, t-1 and t were not affected, but only the priors for t+1 onwards).", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Once the above steps were worked through for each stimulus segment in order, the optimal prior predictions were used to calculate the perceptual inference variables of interest. Predictions themselves were summarised by their mean (\u03bc) and precision (1/variance). Changes to predictions (\u0394\u00b5) were calculated as the absolute change (in octaves) in \u03bc from one prediction to the next. Surprise (S) was calculated as the negative log probability of the observed f value given the prior prediction, and prediction error (irrespective of prediction precision) was calculated as the absolute difference (in octaves) between the observed f value and the mean of the prior prediction. Mathematically, surprise is directly proportional to prediction precision multiplied by prediction error. Finally, \u0394f was calculated as the absolute difference between the current and preceding value of f.", | |
| "type": "paragraph" | |
| } | |
| ] | |
| ], | |
| "prefix": "number", | |
| "type": "list" | |
| } | |
| ], | |
| "id": "s2-1-3", | |
| "title": "Multi-lists", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This is an example of an ordered list, the \"system\" will default to numbers. eLife Research organsims are taken from a controlled list from the submission system:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "items": [ | |
| [ | |
| { | |
| "text": "<i>Arabidopsis</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>B</i>. <i>subtilis</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>C</i>. <i>elegans</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>C</i>. <i>intestinalis</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Chicken", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>D</i>. <i>melanogaster</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>Dictyostelium</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>E</i>. <i>coli</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Frog", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Human", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>M</i>. <i>mulatta</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Maize", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Mouse", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>M</i>. <i>thermophila</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>M</i>. <i>crassa</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>Neurospora</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "None", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Other", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>O</i>. <i>fasciatus</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>P</i>. <i>falciparum</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>P</i>. <i>dumerilii</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Rat", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>S</i>. <i>cerevisiae</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>S</i>. <i>pombe</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>S</i>. <i>enterica</i>serovar Typhi", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>S</i>. <i>pyogenes</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Virus", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>Volvox</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>Xenopus</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "<i>P</i>. <i>cynocephalus</i>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| [ | |
| { | |
| "text": "Zebrafish", | |
| "type": "paragraph" | |
| } | |
| ] | |
| ], | |
| "prefix": "number", | |
| "type": "list" | |
| }, | |
| { | |
| "text": "However, additional research organisms can be added during the production process so this is not a controlled list once it is output from the editorial system. The research organism \"Other\" is hidden from display on the eLife website.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s2-1-4", | |
| "title": "Research Organisms", | |
| "type": "section" | |
| } | |
| ], | |
| "id": "s2-1", | |
| "title": "eLife controlled lists", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This section is an example of different tables, there are four in total (<a href=\"#table1\">Tables 1 to 3</a> and an unnamed inline table).", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "This is the caption: A table containing interesting formating that is large enough to require landscape orientation in the PDF.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.003", | |
| "footnotes": [ | |
| { | |
| "text": [ | |
| { | |
| "text": "Footnotes not linked to content within the table text are usually to define abbreviations. For example:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "WT, wild type.", | |
| "type": "paragraph" | |
| } | |
| ] | |
| } | |
| ], | |
| "id": "table1", | |
| "label": "Table 1", | |
| "tables": [ | |
| "<table>\n<thead>\n\n<tr>\n\n<th colspan=\"3\" rowspan=\"2\">\u2009</th>\n<th align=\"center\" colspan=\"8\">GLVs (percent IS plant<sup>-1</sup>)</th>\n<th align=\"center\" colspan=\"17\">TPS10 products (percent IS plant<sup>-1</sup>)</th>\n<th align=\"center\" colspan=\"10\">Non-target volatiles (percent IS plant<sup>-1</sup>)</th>\n</tr>\n<tr>\n<th align=\"center\" colspan=\"8\">(<i>Z</i>)-Hexen-3-ol</th>\n<th align=\"center\" colspan=\"10\">TAB</th><th align=\"center\" colspan=\"7\">TBF</th>\n<th align=\"center\" colspan=\"6\">\u03b1-Duprezianene</th>\n<th align=\"center\" colspan=\"4\">Germacrene A</th>\n</tr>\n</thead>\n<tbody>\n\n<tr>\n<td><b>Genotype</b></td>\n<td><b>Day n</b></td>\n<td><b>Night n</b></td>\n<td colspan=\"3\"><b>Day</b></td>\n<td colspan=\"5\"><b>Night</b></td>\n<td colspan=\"4\"><b>Day</b></td>\n<td colspan=\"6\"><b>Night</b></td>\n<td colspan=\"4\"><b>Day</b></td>\n<td colspan=\"3\"><b>Night</b></td>\n<td colspan=\"3\"><b>Day</b></td>\n<td colspan=\"3\"><b>Night</b></td>\n<td colspan=\"3\"><b>Day</b></td>\n<td><b>Night</b></td>\n</tr>\n<tr>\n<td><b>WT</b></td>\n<td>8</td><td>8</td>\n<td>0.99%</td>\n<td>\u00b1</td>\n<td>0.99%</td>\n<td>7.96%</td>\n<td>\u00b1</td>\n<td>4.25%</td>\n\n<td rowspan=\"2\" valign=\"middle\"><span class=\"author-callout-style-a1\">}</span></td>\n<td rowspan=\"2\" valign=\"middle\"><b><span class=\"author-callout-style-a1\">a</span></b><sub><b><span class=\"author-callout-style-a1\">lox</span></b></sub></td>\n<td>0.37%</td>\n<td>\u00b1</td>\n<td>0.29%</td>\n<td><b><span class=\"author-callout-style-a1\">a</span></b></td>\n<td colspan=\"3\">\u2014</td>\n<td>\u2009</td>\n<td rowspan=\"3\" valign=\"middle\"><span class=\"author-callout-style-a1\">}</span></td>\n<td rowspan=\"2\" valign=\"bottom\"><b><span class=\"author-callout-style-a1\">a</span></b><sub><b><span class=\"author-callout-style-a1\">TPS</span></b></sub></td>\n<td colspan=\"3\">\u2014</td>\n<td><b><span class=\"author-callout-style-a1\">a</span></b></td>\n<td colspan=\"3\">\u2014</td>\n\n<td><span class=\"author-callout-style-a2\">2.13%</span></td>\n<td><span class=\"author-callout-style-a2\">\u00b1</span></td>\n<td><span class=\"author-callout-style-a2\">0.85%</span></td>\n<td><span class=\"author-callout-style-a2\">0.96%</span></td>\n<td><span class=\"author-callout-style-a2\">\u00b1</span></td>\n<td><span class=\"author-callout-style-a2\">0.42%</span></td>\n<td><span class=\"author-callout-style-a2\">1.68%</span></td>\n<td><span class=\"author-callout-style-a2\">\u00b1</span></td>\n<td><span class=\"author-callout-style-a2\">0.98%</span></td>\n<td>\u2014</td>\n</tr>\n<tr>\n<td><b><i>TPS10</i></b></td>\n<td>7</td>\n<td>7</td>\n<td>2.37%</td>\n<td>\u00b1</td>\n<td>1.55%</td>\n<td>2.84%</td>\n<td>\u00b1</td>\n<td>0.63%</td>\n<td>18.97%</td>\n<td>\u00b1</td>\n<td>6.03%</td>\n\n<td><b><span class=\"author-callout-style-a3\">b</span></b></td>\n<td>0.94%</td>\n<td>\u00b1</td>\n<td>0.53%</td>\n<td rowspan=\"3\" valign=\"middle\"><span class=\"author-callout-style-a3\">}</span></td>\n<td>9.34%</td>\n<td>\u00b1</td>\n<td>3.44%</td>\n<td><b><span class=\"author-callout-style-a3\">b</span></b></td>\n<td>0.20%</td>\n<td>\u00b1</td>\n<td>0.20%</td>\n<td>9.47%</td>\n<td>\u00b1</td>\n<td>5.26%</td>\n<td>0.94%</td>\n<td>\u00b1</td>\n<td>0.26%</td>\n<td>2.78%</td>\n<td>\u00b1</td>\n<td>1.52%</td>\n<td>\u2014</td>\n</tr>\n<tr>\n<td><b><i>lox2/3</i></b></td>\n<td>7</td>\n<td>8</td>\n<td>0.13%</td>\n<td>\u00b1</td>\n<td>0.13%</td>\n<td>1.06%</td>\n<td>\u00b1</td>\n<td>0.64%</td>\n<td rowspan=\"2\" valign=\"middle\"><span class=\"author-callout-style-a3\">}</span></td>\n<td rowspan=\"2\" valign=\"middle\"><b><span class=\"author-callout-style-a3\">b</span></b><sub><b><span class=\"author-callout-style-a3\">lox</span></b></sub></td>\n<td colspan=\"3\">\u2014</td>\n<td><b><span class=\"author-callout-style-a1\">a</span></b></td>\n<td>0.15%</td>\n<td>\u00b1</td>\n<td>0.15%</td>\n<td rowspan=\"2\"><b><span class=\"author-callout-style-a3\">b</span></b><sub><b><span class=\"author-callout-style-a3\">TPS</span></b></sub></td>\n<td colspan=\"3\">\u2014</td>\n<td><b><span class=\"author-callout-style-a1\">a</span></b></td>\n<td colspan=\"3\">\u2014</td>\n<td>2.75%</td>\n<td>\u00b1</td>\n<td>1.12%</td>\n<td>0.60%</td>\n<td>\u00b1</td>\n<td>0.19%</td>\n<td>1.68%</td>\n<td>\u00b1</td>\n<td>1.49%</td>\n<td>\u2014</td>\n</tr>\n<tr>\n<td><b><i>lox2/3</i>x<i>TPS10</i></b></td>\n<td>7</td>\n<td>7</td>\n<td>0.07%</td>\n<td>\u00b1</td>\n<td>0.07%</td>\n<td>1.24%</td>\n<td>\u00b1</td>\n<td>0.84%</td>\n<td>7.39%</td>\n<td>\u00b1</td>\n<td>2.56%</td>\n<td><b><span class=\"author-callout-style-a3\">b</span></b></td>\n<td>2.08%</td>\n<td>\u00b1</td>\n<td>0.84%</td>\n<td>\u2009</td>\n<td>4.47%</td>\n<td>\u00b1</td>\n<td>1.70%</td>\n<td><b><span class=\"author-callout-style-a3\">b</span></b></td>\n<td>0.40%</td>\n<td>\u00b1</td>\n<td>0.40%</td>\n<td>3.02%</td>\n<td>\u00b1</td>\n<td>1.42%</td>\n<td>0.73%</td>\n<td>\u00b1</td>\n<td>0.31%</td>\n<td>0.66%</td>\n<td>\u00b1</td>\n<td>0.37%</td>\n<td>\u2014</td>\n</tr>\n</tbody>\n</table>" | |
| ], | |
| "title": "This is the title.", | |
| "type": "table" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "text": "<a href=\"#table2\">Table 2</a> is an example of a standard table that will be the width of the text column in the PDF. It does not contain any unusual styling. It does have footnotes linked to content in the table using the prescribed symbols.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "This table contains references and footnotes and is sized to the text column width in the PDF.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.004", | |
| "footnotes": [ | |
| { | |
| "id": "tablefn1", | |
| "label": "*", | |
| "text": [ | |
| { | |
| "text": "Footnotes can be used to highlight properties of data reported in a table such as statistical significance. They are separate from the table caption and appear afterwards. They are hyperlinked to allow easy navigation. Footnotes in tables use the same standard set of symbols used for authors footnotes.", | |
| "type": "paragraph" | |
| } | |
| ] | |
| }, | |
| { | |
| "id": "tablefn2", | |
| "label": "\u2020", | |
| "text": [ | |
| { | |
| "text": "Authors are fully allowed to cite references and figures in tables. There is no difference in citation style between the main text and tables.", | |
| "type": "paragraph" | |
| } | |
| ] | |
| }, | |
| { | |
| "text": [ | |
| { | |
| "text": "Order: Designated footnotes (e.g. *, \u2020, \u2021, \u00a7, #, \u00b6, **, and so on), p value footnotes (*p, **p, ***p), undesignated footnotes and abbreviations.", | |
| "type": "paragraph" | |
| } | |
| ] | |
| } | |
| ], | |
| "id": "table2", | |
| "label": "Table 2", | |
| "tables": [ | |
| "<table>\n<thead>\n<tr>\n<th rowspan=\"2\">Protein</th>\n<th rowspan=\"2\">Molar ratio of lipid:protein in RPL reactions<a href=\"#tablefn1\">*</a></th>\n<th colspan=\"2\">Molar ratio of lipid:protein on vacuoles</th>\n<th rowspan=\"2\">References<a href=\"#tablefn2\">\u2020</a></th>\n</tr>\n<tr>\n<th>BJ3505</th>\n<th>DKY6218</th>\n</tr>\n</thead>\n<tbody>\n<tr>\n\n<td class=\"author-callout-style-b1\">Vam7p</td>\n\n<td class=\"author-callout-style-b2\">2 \u00d7 10<sup>3</sup></td>\n\n<td class=\"author-callout-style-b3\">30 \u00d7 10<sup>4</sup></td>\n\n<td class=\"author-callout-style-b4\">6.5 \u00d7 10<sup>4</sup></td>\n\n<td><a href=\"#bib12\">DeLano, 2002</a></td>\n</tr>\n<tr>\n\n<td class=\"author-callout-style-b5\">Vam3p</td>\n\n<td class=\"author-callout-style-b6\">2 \u00d7 10<sup>3</sup></td>\n\n<td class=\"author-callout-style-b7\">11 \u00d7 10<sup>4</sup></td>\n\n<td class=\"author-callout-style-b8\">22 \u00d7 10<sup>4</sup></td>\n<td><a href=\"#bib13\">Department of Education and Morgan, 2016</a></td>\n</tr>\n<tr>\n<td>Vti1p</td>\n<td>2 \u00d7 10<sup>3</sup></td>\n<td>10 \u00d7 10<sup>4</sup></td>\n<td>13 \u00d7 10<sup>4</sup></td>\n<td><a href=\"#bib54\">Zhong et al., 2013</a></td>\n</tr>\n<tr>\n<td>Nyv1p</td>\n<td>2 \u00d7 10<sup>3</sup></td>\n<td>4.3 \u00d7 10<sup>4</sup></td>\n<td>8.1 \u00d7 10<sup>4</sup></td>\n<td><a href=\"#bib16\">Ferry et al., 2014</a></td>\n</tr>\n</tbody>\n</table>", | |
| "<table>\n<thead>\n<tr>\n<th rowspan=\"2\">Protein</th>\n<th rowspan=\"2\">Molar ratio of lipid:protein in RPL reactions<a href=\"#tablefn1\">*</a></th>\n<th colspan=\"2\">Molar ratio of lipid:protein on vacuoles</th>\n<th rowspan=\"2\">References<a href=\"#tablefn2\">\u2020</a></th>\n</tr>\n</thead>\n<tbody>\n<tr>\n<td>Ypt7p</td>\n<td>4 \u00d7 10<sup>3</sup></td>\n<td>1.9 \u00d7 10<sup>4</sup></td>\n<td>1.8 \u00d7 10<sup>4</sup></td>\n<td><a href=\"#bib54\">Zhong et al., 2013</a></td>\n</tr>\n<tr>\n<td>Sec17p</td><td>7 \u00d7 10<sup>3</sup></td>\n<td>41 \u00d7 10<sup>4</sup></td>\n<td>13 \u00d7 10<sup>4</sup></td>\n<td><a href=\"#bib51\">Wolski et al., 2008</a></td>\n</tr>\n<tr>\n<td>Sec18p</td>\n<td>1 \u00d7 10<sup>3</sup></td>\n<td>10 \u00d7 10<sup>4</sup></td>\n<td>13 \u00d7 10<sup>4</sup></td>\n<td>This article (<a href=\"#fig1\">Figure 1</a>)</td>\n</tr>\n<tr>\n<td>Vps33p</td>\n<td>6 \u00d7 10<sup>3</sup></td>\n<td>17 \u00d7 10<sup>4</sup></td>\n<td>31 \u00d7 10<sup>4</sup></td>\n<td><a href=\"#bib54\">Zhong et al., 2013</a></td>\n</tr>\n</tbody>\n</table>" | |
| ], | |
| "type": "table" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "text": "<a href=\"#table3\">Table 3</a> is an example of a narrow table that will appear at half the text column width in the PDF. It also has source data.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "doi": "10.7554/eLife.00666.005", | |
| "id": "table3", | |
| "label": "Table 3", | |
| "sourceData": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "Each data point was performed in duplicate and is shown separately.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.006", | |
| "filename": "elife-00666-table3-data1.xlsx", | |
| "id": "table3sdata1", | |
| "label": "Table 3\u2014source data 1", | |
| "mediaType": "application/xlsx", | |
| "title": "Representative curves of steady-state kinetic analyses for each IGF1R protein characterized.", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-table3-data1.xlsx" | |
| } | |
| ], | |
| "tables": [ | |
| "<table>\n<tbody>\n<tr>\n<td colspan=\"2\">Data collection</td>\n</tr>\n<tr>\n<td>\u2003Space group</td>\n<td>P6<sub>2</sub></td>\n</tr>\n<tr>\n<td rowspan=\"2\">Cell dimensions (\u00c5)</td>\n<td>a = b = 78.33, c = 62.32</td>\n</tr>\n<tr>\n<td>\u03b1 = \u03b2 = 90<sup>o</sup>, \u03b3 = 120<sup>o</sup></td>\n</tr>\n<tr>\n<td>\u2003Wavelength (\u00c5)</td>\n<td>0.9794</td>\n</tr>\n<tr>\n<td>\u2003R<sub>sym</sub> or R<sub>merge</sub> (%)</td>\n<td>8.4</td>\n</tr>\n<tr>\n<td>\u2003Resolution (\u00c5)</td>\n<td><span class=\"monospace\">50\u20132.05 (2.09\u20132.05)</span></td>\n</tr>\n<tr>\n<td>\u2003I/\u03c3I</td><td>19.19 (3.23)</td>\n</tr>\n<tr>\n<td>\u2003Completeness (%)</td>\n<td><span class=\"monospace\">99.8 (97.3)</span></td>\n</tr>\n<tr>\n<td>\u2003Redundancy</td>\n<td>6.2 (5.4)</td>\n</tr>\n<tr>\n<td colspan=\"2\">Refinement</td>\n</tr>\n<tr>\n<td>\u2003No. reflections</td>\n<td>12,206</td>\n</tr>\n<tr>\n<td>\u2003Resolution (\u00c5)</td>\n<td><span class=\"monospace\">39.17\u20132.06 (2.14\u20132.06)</span></td>\n</tr>\n<tr>\n<td>\u2003R<sub>work</sub>/R<sub>free</sub></td>\n<td><span class=\"monospace\">0.17/0.21 (0.16/0.19)</span></td>\n</tr>\n<tr>\n<td>\u2003No. atoms</td>\n<td/>\n</tr>\n<tr>\n<td>Protein</td>\n<td>1608</td>\n</tr>\n<tr>\n<td>Ligand/ion</td>\n<td>3</td>\n</tr>\n<tr>\n<td>Water</td>\n<td>61</td>\n</tr>\n<tr>\n<td>\u2003R.m.s. deviations</td>\n<td/>\n</tr>\n<tr>\n<td>\u2003Bond lengths (\u00c5)</td>\n<td>0.0077</td>\n</tr>\n<tr>\n<td>\u2003Bond angles (\u00b0)</td>\n<td>0.932</td>\n</tr>\n</tbody>\n</table>" | |
| ], | |
| "type": "table" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "text": "The following unnamed table is an example of an inline table that has no heading.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "footnotes": [ | |
| { | |
| "text": [ | |
| { | |
| "text": "This is an unmarked footnote for an anchored/inline table", | |
| "type": "paragraph" | |
| } | |
| ] | |
| } | |
| ], | |
| "id": "inlinetable1", | |
| "tables": [ | |
| "<table>\n<thead>\n<tr>\n<th/>\n<th>pY</th>\n<th>Experiment</th>\n<th>Concentration (\u03bcM)</th>\n</tr>\n</thead>\n<tbody>\n<tr>\n<td>IGF1R-fl + IGF1</td>\n<td>+</td>\n<td><i>K</i><sub><i>m</i></sub> ATP</td>\n<td>500, 400, 300, 250, 125, 62.5, 31.3, 15.6, 7.8</td>\n</tr>\n<tr>\n<td>IGF1R-fl + IGF1</td>\n<td>+</td>\n<td><i>K</i><sub><i>m</i></sub> Peptide</td>\n<td>600, 300, 150, 75, 37.5, 18.8, 9.4</td>\n</tr>\n<tr>\n<td>IGF1R-fl + IGF1</td>\n<td>\u2212</td>\n<td><i>K</i><sub><i>m</i></sub> ATP</td>\n<td>2000, 1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8</td>\n</tr>\n<tr>\n<td>IGF1R-fl + IGF1</td>\n<td>\u2212</td>\n<td><i>K</i><sub><i>m</i></sub> Peptide</td>\n<td>500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9</td>\n</tr>\n<tr>\n<td>IGF1R-fl</td>\n<td>+</td>\n<td><i>K</i><sub><i>m</i></sub> ATP</td>\n<td>500, 400, 300, 250, 125, 62.5, 31.3, 15.6, 7.8</td>\n</tr>\n<tr>\n<td>IGF1R-fl</td>\n<td>+</td>\n<td><i>K</i><sub><i>m</i></sub> Peptide</td>\n<td>500, 400, 250, 125, 62.5, 31.3, 15.6, 7.8</td>\n</tr>\n<tr>\n<td>IGF1R-fl</td>\n<td>\u2212</td>\n<td><i>K</i><sub><i>m</i></sub> ATP</td>\n<td>1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8</td>\n</tr>\n<tr>\n<td>IGF1R-fl</td>\n<td>\u2212</td>\n<td><i>K</i><sub><i>m</i></sub> Peptide</td>\n<td>1000, 500, 250, 125, 62.5, 31.3, 15.6</td>\n</tr>\n<tr>\n<td>IGF1R-icd</td>\n<td>+</td>\n<td><i>K</i><sub><i>m</i></sub> ATP</td>\n<td>500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9</td>\n</tr>\n<tr>\n<td>IGF1R-icd</td>\n<td>+</td>\n<td><i>K</i><sub><i>m</i></sub> Peptide</td>\n<td>1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8</td>\n</tr>\n<tr>\n<td>IGF1R-icd</td>\n<td>\u2212</td>\n<td><i>K</i><sub><i>m</i></sub> ATP</td>\n<td>1000, 500, 250, 125, 62.5, 31.3</td>\n</tr>\n<tr>\n<td>IGF1R-icd</td>\n<td>\u2212</td>\n<td><i>K</i><sub><i>m</i></sub> Peptide</td>\n<td>1000, 500, 250, 125, 62.5, 31.3</td>\n</tr>\n<tr>\n<td>IGF1R-kin</td>\n<td>\u2212</td>\n<td><i>K</i><sub><i>m</i></sub> Peptide</td>\n<td>1250, 625, 312.5, 156.3, 78.1, 39.1</td>\n</tr>\n</tbody>\n</table>" | |
| ], | |
| "type": "table" | |
| } | |
| ], | |
| "id": "s2-2", | |
| "title": "Tables", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "Content can contain inline formulae or display formulae. Below is an example of a mixture of inline and display formula. MathMl is used in all instances.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "We propose a Bayesian scheme for BCV (see <a href=\"#equ1\">equation 1</a>) that accommodates the influence of context on incentive value. BCV focuses on scenarios (i) where incentive value depends on contextual information (either represented by cues or by previous rewards) provided before options or rewards are presented, and (ii) where reward is defined by a single attribute (e.g., reward amount). To describe the basic principles of BCV, we adopt the formalism of Bayesian graphs ( <a href=\"#bib47\">The <i>Shigella</i> Genome Sequencing Consortium, 2015c</a>) where a generative model is described by nodes or circles, representing random variables (shaded and white circles refer to observed and non-observed variables respectively), and arrows, representing causal relationships among variables. A simple generative model hypothesized by BCV is shown in Figure 1A of another article (not linked here), where C represents prior beliefs about the average reward expected in a given context. Formally, this corresponds to a (Gaussian) prior belief (with mean <math> <mstyle displaystyle=\"true\" scriptlevel=\"0\"> <mrow> <msub> <mi>\u03bc</mi> <mrow> <mi>c</mi> </mrow> </msub> </mrow> </mstyle> </math> and variance <math> <mstyle displaystyle=\"true\" scriptlevel=\"0\"> <mrow> <msubsup> <mi>\u03c3</mi> <mrow> <mi>c</mi> </mrow> <mrow> <mn>2</mn> </mrow> </msubsup> </mrow> </mstyle> </math> over the mean of a (Gaussian) distribution of reward options R (with variance <math> <mstyle displaystyle=\"true\" scriptlevel=\"0\"> <mrow> <msubsup> <mi>\u03c3</mi> <mrow> <mi>R</mi> </mrow> <mrow> <mn>2</mn> </mrow> </msubsup> </mrow> </mstyle> </math> ). When R is observed, a posterior expectation about the context is obtained by application of Bayes rule ( <a href=\"#bib46\">The <i>Shigella</i> Genome Sequencing Consortium, 2015b</a> ): id and a label required for display formulae", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "id": "equ3", | |
| "label": "(3)", | |
| "mathml": "<math>\n<mstyle displaystyle=\"true\" scriptlevel=\"0\">\n<mrow>\n<msub>\n<mi>\u03bc</mi>\n<mrow>\n<mi>C</mi>\n<mrow>\n<mo stretchy=\"false\">|</mo>\n</mrow>\n<mi>R</mi>\n</mrow>\n</msub>\n<mo>=</mo>\n<msub>\n<mi>\u03bc</mi>\n<mrow>\n<mi>C</mi>\n</mrow>\n</msub>\n<mo>+</mo>\n<mfrac>\n<msubsup>\n<mi>\u03c3</mi>\n<mrow>\n<mi>C</mi>\n</mrow>\n<mrow>\n<mn>2</mn>\n</mrow>\n</msubsup>\n<mrow>\n<msubsup>\n<mi>\u03c3</mi>\n<mrow>\n<mi>C</mi>\n</mrow>\n<mrow>\n<mn>2</mn>\n</mrow>\n</msubsup>\n<mo>+</mo>\n<msubsup>\n<mi>\u03c3</mi>\n<mrow>\n<mi>R</mi>\n</mrow>\n<mrow>\n<mn>2</mn>\n</mrow>\n</msubsup>\n</mrow>\n</mfrac>\n<mrow>\n<mo>(</mo>\n<mi>R</mi>\n<mo>\u2212</mo>\n<msub>\n<mi>\u03bc</mi>\n<mrow>\n<mi>C</mi>\n</mrow>\n</msub>\n<mo>)</mo>\n</mrow>\n</mrow>\n</mstyle>\n</math>", | |
| "type": "mathml" | |
| }, | |
| { | |
| "text": "where text following on from this equation but still within the same paragraph should not be indented in the PDF. This is usually used by authors wanting to explain the terms used in the maths.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Additional to maths, eLife articles can also contain code blocks for the display of computer code snipets. For example:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "code": "<MotifGraft name=\"motif_grafting\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0context_structure=\"%%context%%\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0motif_structure=\"truncatedBH3.pdb\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0RMSD_tolerance=\"3.0\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0NC_points_RMSD_tolerance=\"2.0\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0clash_score_cutoff=\"0\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0clash_test_residue=\"ALA\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0hotspots=\"9:12:13:14:16:17\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0combinatory_fragment_size_delta=\"0:0\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0max_fragment_replacement_size_delta=\"0:0\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0full_motif_bb_alignment=\"1\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0allow_independent_alignment_per_fragment=\"0\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0graft_only_hotspots_by_replacement=\"0\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0only_allow_if_N_point_match_aa_identity=\"0\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0only_allow_if_C_point_match_aa_identity=\"0\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0revert_graft_to_native_sequence=\"1\"\n\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0allow_repeat_same_graft_output=\"1\"/>", | |
| "type": "code" | |
| } | |
| ], | |
| "id": "s2-3", | |
| "title": "Maths", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This section of the article shows how figures should be presented and will include examples of single figures and figures arranged with a variety of additional assets.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "<a href=\"#fig1\">Figure 1</a> is an example of a single figure.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "doi": "10.7554/eLife.00666.007", | |
| "id": "fig1", | |
| "image": { | |
| "alt": "", | |
| "attribution": [ | |
| "\u00a9 2016 eLife. All rights reserved. For the purpose having a example of how to tag a separate license for an item, we have indicated in the XML and display this is a\n copyrighted figure; however it is not." | |
| ], | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig1.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig1.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-fig1.jpg" | |
| } | |
| }, | |
| "label": "Figure 1", | |
| "title": "Single figure: The header of an eLife article example on the HTML page. In the PDf this is represented as a single column.", | |
| "type": "image" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "text": "<a href=\"#fig2\">Figure 2</a> is an example of a figure with figure supplements, <a href=\"#fig2s1\">Figure 2\u2014figure supplement 1</a> and <a href=\"#fig2s2\">Figure 2\u2014figure supplement 2</a>.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "This is the basic information provided about an article. <a href=\"#fig1\">Figure 1 </a> shows an expanded view (<a href=\"#bib26\">Kok et al., 2015</a>; <a href=\"#bib28\">National Institute of Mental Health, 1990</a>).", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.008", | |
| "id": "fig2", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig2.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig2.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-fig2.jpg" | |
| } | |
| }, | |
| "label": "Figure 2", | |
| "title": "Figure with figure supplements. In the PDF this asset box will take full column width.", | |
| "type": "image" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.009", | |
| "id": "fig2s1", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig2-figsupp1.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig2-figsupp1.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-fig2-figsupp1.jpg" | |
| } | |
| }, | |
| "label": "Figure 2\u2014figure supplement 1", | |
| "title": "The representation of the Major Subject Areas, Research Organisms and author keywords on the eLife HTML page", | |
| "type": "image" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.010", | |
| "id": "fig2s2", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig2-figsupp2.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig2-figsupp2.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-fig2-figsupp2.jpg" | |
| } | |
| }, | |
| "label": "Figure 2\u2014figure supplement 2", | |
| "title": "Representation of figure with figure supplements on the HTML view.", | |
| "type": "image" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "text": "<a href=\"#fig3\">Figure 3</a> is an example of a figure with a figure supplement (<a href=\"#fig3s1\">Figure 3\u2014figure supplement 1</a>) with two sub-assets, <a href=\"#fig3sdata1\">Figure 3\u2014figure supplement 1\u2014source data 1</a> and <a href=\"#fig3video1\">Figure 3\u2014video 1</a> (see <a href=\"#bib53\">Zhang et al., 2010</a>, <a href=\"#bib54\">Zhong et al., 2013</a>; <a href=\"#bib52\">World Health Organization, 2016</a>).", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "doi": "10.7554/eLife.00666.011", | |
| "id": "fig3", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig3.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig3.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-fig3.jpg" | |
| } | |
| }, | |
| "label": "Figure 3", | |
| "title": "Figure with figure supplements and figure supplement with source data and a video (see <a href=\"#bib25\">Koch, 1959</a>) .", | |
| "type": "image" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.012", | |
| "id": "fig3s1", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig3-figsupp1.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig3-figsupp1.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-fig3-figsupp1.jpg" | |
| } | |
| }, | |
| "label": "Figure 3\u2014figure supplement 1", | |
| "sourceData": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "Legend of the figure supplement source data.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.013", | |
| "filename": "elife-00666-fig3-figsupp1-data1.xlsx", | |
| "id": "fig3sdata1", | |
| "label": "Figure 3\u2014figure supplement 1\u2014source data 1", | |
| "mediaType": "application/xlsx", | |
| "title": "Title of the figure supplement source data.", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-fig3-figsupp1-data1.xlsx" | |
| } | |
| ], | |
| "title": "Title of the figure supplement", | |
| "type": "image" | |
| }, | |
| { | |
| "doi": "10.7554/eLife.00666.035", | |
| "id": "fig3video1", | |
| "label": "Figure 3\u2014video 1", | |
| "title": "\n A description of the eLife editorial process.\n ", | |
| "type": "video", | |
| "height": 720, | |
| "width": 1280, | |
| "image": "https://cdn.elifesciences.org/articles/00666/elife-00666-fig3-video1.jpg", | |
| "sources": [ | |
| { | |
| "mediaType": "video/mp4; codecs=\"avc1.42E01E, mp4a.40.2\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/mp4/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-fig3-video1.mp4" | |
| }, | |
| { | |
| "mediaType": "video/webm; codecs=\"vp8.0, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/webm/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-fig3-video1.webm" | |
| }, | |
| { | |
| "mediaType": "video/ogg; codecs=\"theora, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/ogv/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-fig3-video1.ogv" | |
| } | |
| ], | |
| "placeholder": { | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig3-video1.jpg", | |
| "alt": "", | |
| "size": { | |
| "width": 1280, | |
| "height": 720 | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig3-video1.jpg/full/full/0/default.jpg", | |
| "filename": "elife-00666-fig3-video1.jpg" | |
| } | |
| } | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "text": "<a href=\"#fig4\">Figure 4</a> is an example of a figure with source code (<a href=\"#fig4scode1\">Figure 4\u2014source code 1</a>).", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "doi": "10.7554/eLife.00666.014", | |
| "id": "fig4", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig4.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-fig4.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-fig4.jpg" | |
| } | |
| }, | |
| "label": "Figure 4", | |
| "title": "Single figure with source code.", | |
| "type": "image" | |
| } | |
| ], | |
| "type": "figure" | |
| } | |
| ], | |
| "id": "s2-4", | |
| "title": "Figures", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "<a href=\"#video1\">Video 1</a> shows the editorial process and <a href=\"#video2\">Animation 1</a> shows how we represent animated gif files.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "doi": "10.7554/eLife.00666.016", | |
| "id": "video1", | |
| "label": "Video 1", | |
| "sourceData": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "Legend of the source code.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.037", | |
| "filename": "elife-00666-video1-data1.xlsx", | |
| "id": "video1sdata1", | |
| "label": "Video 1\u2014source data 1", | |
| "mediaType": "application/xlsx", | |
| "title": "Title of the source code.", | |
| "uri": "https://cdn.elifesciences.org/articles/00666/elife-00666-video1-data1.xlsx" | |
| } | |
| ], | |
| "title": "\n A description of the eLife editorial process.\n ", | |
| "type": "video", | |
| "height": 720, | |
| "width": 1280, | |
| "image": "https://cdn.elifesciences.org/articles/00666/elife-00666-video1.jpg", | |
| "sources": [ | |
| { | |
| "mediaType": "video/mp4; codecs=\"avc1.42E01E, mp4a.40.2\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/mp4/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video1.mp4" | |
| }, | |
| { | |
| "mediaType": "video/webm; codecs=\"vp8.0, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/webm/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video1.webm" | |
| }, | |
| { | |
| "mediaType": "video/ogg; codecs=\"theora, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/ogv/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video1.ogv" | |
| } | |
| ], | |
| "placeholder": { | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-video1.jpg", | |
| "alt": "", | |
| "size": { | |
| "width": 1280, | |
| "height": 720 | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-video1.jpg/full/full/0/default.jpg", | |
| "filename": "elife-00666-video1.jpg" | |
| } | |
| } | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "autoplay": true, | |
| "doi": "10.7554/eLife.00666.038", | |
| "id": "video2", | |
| "label": "Animation 1", | |
| "loop": true, | |
| "title": "A demonstration of how to tag an animated gif file to ensure it is autolooped when on the eLife website.", | |
| "type": "video", | |
| "height": 834, | |
| "width": 669, | |
| "image": "https://cdn.elifesciences.org/articles/00666/elife-00666-video2.jpg", | |
| "sources": [ | |
| { | |
| "mediaType": "video/mp4; codecs=\"avc1.42E01E, mp4a.40.2\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/mp4/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video2.mp4" | |
| }, | |
| { | |
| "mediaType": "video/webm; codecs=\"vp8.0, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/webm/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video2.webm" | |
| }, | |
| { | |
| "mediaType": "video/ogg; codecs=\"theora, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/ogv/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-video2.ogv" | |
| } | |
| ], | |
| "placeholder": { | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-video2.jpg", | |
| "alt": "", | |
| "size": { | |
| "width": 669, | |
| "height": 834 | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-video2.jpg/full/full/0/default.jpg", | |
| "filename": "elife-00666-video2.jpg" | |
| } | |
| } | |
| } | |
| ], | |
| "type": "figure" | |
| } | |
| ], | |
| "id": "s2-5", | |
| "title": "Videos", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "content": [ | |
| { | |
| "text": "It is rare for eLife research articles to contain boxes; however they are common in Feature content. <a href=\"#box1\">Box 1</a> is a simple box that contains very little text and <a href=\"#box2\">Box 2</a> is larger.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "Example of a small box", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Donec rhoncus in odio non vulputate. Donec vitae enim at erat tincidunt tincidunt in nec arcu. Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Aliquam id nunc id arcu maximus rutrum. Praesent bibendum nisl orci, ac sollicitudin purus aliquam in. Duis eu fermentum arcu. Fusce eget dolor augue. Nulla facilisi. Suspendisse eu nisl vitae neque ullamcorper imperdiet (see <a href=\"#bib29\">Nell\u00e5ker, 2014</a>; <a href=\"#bib30\"> Pages et al., 2014</a>; and <a href=\"#bib31\">Palmer et al., 2007</a>). Boxes, like main text, can contain <a href=\"https://elifesciences.org/about\">hyperlinks</a> at any point. Etiam in sem augue.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.017", | |
| "id": "box1", | |
| "title": "Box 1.", | |
| "type": "box" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "Example of a large box", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "This box contains a <a href=\"#box2fig1\">figure</a>. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Quisque vel rhoncus lorem. Suspendisse posuere non enim vel tempor. Fusce quis sem sed nulla tincidunt faucibus. Vivamus dictum magna in ante porttitor faucibus. Aenean lobortis, sem in viverra dignissim, odio purus vestibulum libero, in eleifend lacus metus id tortor. Phasellus tincidunt ipsum ut ornare hendrerit. Praesent lobortis consectetur egestas. Curabitur viverra lectus eu venenatis sagittis. Aliquam lobortis metus mauris, in tincidunt diam ullamcorper ac. Phasellus sagittis, leo eget lacinia commodo, eros justo mattis eros, quis dapibus ipsum ex sit amet sapien. Quisque consequat arcu ut efficitur tincidunt. Ut convallis, ex maximus aliquam tempor, lorem elit fermentum ipsum, nec volutpat velit sem a lectus. Morbi sed mauris vel purus interdum consectetur dapibus vel velit. Nam pellentesque, ipsum vel euismod mattis, turpis augue mattis nunc, ac aliquam dolor massa non mi. Vestibulum sit amet elit a augue semper facilisis interdum quis nibh. Mauris consectetur nisi aliquam urna lobortis, eu efficitur nisl lobortis; <a href=\"#bib2\">Bates et al., 2016</a> and <a href=\"#bib32\">Patterson et al., 2011</a>.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "doi": "10.7554/eLife.00666.036", | |
| "id": "box2fig1", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-box2-fig1.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-box2-fig1.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-box2-fig1.jpg" | |
| } | |
| }, | |
| "label": "Box 2\u2014Figure 1", | |
| "title": "Box figure", | |
| "type": "image" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "text": "Donec rhoncus in odio non vulputate. Donec vitae enim at erat tincidunt tincidunt in nec arcu. Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Aliquam id nunc id arcu maximus rutrum. Praesent bibendum nisl orci, ac sollicitudin purus aliquam in. Duis eu fermentum arcu. Fusce eget dolor augue. Nulla facilisi. Suspendisse eu nisl vitae neque ullamcorper imperdiet. Vestibulum ultrices vehicula nibh, a ullamcorper dui semper suscipit. Etiam in sem augue.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.018", | |
| "id": "box2", | |
| "label": "Box 2", | |
| "title": "Box figure", | |
| "type": "box" | |
| } | |
| ], | |
| "id": "s2-6-1", | |
| "title": "Boxes", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "If an author mentions an RRID in their content, it is required that we link it, for example, <a href=\"https://scicrunch.org/resolver/RRID:IMSR_JAX:004435\">RRID:IMSR_JAX:004435</a>.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s2-6-2", | |
| "title": "RRIDs", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "Here is an example of making text display in different colours: <span class=\"author-callout-style-a1\">Blue text: #366BFB</span>; <span class=\"author-callout-style-a2\">Purple text: #9C27B0</span>; and <span class=\"author-callout-style-a3\">Red text: #D50000</span>.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s2-6-3", | |
| "title": "Coloured text", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "Here is an example of pulling in an inline graphic <img src=\"https://cdn.elifesciences.org/articles/00666/elife-00666-inf001.jpeg\"/>.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s2-6-4", | |
| "title": "Inline graphics", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "All files attached to an article must be cited in the main text as well. So, <a href=\"#supp1\">Supplementary file 1</a> and <a href=\"#sdata1\">Source data 1</a> have to be cited in the text.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s2-6-5", | |
| "title": "Additional files", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "All references have to be cited in the main text. They are listed in the reference list in alphabetical order, however, in the text the citations do not have to be in the same order as they are listed according to when the author of the article cites them. This article is littered with citations to ensure all the references are cited at some point. They have no relevance to the content <a href=\"#bib1\">Aivazian et al., 2006</a>.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s2-6-6", | |
| "title": "References", | |
| "type": "section" | |
| } | |
| ], | |
| "id": "s2-6", | |
| "title": "Other stuff", | |
| "type": "section" | |
| } | |
| ], | |
| "id": "s2", | |
| "title": "Results", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "The function of the Discussion is to interpret your results in light of what was already known about the subject of the investigation, and to explain our new understanding of the problem after taking your results into consideration. The Discussion will always connect to the Introduction by way of the question(s) or hypotheses you posed and the literature you cited, but it does not simply repeat or rearrange the Introduction. Instead, it tells how your study has moved us forward from the place you left us at the end of the Introduction (<a href=\"#bib38\">Schneider, 2006</a>; <a href=\"#bib40\"> Schwartz, 1993</a>).", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s3", | |
| "title": "Discussion", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "assets": [ | |
| { | |
| "id": "keyresource", | |
| "label": "Key resources table", | |
| "tables": [ | |
| "<table>\n<thead>\n<tr>\n<th>Reagent type <br/>(species) or resource</th>\n<th>Designation</th>\n<th>Source or reference</th>\n<th>Identifiers</th>\n<th>Additional <br/>information</th>\n</tr>\n</thead>\n<tbody>\n<tr>\n<td>gene (<i>Drosophila melanogaster</i>)</td>\n<td>nito</td>\n<td>NA</td>\n<td>FLYB:FBgn0027548</td>\n<td>\u00a0</td>\n</tr>\n<tr>\n<td>gene (<i>D. melanogaste</i>r)</td>\n<td>Sxl</td>\n<td>NA</td>\n<td>FLYB:FBgn0264270</td>\n<td>\u00a0</td>\n</tr>\n<tr>\n<td>genetic reagent (D. melanogaster)</td>\n<td>MTD-Gal4</td>\n<td>Bloomington Drosophila Stock Center</td>\n<td>BDSC:31777; FLYB:FBtp0001612; RRID:<a href=\"https://scicrunch.org/resolver/BDSC_31777\">BDSC_31777</a></td>\n<td>FlyBase symbol: P{GAL4-nos.NGT}</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaster</i>)</td>\n<td>ap-Gal4</td>\n<td>Bloomington Drosophila Stock Center</td>\n<td>BDSC:3041; FLYB:FBti0002785; RRID:<a href=\"https://scicrunch.org/resolver/BDSC_3041\">BDSC_3041</a></td>\n<td>FlyBase symbol: P{GawB}ap[md544]</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaster</i>)</td>\n<td>nub-Gal4</td>\n<td>PMID:20798049</td>\n<td>FLYB:FBti0016825</td>\n<td>FlyBase symbol: P{GawB}nubbin-AC-62</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaste</i>r)</td>\n<td>dome-Gal4</td>\n<td>PMID:12403714</td>\n<td>FLYB:FBti0022298</td>\n<td>FlyBase symbol: P{GawB}dome[PG14]</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaster</i>)</td>\n<td>UAS-2xEYFP</td>\n<td>PMID:12324968</td>\n<td>FLYB:FBtp0016537</td>\n<td>FlyBase symbol: P{UAS-2xEYFP}</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaster</i>)</td>\n<td>nito[HP25329]</td>\n<td>Bloomington Drosophila Stock Center</td>\n<td>BDSC:22092; FLYB:FBal0238892; RRID:<a href=\"https://scicrunch.org/resolver/BDSC_22092\">BDSC_22092</a></td>\n<td>Genotype: w[1118]; P{w[+mC]=EPg}nito[HP25329]/CyO</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaster</i>)</td>\n<td>nito[1]</td>\n<td>this paper</td>\n<td>\u00a0</td>\n<td>Progenitor = nito[HP25329]; imprecise excision; lethal</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaster</i>)</td>\n<td>nito shRNA (HMJ02081)</td>\n<td>Bloomington Drosophila Stock Center</td>\n<td>TRiP:HMJ02081; BDSC:56852; RRID:<a href=\"https://scicrunch.org/resolver/BDSC_56852\">BDSC_56852</a></td>\n<td>FlyBase symbol: P{TRiP.HMJ02081}attP40</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaster</i>)</td>\n<td>nito dsRNA (VDRC 20942)</td>\n<td>Vienna Drosophila RNAi Center</td>\n<td>VDRC:20942</td>\n<td>\u00a0</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaster</i>)</td>\n<td>FRT[G13]</td>\n<td>Bloomington Drosophila Stock Center</td>\n<td>BDSC:1956; FLYB:FBti0001247</td>\n<td>FlyBase symbol: P{FRT(whs)}G13</td>\n</tr>\n<tr>\n<td>genetic reagent (<i>D. melanogaster</i>)</td>\n<td>\"y w hsflp; ubiGFP FRT[G13]\"</td>\n<td>PMID:18160348</td>\n<td>\u00a0</td>\n<td>\u00a0</td>\n</tr>\n<tr>\n<td>cell line (<i>D. melanogaste</i>r)</td>\n<td>S2</td>\n<td>other</td>\n<td>FLYB:FBtc0000181; RRID:<a href=\"https://scicrunch.org/resolver/CVCL_Z992\">CVCL_Z992</a></td>\n<td>Cell line maintained in N. Perrimon lab; FlyBase symbol:\n S2-DRSC.</td>\n</tr>\n<tr>\n<td>antibody</td>\n<td>anti-Nito</td>\n<td>this paper</td>\n<td>\u00a0</td>\n<td>Rabbit polyclonal; against aa 479-500; used YZ3137 (1:500)</td>\n</tr>\n<tr>\n<td>antibody</td>\n<td>anti-alpha-Spectrin (mouse monoclonal)</td>\n<td>Developmental Studies Hybridoma Bank</td>\n<td>DSHB:3A9; RRID:<a href=\"https://scicrunch.org/resolver/AB_528473\">AB_528473</a></td>\n<td>(1:10)</td>\n</tr>\n<tr>\n<td>antibody</td>\n<td>anti-Vasa (rabbit polyclonal)</td>\n<td>Santa Cruz Biotechnology</td>\n<td>Santa Cruz:sc-30210; RRID:<a href=\"https://scicrunch.org/resolver/AB_793874\">AB_793874</a></td>\n<td>(1:250)</td>\n</tr>\n<tr>\n<td>antibody</td>\n<td>anti-Sxl (mouse monoclonal)</td>\n<td>Developmental Studies Hybridoma Bank</td>\n<td>DSHB:M18; RRID:<a href=\"https://scicrunch.org/resolver/AB_528464\">AB_528464</a></td>\n<td>(1:10)</td>\n</tr>\n<tr>\n<td>antibody</td>\n<td>anti-GFP (rabbit polyclonal)</td>\n<td>Molecular Probes</td>\n<td>Molecular Probes:A-6455; RRID:<a href=\"https://scicrunch.org/resolver/AB_221570\">AB_221570</a></td>\n<td>(1:1000)</td>\n</tr>\n<tr>\n<td>antibody</td>\n<td>anti-GFP (mouse monoclonal)</td>\n<td>Molecular Probes</td>\n<td>Molecular Probes:A-11120; RRID:<a href=\"https://scicrunch.org/resolver/AB_221568\">AB_221568</a></td>\n<td>(1:200)</td>\n</tr>\n<tr>\n<td>antibody</td>\n<td>anti-HA (rat monoclonal)</td>\n<td>Roche</td>\n<td>Roche:3F10; RRID:<a href=\"https://scicrunch.org/resolver/AB_2314622\">AB_2314622</a></td>\n<td>\u00a0</td>\n</tr>\n<tr>\n<td>antibody</td>\n<td>Alexa 488- or 555- secondaries</td>\n<td>Molecular Probes</td>\n<td>\u00a0</td>\n<td>(1:1000)</td>\n</tr>\n<tr>\n<td>other</td>\n<td>DAPI stain</td>\n<td>Molecular Probes</td>\n<td>\u00a0</td>\n<td>(1:1000)</td>\n</tr>\n<tr>\n<td>recombinant DNA reagent</td>\n<td>pAGW (Gateway vector)</td>\n<td>Drosophila Genomics Resource Center</td>\n<td>DGRC:1071</td>\n<td>\u00a0</td>\n</tr>\n<tr>\n<td>recombinant DNA reagent</td>\n<td>pAHW (Gateway vector)</td>\n<td>Drosophila Genomics Resource Center</td>\n<td>DGRC:1095</td>\n<td>\u00a0</td>\n</tr>\n<tr>\n<td>recombinant DNA reagent</td>\n<td>GH11110 (cDNA)</td>\n<td>Drosophila Genomics Resource Center</td>\n<td>DGRC:5666</td>\n<td>\u00a0</td>\n</tr>\n<tr>\n<td>recombinant DNA reagent</td>\n<td>GFP-Nito (plasmid)</td>\n<td>this paper</td>\n<td>\u00a0</td>\n<td>Progenitors: GH11110 (cDNA); Gateway vector pAGW</td>\n</tr>\n<tr>\n<td>recombinant DNA reagent</td>\n<td>HA-Sxl (plasmid)</td>\n<td>PMID:16207758</td>\n<td>\u00a0</td>\n<td>Progentiors: PCR, UAS-Sxl flies; Gateway vector pAHW</td>\n</tr>\n<tr>\n<td>recombinant DNA reagent</td>\n<td>GFP-Sxl (plasmid)</td>\n<td>PMID:16207758</td>\n<td>\u00a0</td>\n<td>Progentiors: PCR, UAS-Sxl flies; Gateway vector pAGW</td>\n</tr>\n</tbody>\n</table>" | |
| ], | |
| "type": "table" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "text": "eLife is tagged up as XML using the NISO standard JATS DTD. We conform to the JATS4R recommendations where possible and also deliver our content to PMC. We also convert our JATS XML to PubMed and CrossRef DTDs when we deposit our content with them. eLife content is delivered to more repositories and it can be scraped from the eLife site (<a href=\"#bib17\"> Gall et al., 2012</a>; <a href=\"#bib22\">Horne and Page, 2008</a>; <a href=\"#bib27\"> McQuilton et al., 2012</a>; <a href=\"#bib43\">Staab et al., 2013</a>).", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "The following is an example of monotype text within the body of an eLife article.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "<span class=\"monospace\">P<sub>NRE+AP-1</sub>: 5\u2019\u2013 CTTCGTGACTAGTCTTGACTCAGA \u20133\u2019</span>", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "<span class=\"monospace\">P<sub>RAM</sub>: 5\u2019\u2013 CTAGAAGTTTGTTCGTGACTCAGA \u20133\u2019</span>", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "<span class=\"monospace\">E1: 5\u2019\u2013 CTAGAAGTTTGTTGACTCACCCGA \u20133\u2019</span>", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "<span class=\"monospace\">E2: 5\u2019\u2013 CTAGAAGTTTGTTGACTCATTAGA \u20133\u2019</span>", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "<span class=\"monospace\">E3: 5\u2019\u2013 CTAGAAGTTTGTGTATGACTCAGA \u20133\u2019</span>", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "<span class=\"monospace\">CME: 5\u2019\u2013 CTAGAAATTTGTACGTGCCACAGA \u20133\u2019</span>", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "In some cases, authors will include extremely long gene sequences or other letter strings that need to be enclosed withing a particular style tagging in order that they can be wrapped on the final HTML display. If this tagging is not included, the strings will likely spill across the edge of the text column, which can look very messy, not to mention rather silly: <span class=\"sequence\">TAATAAGGAAGAACTGCTTATTCTTAATTATTTCTACCTACTAAACTAACTAATTATCAACAAATATCATCTATTTAATAGTATATCATCACATGCGGTGTAAGAGGATGACATAAAGATTGAGAAACAGTCATCCAGTCTAATGGAAGCTCAAATGCAAGGGCTGATAATGTAATAGGATAATGAATGACAACGTATAAAAGGAAAGAAGATAAAGCAATATTATTTTGTAGAATTATCGATTCCCTTTTGTGGATCCCTATATCCTCGAGGAGAA</span>. Sequences like this should be tagged during pre-editing. This tagging will also increase discoverability of gene sequences in eLife articles.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s4", | |
| "title": "Materials and methods", | |
| "type": "section" | |
| } | |
| ], | |
| "references": [ | |
| { | |
| "articleTitle": "TIP47 is a key effector for Rab9 localization", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Aivazian, D", | |
| "preferred": "D Aivazian" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Serrano, RL", | |
| "preferred": "RL Serrano" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Pfeffer, S", | |
| "preferred": "S Pfeffer" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2006", | |
| "doi": "10.1083/jcb.200510010", | |
| "id": "bib1", | |
| "journal": "The Journal of Cell Biology", | |
| "pages": { | |
| "first": "917", | |
| "last": "926", | |
| "range": "917\u2013926" | |
| }, | |
| "pmid": 16769818, | |
| "type": "journal", | |
| "volume": "173" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Bates, D", | |
| "preferred": "D Bates" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Maechler, M", | |
| "preferred": "M Maechler" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Bolker, B", | |
| "preferred": "B Bolker" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Walker, S", | |
| "preferred": "S Walker" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Haubo Bojesen Christensen, R", | |
| "preferred": "R Haubo Bojesen Christensen" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Singmann, H", | |
| "preferred": "H Singmann" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Dai, B", | |
| "preferred": "B Dai" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Grothendieck, G", | |
| "preferred": "G Grothendieck" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Green, P", | |
| "preferred": "P Green" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "curators": [ | |
| { | |
| "name": { | |
| "index": "Bolker, B", | |
| "preferred": "B Bolker" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2016", | |
| "id": "bib2", | |
| "publisher": { | |
| "name": [ | |
| "CRAN" | |
| ] | |
| }, | |
| "source": "CRAN", | |
| "title": "Lme4: Linear Mixed-Effects Models Using Eigen and S4", | |
| "type": "software", | |
| "uri": "https://cran.r-project.org/web/packages/lme4/index.html", | |
| "version": "1.1-12" | |
| }, | |
| { | |
| "articleTitle": "A prospective randomized trial examining health care utilization in individuals using multiple \n smartphone-enabled biosensors", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Bloss, CS", | |
| "preferred": "CS Bloss" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Wineinger, NE", | |
| "preferred": "NE Wineinger" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Peters, M", | |
| "preferred": "M Peters" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Boeldt, DL", | |
| "preferred": "DL Boeldt" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Ariniello, L", | |
| "preferred": "L Ariniello" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Kim, JL", | |
| "preferred": "JL Kim" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Judy Sheard, J", | |
| "preferred": "J Judy Sheard" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Komatireddy, R", | |
| "preferred": "R Komatireddy" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Barrett, P", | |
| "preferred": "P Barrett" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Topol, EJ", | |
| "preferred": "EJ Topol" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2016", | |
| "doi": "10.1101/029983", | |
| "id": "bib3", | |
| "source": "bioRxiv", | |
| "type": "preprint", | |
| "uri": "https://doi.org/10.1101/029983" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Bouveret, R", | |
| "preferred": "R Bouveret" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Waardenberg, AJ", | |
| "preferred": "AJ Waardenberg" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Schonrock, N", | |
| "preferred": "N Schonrock" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Ramialison, M", | |
| "preferred": "M Ramialison" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Doan, T", | |
| "preferred": "T Doan" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "de Jong, D", | |
| "preferred": "D de Jong" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Bondue, A", | |
| "preferred": "A Bondue" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Kaur, G", | |
| "preferred": "G Kaur" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Mohamed, S", | |
| "preferred": "S Mohamed" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Fonoudi, H", | |
| "preferred": "H Fonoudi" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Chen, C", | |
| "preferred": "C Chen" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Wouters, M", | |
| "preferred": "M Wouters" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Bhattacharya, S", | |
| "preferred": "S Bhattacharya" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": " Plachta, N", | |
| "preferred": "N Plachta" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Dunwoodie, SL", | |
| "preferred": "SL Dunwoodie" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Chapman, G", | |
| "preferred": "G Chapman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Blanpain, C", | |
| "preferred": "C Blanpain" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Harvey, RP", | |
| "preferred": "RP Harvey" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "dataId": "GSE44902", | |
| "date": "2015", | |
| "id": "bib4", | |
| "source": "NCBI Gene Expression Omnibus", | |
| "title": "NKX2-5 mutations causative for congenital heart disease retain\n functionality and are directed to hundreds of targets", | |
| "type": "data" | |
| }, | |
| { | |
| "articleTitle": "Aquiflexum balticum gen. nov., sp nov., a novel marine bacterium\n of the Cytophaga-Flavobacterium-Bacteroides group isolated from surface\n water of the central Baltic Sea", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Brettar, I", | |
| "preferred": "I Brettar" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Christen, R", | |
| "preferred": "R Christen" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Hofle, M", | |
| "preferred": "M Hofle" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2004", | |
| "discriminator": "a", | |
| "doi": "10.1099/ijs.0.63255-0", | |
| "id": "bib5", | |
| "journal": "International journal of systematic and evolutionary\n microbiology", | |
| "pages": { | |
| "first": "2335", | |
| "last": "2341", | |
| "range": "2335\u20132341" | |
| }, | |
| "pmid": 15545480, | |
| "type": "journal", | |
| "volume": "54" | |
| }, | |
| { | |
| "articleTitle": "Belliella baltica gen. nov., sp. nov., a novel marine bacterium\n of the Cytophaga-Flavobacterium-Bacteroides group isolated from surface\n water of the central Baltic Sea", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Brettar, I", | |
| "preferred": "I Brettar" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Christen, R", | |
| "preferred": "R Christen" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Hofle, MG", | |
| "preferred": "MG Hofle" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2004", | |
| "discriminator": "b", | |
| "doi": "10.1099/ijs.0.02752-0", | |
| "id": "bib6", | |
| "journal": "International journal of systematic and evolutionary\n microbiology", | |
| "pages": "65", | |
| "pmid": 14742460, | |
| "type": "journal", | |
| "volume": "54" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Bricogne, G", | |
| "preferred": "G Bricogne" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Blanc, E", | |
| "preferred": "E Blanc" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Brandl, M", | |
| "preferred": "M Brandl" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Flensburg, C", | |
| "preferred": "C Flensburg" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Keller, P", | |
| "preferred": "P Keller" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Paciorek, W", | |
| "preferred": "W Paciorek" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Roversi, P", | |
| "preferred": "P Roversi" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Sharff, A", | |
| "preferred": "A Sharff" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Smart, OS", | |
| "preferred": "OS Smart" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Vonrhein, C", | |
| "preferred": "C Vonrhein" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Womack, TO", | |
| "preferred": "TO Womack" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2011", | |
| "id": "bib7", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Cambridge, UK" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge, UK" | |
| ] | |
| }, | |
| "name": [ | |
| "Global Phasing Ltd" | |
| ] | |
| }, | |
| "title": "BUSTER", | |
| "type": "software", | |
| "uri": "https://www.globalphasing.com/buster/", | |
| "version": "2.10.0" | |
| }, | |
| { | |
| "bookTitle": "Advances in insect chemical ecology", | |
| "date": "2004", | |
| "editors": [ | |
| { | |
| "name": { | |
| "index": "Card\u00e9, RT", | |
| "preferred": "RT Card\u00e9" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Millar, JG", | |
| "preferred": "JG Millar" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "id": "bib8", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "name": [ | |
| "Cambridge University Press" | |
| ] | |
| }, | |
| "type": "book" | |
| }, | |
| { | |
| "articleTitle": "The Venus Hypothesis", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Cartwright, A", | |
| "preferred": "A Cartwright" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2016", | |
| "id": "bib9", | |
| "source": "arXiv.org", | |
| "type": "preprint", | |
| "uri": "https://arxiv.org/abs/1608.03074" | |
| }, | |
| { | |
| "bookTitle": "An Introduction to Work and Organizational Psychology: A European\n Perspective", | |
| "date": "2008", | |
| "edition": "2", | |
| "editors": [ | |
| { | |
| "name": { | |
| "index": "Chmeil, N", | |
| "preferred": "N Chmeil" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "id": "bib10", | |
| "publisher": { | |
| "name": [ | |
| "Wiley-Blackwell" | |
| ] | |
| }, | |
| "type": "book" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Coyne, JA", | |
| "preferred": "JA Coyne" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Orr, HA", | |
| "preferred": "HA Orr" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "bookTitle": "Speciation and its consequences", | |
| "chapterTitle": "Two rules of speciation", | |
| "date": "1989", | |
| "editors": [ | |
| { | |
| "name": { | |
| "index": "Otte, D", | |
| "preferred": "D Otte" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Endler, JA", | |
| "preferred": "JA Endler" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "id": "bib11", | |
| "pages": { | |
| "first": "1", | |
| "last": "2", | |
| "range": "1\u20132" | |
| }, | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Sunderland, MA" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Sunderland, MA" | |
| ] | |
| }, | |
| "name": [ | |
| "Sinauer Associates" | |
| ] | |
| }, | |
| "type": "book-chapter" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "DeLano, W", | |
| "preferred": "W DeLano" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2002", | |
| "id": "bib12", | |
| "publisher": { | |
| "name": [ | |
| "Schr\u00f6dinger LLC" | |
| ] | |
| }, | |
| "source": "PyMol", | |
| "title": "The PyMol Molecular Graphics System", | |
| "type": "software", | |
| "uri": "https://www.pymol.org/", | |
| "version": "Version 1.7.4" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": "Department of Education", | |
| "type": "group" | |
| }, | |
| { | |
| "name": { | |
| "index": "Morgan, N", | |
| "preferred": "N Morgan" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2016", | |
| "id": "bib13", | |
| "isbn": "978-1-4741-3015-8", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "Her Majesty\u2019s Stationery Office" | |
| ] | |
| }, | |
| "source": "Educational excellence everywhere", | |
| "title": "Educational excellence everywhere", | |
| "type": "report" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Du, J", | |
| "preferred": "J Du" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Johnson, LM", | |
| "preferred": "LM Johnson" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Groth, M", | |
| "preferred": "M Groth" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Feng, S", | |
| "preferred": "S Feng" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Hale, CJ", | |
| "preferred": "CJ Hale" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Li, S", | |
| "preferred": "S Li" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Vashisht, AA", | |
| "preferred": "AA Vashisht" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Gallego-Bartolome, J", | |
| "preferred": "J Gallego-Bartolome" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Wohlschlegel, JA", | |
| "preferred": "JA Wohlschlegel" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Patel, DJ", | |
| "preferred": "DJ Patel" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Jacobsen, SE", | |
| "preferred": "SE Jacobsen" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2014", | |
| "doi": "10.2210/pdb4qen/pdb", | |
| "id": "bib14", | |
| "source": "RCSB Protein Data Bank", | |
| "title": "Crystal structure of KRYPTONITE in complex with mCHH DNA and\n SAH", | |
| "type": "data", | |
| "uri": "https://doi.org/10.2210/pdb4qen/pdb" | |
| }, | |
| { | |
| "accessed": "2016-08-19", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Eisen, M", | |
| "preferred": "M Eisen" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2016", | |
| "id": "bib15", | |
| "title": "The Imprinter of All Maladies", | |
| "type": "web", | |
| "uri": "http://www.michaeleisen.org/blog/?p=1894", | |
| "website": "it is NOT junk" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Ferry, Q", | |
| "preferred": "Q Ferry" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Steinberg, J", | |
| "preferred": "J Steinberg" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Webber, C", | |
| "preferred": "C Webber" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "FitzPatrick, DR", | |
| "preferred": "DR FitzPatrick" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Ponting, CP", | |
| "preferred": "CP Ponting" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Zisserman, A", | |
| "preferred": "A Zisserman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Nell\u00e5ker, C", | |
| "preferred": "C Nell\u00e5ker" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2014", | |
| "id": "bib16", | |
| "source": "Division of Clinical Neurology, University of Oxford", | |
| "title": "Diagnostically relevant facial gestalt information from ordinary photos database", | |
| "type": "data", | |
| "uri": "https://github.com/ChristofferNellaker/Clinical_Face_Phenotype_Space_Pipeline" | |
| }, | |
| { | |
| "articleTitle": "Autoimmunity initiates in nonhematopoietic cells and progresses\n via lymphocytes in an interferon-dependent autoimmune\n disease", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Gall, A", | |
| "preferred": "A Gall" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Treuting, P", | |
| "preferred": "P Treuting" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Elkon, KB", | |
| "preferred": "KB Elkon" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Loo, YM", | |
| "preferred": "YM Loo" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Gale, M, Jnr", | |
| "preferred": "M Gale Jnr" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Barber, GN", | |
| "preferred": "GN Barber" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2012", | |
| "doi": "10.1016/j.immuni.2011.11.018", | |
| "id": "bib17", | |
| "journal": "Immunity", | |
| "pages": { | |
| "first": "120", | |
| "last": "131", | |
| "range": "120\u2013131" | |
| }, | |
| "pmid": 22284419, | |
| "type": "journal", | |
| "volume": "36" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Gavrilov, S", | |
| "preferred": "S Gavrilov" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Harvey, RP", | |
| "preferred": "RP Harvey" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Papaioannou, VE", | |
| "preferred": "VE Papaioannou" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "dataId": "NM_009324", | |
| "date": "2014", | |
| "id": "bib18", | |
| "source": "NCBI Nucleotide", | |
| "title": "Mus musculus T-box 2 (Tbx2), mRNA", | |
| "type": "data" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": "GlaxoSmithKline UK", | |
| "type": "group" | |
| } | |
| ], | |
| "date": "2016", | |
| "id": "bib19", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "formatted": [ | |
| "United Kingdom" | |
| ] | |
| }, | |
| "name": [ | |
| "GlaxoSmithKline UK" | |
| ] | |
| }, | |
| "source": "Augmentin 250/62 SF Suspension", | |
| "title": "Augmentin 250/62 SF Suspension", | |
| "type": "report", | |
| "uri": "https://www.medicines.org.uk/emc/medicine/19188" | |
| }, | |
| { | |
| "articleTitle": "\n Ruffus: a lightweight Python library for computational pipelines\n ", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Goodstadt, L", | |
| "preferred": "L Goodstadt" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2010", | |
| "doi": "10.1093/bioinformatics/btq524", | |
| "id": "bib20", | |
| "journal": "Bioinformatics", | |
| "pages": { | |
| "first": "2778", | |
| "last": "2779", | |
| "range": "2778\u20132779" | |
| }, | |
| "pmid": 20847218, | |
| "type": "journal", | |
| "volume": "26" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Hoang, C", | |
| "preferred": "C Hoang" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Swift, GH", | |
| "preferred": "GH Swift" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Azevedo-Pouly, A", | |
| "preferred": "A Azevedo-Pouly" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "MacDonald, RJ", | |
| "preferred": "RJ MacDonald" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "dataId": "GSE70542", | |
| "date": "2015", | |
| "id": "bib21", | |
| "source": "NCBI Gene Expression Omnibus", | |
| "title": "Effects on the transcriptome of adult mouse pancreas (principally\n acinar cells) by the inactivation of the Ptf1a gene in vivo", | |
| "type": "data" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Horne, P", | |
| "preferred": "P Horne" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Page, J", | |
| "preferred": "J Page" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "bookTitle": "Integrated pest management for crops and pastures", | |
| "date": "2008", | |
| "id": "bib22", | |
| "isbn": "978-0-643-09257-0", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Victoria" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Victoria" | |
| ] | |
| }, | |
| "name": [ | |
| "Landlinks Press" | |
| ] | |
| }, | |
| "type": "book" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Hubbard, S", | |
| "preferred": "S Hubbard" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Thornton, J", | |
| "preferred": "J Thornton" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "1993", | |
| "id": "bib23", | |
| "publisher": { | |
| "name": [ | |
| "Department of Biochemistry Molecular Biology, University College London" | |
| ] | |
| }, | |
| "source": "Naccess", | |
| "title": "Naccess", | |
| "type": "software", | |
| "uri": "http://www.bioinf.manchester.ac.uk/naccess", | |
| "version": "V2.1.1" | |
| }, | |
| { | |
| "articleTitle": "Boundary learning by optimization with topological\n constraints", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Jain, BV", | |
| "preferred": "BV Jain" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Bollman, B", | |
| "preferred": "B Bollman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Richardson, M", | |
| "preferred": "M Richardson" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Berger, DR", | |
| "preferred": "DR Berger" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Helmstaedter, MN", | |
| "preferred": "MN Helmstaedter" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Briggman, KL", | |
| "preferred": "KL Briggman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Denk, W", | |
| "preferred": "W Denk" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Bowden, JB", | |
| "preferred": "JB Bowden" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Mendenhall, JM", | |
| "preferred": "JM Mendenhall" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Abraham, WC", | |
| "preferred": "WC Abraham" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Harris, KM", | |
| "preferred": "KM Harris" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Kasthuri, N", | |
| "preferred": "N Kasthuri" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Hayworth, KJ", | |
| "preferred": "KJ Hayworth" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Schalek, R", | |
| "preferred": "R Schalek" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Tapia, JC", | |
| "preferred": "JC Tapia" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Lichtman, JW", | |
| "preferred": "JW Lichtman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Seung, HS", | |
| "preferred": "HS Seung" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "conference": { | |
| "name": [ | |
| "IEEE Conference on Computer Vision and Pattern Recognition (CVPR), 2010" | |
| ] | |
| }, | |
| "date": "2010", | |
| "id": "bib24", | |
| "type": "conference-proceeding" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Koch, S", | |
| "preferred": "S Koch" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "bookTitle": "Psychology A Study Of A Science", | |
| "date": "1959", | |
| "id": "bib25", | |
| "publisher": { | |
| "name": [ | |
| "Mcgraw-Hill Book Company" | |
| ] | |
| }, | |
| "type": "book", | |
| "volume": "3: Formulations of the Person and the Social Context" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Kok, K", | |
| "preferred": "K Kok" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Ay, A", | |
| "preferred": "A Ay" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Li, L", | |
| "preferred": "L Li" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Arnosti, DN", | |
| "preferred": "DN Arnosti" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2015", | |
| "doi": "10.5061/dryad.cv323", | |
| "id": "bib26", | |
| "source": "Dryad Digital Repository", | |
| "title": "Data from: Genome-wide errant targeting by Hairy", | |
| "type": "data", | |
| "uri": "https://doi.org/10.5061/dryad.cv323" | |
| }, | |
| { | |
| "articleTitle": "FlyBase 101\u2014the basics of navigating FlyBase", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "McQuilton, P", | |
| "preferred": "P McQuilton" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "St Pierre, SE", | |
| "preferred": "SE St Pierre" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Thurmond, J", | |
| "preferred": "J Thurmond" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": "FlyBase Consortium", | |
| "type": "group" | |
| } | |
| ], | |
| "date": "2012", | |
| "doi": "10.1093/nar/gkr1030", | |
| "id": "bib27", | |
| "journal": "Nucleic Acids Res", | |
| "pages": { | |
| "first": "D706", | |
| "last": "D714", | |
| "range": "D706\u2013D714" | |
| }, | |
| "pmid": 22127867, | |
| "type": "journal", | |
| "volume": "40" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": "National Institute of Mental Health", | |
| "type": "group" | |
| } | |
| ], | |
| "date": "1990", | |
| "id": "bib28", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Washington, DC, United States" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Washington, DC, United States" | |
| ] | |
| }, | |
| "name": [ | |
| "Government Printing Office" | |
| ] | |
| }, | |
| "source": "Clinical training in serious mental illness (DHHS Publication No. ADM 90-1679)", | |
| "title": "Clinical training in serious mental illness (DHHS Publication No. ADM 90-1679)", | |
| "type": "report" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Nell\u00e5ker, C", | |
| "preferred": "C Nell\u00e5ker" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2014", | |
| "id": "bib29", | |
| "publisher": { | |
| "name": [ | |
| "Github" | |
| ] | |
| }, | |
| "source": "Github", | |
| "title": "Clinical_Face_Phenotype_Space_Pipeline", | |
| "type": "software", | |
| "uri": "https://github.com/ChristofferNellaker/Clinical_Face_Phenotype_Space_Pipeline", | |
| "version": "v1.2" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Pages, H", | |
| "preferred": "H Pages" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Gentleman, R", | |
| "preferred": "R Gentleman" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Aboyoun, P", | |
| "preferred": "P Aboyoun" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Biostrings, DS", | |
| "preferred": "DS Biostrings" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2014", | |
| "id": "bib30", | |
| "publisher": { | |
| "name": [ | |
| "Bioconductor" | |
| ] | |
| }, | |
| "source": "Bioconductor", | |
| "title": "String objects representing biological sequences, and matching algorithms", | |
| "type": "software", | |
| "uri": "https://bioconductor.org/packages/release/bioc/html/Biostrings.html", | |
| "version": "R Package Version 2.30.1" | |
| }, | |
| { | |
| "articleTitle": "Probabilistic Formulation of Independent Vector Analysis Using Complex Gaussian Scale Mixtures", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Palmer, JA", | |
| "preferred": "JA Palmer" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Kreutz-Delgado, K", | |
| "preferred": "K Kreutz-Delgado" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Rao, BD", | |
| "preferred": "BD Rao" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Makeig, S", | |
| "preferred": "S Makeig" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "conference": { | |
| "name": [ | |
| " 8th International Conference, ICA 2009, Paraty, Brazil, March 15-18, 2009" | |
| ] | |
| }, | |
| "date": "2007", | |
| "id": "bib31", | |
| "pages": { | |
| "first": "90", | |
| "last": "97", | |
| "range": "90\u201397" | |
| }, | |
| "source": "Independent component analysis and signal separation", | |
| "type": "conference-proceeding" | |
| }, | |
| { | |
| "assignees": [ | |
| { | |
| "name": "Mankind Corp", | |
| "type": "group" | |
| } | |
| ], | |
| "country": "United States", | |
| "date": "2011", | |
| "id": "bib32", | |
| "inventors": [ | |
| { | |
| "name": { | |
| "index": "Patterson, JB", | |
| "preferred": "JB Patterson" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Lonergan, DG", | |
| "preferred": "DG Lonergan" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Flynn, GA", | |
| "preferred": "GA Flynn" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Qingpeng, Z", | |
| "preferred": "Z Qingpeng" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Pallai, PV", | |
| "preferred": "PV Pallai" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "number": "US20100941530", | |
| "patentType": "United States patent", | |
| "title": "IRE-1alpha inhibitors", | |
| "type": "patent", | |
| "uri": "http://europepmc.org/patents/PAT/US2011065162" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": "R Development Core Team", | |
| "type": "group" | |
| } | |
| ], | |
| "date": "2015", | |
| "id": "bib33", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Vienna, Austria" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Vienna, Austria" | |
| ] | |
| }, | |
| "name": [ | |
| "R Foundation for Statistical Computing" | |
| ] | |
| }, | |
| "title": "R: a language and environment for statistical computing", | |
| "type": "software", | |
| "uri": "http://www.r-project.org/", | |
| "version": "3.2.2" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Radoshevich, L", | |
| "preferred": "L Radoshevich" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Impens, F", | |
| "preferred": "F Impens" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Ribet, D", | |
| "preferred": "D Ribet" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Quereda, JJ", | |
| "preferred": "JJ Quereda" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Nam Tham, T", | |
| "preferred": "T Nam Tham" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Nahori, MA", | |
| "preferred": "MA Nahori" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Bierne, H", | |
| "preferred": "H Bierne" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Dussurget, O", | |
| "preferred": "O Dussurget" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Pizarro-Cerd\u00e1, J", | |
| "preferred": "J Pizarro-Cerd\u00e1" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Knobeloch, KP", | |
| "preferred": "KP Knobeloch" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Cossart, P", | |
| "preferred": "P Cossart" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "dataId": "PXD001805", | |
| "date": "2015", | |
| "discriminator": "a", | |
| "id": "bib34", | |
| "source": "ProteomeXchange", | |
| "title": "ISG15 counteracts <i>Listeria monocytogenes</i>\n infection", | |
| "type": "data", | |
| "uri": "http://proteomecentral.proteomexchange.org/cgi/GetDataset?ID=PXD001805" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Radoshevich, L", | |
| "preferred": "L Radoshevich" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Impens, F", | |
| "preferred": "F Impens" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Ribet, D", | |
| "preferred": "D Ribet" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Quereda, JJ", | |
| "preferred": "JJ Quereda" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Nam Tham, T", | |
| "preferred": "T Nam Tham" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Nahori, MA", | |
| "preferred": "MA Nahori" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Bierne, H", | |
| "preferred": "H Bierne" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Dussurget, O", | |
| "preferred": "O Dussurget" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Pizarro-Cerd\u00e1, J", | |
| "preferred": "J Pizarro-Cerd\u00e1" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Knobeloch, KP", | |
| "preferred": "KP Knobeloch" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Cossart, P", | |
| "preferred": "P Cossart" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "dataId": "E-MTAB-3649", | |
| "date": "2015", | |
| "discriminator": "b", | |
| "id": "bib35", | |
| "source": "ArrayExpress", | |
| "title": "Transcription profiling by high throughput sequencing of LoVo\n cells infected with Listeria for 24 hr compared to uninfected\n cells", | |
| "type": "data" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Rasband, WS", | |
| "preferred": "WS Rasband" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "1997", | |
| "id": "bib36", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Bethesda, MA" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Bethesda, MA" | |
| ] | |
| }, | |
| "name": [ | |
| "US National Institutes of Health" | |
| ] | |
| }, | |
| "title": "Image J", | |
| "type": "software", | |
| "uri": "http://imagej.nih.gov/ij/" | |
| }, | |
| { | |
| "articleTitle": "Arboretum: reconstruction and analysis of the evolutionary\n history of condition-specific transcriptional programs", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Roy, S", | |
| "preferred": "S Roy" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Wapinski", | |
| "preferred": "Wapinski" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Pfiffner, J", | |
| "preferred": "J Pfiffner" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "French, C", | |
| "preferred": "C French" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Socha, A", | |
| "preferred": "A Socha" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Konieczka, J", | |
| "preferred": "J Konieczka" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Regev, A", | |
| "preferred": "A Regev" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2013", | |
| "id": "bib37", | |
| "journal": "Genome Res", | |
| "pages": "In press", | |
| "type": "journal" | |
| }, | |
| { | |
| "author": { | |
| "name": { | |
| "index": "Schneider, P", | |
| "preferred": "P Schneider" | |
| }, | |
| "type": "person" | |
| }, | |
| "date": "2006", | |
| "id": "bib38", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Nijmegen, The Netherlands" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Nijmegen, The Netherlands" | |
| ] | |
| }, | |
| "name": [ | |
| "Radboud University Nijmegen Medical Centre" | |
| ] | |
| }, | |
| "title": "PhD thesis: Submicroscopic <i>Plasmodium falciparum</i> gametocytaemia and the contribution to malaria transmission", | |
| "type": "thesis" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Schr\u00f6dinger, LLC", | |
| "preferred": "LLC Schr\u00f6dinger" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2011", | |
| "id": "bib39", | |
| "publisher": { | |
| "name": [ | |
| "Schr\u00f6dinger LLC" | |
| ] | |
| }, | |
| "source": "The PyMOL Molecular Graphics System", | |
| "title": "The PyMOL Molecular Graphics System", | |
| "type": "software", | |
| "uri": "https://www.pymol.org/", | |
| "version": "1.2r3pre" | |
| }, | |
| { | |
| "articleTitle": "Obesity affects economic, social status", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Schwartz, J", | |
| "preferred": "J Schwartz" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "1993-09-09", | |
| "id": "bib40", | |
| "pages": { | |
| "first": "A1", | |
| "last": "A4", | |
| "range": "A1\u2013A4" | |
| }, | |
| "periodical": "The Washington Post", | |
| "type": "periodical" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": "Scripps Translational Science Institute", | |
| "type": "group" | |
| } | |
| ], | |
| "authorsType": "sponsors", | |
| "date": "2015", | |
| "id": "bib41", | |
| "title": "Scripps Wired for Health Study", | |
| "type": "clinical-trial", | |
| "uri": "https://clinicaltrials.gov/ct2/show/NCT01975428" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Smit, A", | |
| "preferred": "A Smit" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Hubley, R", | |
| "preferred": "R Hubley" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2010", | |
| "id": "bib42", | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Seattle, USA" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Seattle, USA" | |
| ] | |
| }, | |
| "name": [ | |
| "Institute for Systems Biology" | |
| ] | |
| }, | |
| "title": "RepeatModeler", | |
| "type": "software", | |
| "uri": "http://www.repeatmasker.org/RepeatModeler.html", | |
| "version": "open-1.0" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Staab, TA", | |
| "preferred": "TA Staab" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Griffen, TC", | |
| "preferred": "TC Griffen" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Corcoran, C", | |
| "preferred": "C Corcoran" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Evgrafov, O", | |
| "preferred": "O Evgrafov" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Knowles, JA", | |
| "preferred": "JA Knowles" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Sieburth, D", | |
| "preferred": "D Sieburth" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "dataId": "MA0547.1", | |
| "date": "2013", | |
| "id": "bib43", | |
| "source": "JASPAR", | |
| "title": "SKN-1 from the JASPAR CORE database", | |
| "type": "data", | |
| "uri": "http://jaspar.genereg.net/cgi-bin/jaspar_db.pl" | |
| }, | |
| { | |
| "articleTitle": "Hypoxic Preconditioning of Human Cardiosphere-derived Cell Sheets Enhances Cellular Functions via \n Activation of the PI3K/Akt/mTOR/HIF-1a Pathway", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Tanaka, Y", | |
| "preferred": "Y Tanaka" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Hosoyama, T", | |
| "preferred": "T Hosoyama" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Mikamo, A", | |
| "preferred": "A Mikamo" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Kurazumi, H", | |
| "preferred": "H Kurazumi" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Nishimoto, A", | |
| "preferred": "A Nishimoto" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Ueno, K", | |
| "preferred": "K Ueno" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Shirasawa, B", | |
| "preferred": "B Shirasawa" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Hamano, K", | |
| "preferred": "K Hamano" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2016", | |
| "doi": "10.20944/preprints201608.0124.v1", | |
| "id": "bib44", | |
| "source": "preprints", | |
| "type": "preprint", | |
| "uri": "https://doi.org/10.20944/preprints201608.0124.v1" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": "The <i>Shigella</i> Genome Sequencing Consortium", | |
| "type": "group" | |
| } | |
| ], | |
| "dataId": "PRJEB2846", | |
| "date": "2015", | |
| "discriminator": "a", | |
| "id": "bib45", | |
| "source": "NCBI BioProject", | |
| "title": "Global Diversity of Shigella Species", | |
| "type": "data" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": "The <i>Shigella</i> Genome Sequencing Consortium", | |
| "type": "group" | |
| } | |
| ], | |
| "dataId": "PRJEB2460", | |
| "date": "2015", | |
| "discriminator": "b", | |
| "id": "bib46", | |
| "source": "NCBI BioProject", | |
| "title": "Shigella sonnei and flexneri from around the world", | |
| "type": "data" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": "The <i>Shigella</i> Genome Sequencing Consortium", | |
| "type": "group" | |
| } | |
| ], | |
| "dataId": "PRJEB2542", | |
| "date": "2015", | |
| "discriminator": "c", | |
| "id": "bib47", | |
| "source": "NCBI BioProject ", | |
| "title": "Shigella flexneri from around the world", | |
| "type": "data" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Turlings, TCJ", | |
| "preferred": "TCJ Turlings" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "W\u00e4ckers, FL", | |
| "preferred": "FL W\u00e4ckers" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "bookTitle": "Advances in insect chemical ecology", | |
| "chapterTitle": "Recruitment of predators and parasitoids by herbivore-injured\n plants", | |
| "date": "2004", | |
| "discriminator": "a", | |
| "editors": [ | |
| { | |
| "name": { | |
| "index": "Card\u00e9, RT", | |
| "preferred": "RT Card\u00e9" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Millar, JG", | |
| "preferred": "JG Millar" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "id": "bib48", | |
| "pages": { | |
| "first": "21", | |
| "last": "75", | |
| "range": "21\u201375" | |
| }, | |
| "publisher": { | |
| "address": { | |
| "components": { | |
| "locality": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "formatted": [ | |
| "Cambridge" | |
| ] | |
| }, | |
| "name": [ | |
| "Cambridge University Press" | |
| ] | |
| }, | |
| "type": "book-chapter" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Turlings, TCJ", | |
| "preferred": "TCJ Turlings" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "W\u00e4ckers, FL", | |
| "preferred": "FL W\u00e4ckers" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "bookTitle": "Advances in insect chemical ecology", | |
| "date": "2004", | |
| "discriminator": "b", | |
| "editors": [ | |
| { | |
| "name": { | |
| "index": "Card\u00e9, RT", | |
| "preferred": "RT Card\u00e9" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Millar, JG", | |
| "preferred": "JG Millar" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "id": "bib49", | |
| "publisher": { | |
| "name": [ | |
| "Cambridge University Press" | |
| ] | |
| }, | |
| "type": "book" | |
| }, | |
| { | |
| "accessed": "1995-09-10", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Walker, J", | |
| "preferred": "J Walker" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "1994", | |
| "id": "bib50", | |
| "title": "Solar System Live", | |
| "type": "web", | |
| "uri": "https://www.fourmilab.ch/solar/" | |
| }, | |
| { | |
| "articleTitle": "Crystal structure of the FeS cluster-containing nucleotide\n excision repair helicase XPD", | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Wolski, SC", | |
| "preferred": "SC Wolski" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Kuper, J", | |
| "preferred": "J Kuper" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Hanzelmann, P", | |
| "preferred": "P Hanzelmann" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Truglio, JJ", | |
| "preferred": "JJ Truglio" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Croteau, DL", | |
| "preferred": "DL Croteau" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Van Houten, B", | |
| "preferred": "B Van Houten" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "date": "2008", | |
| "doi": "10.1371/journal.pbio.0060149", | |
| "id": "bib51", | |
| "journal": "PLoS Biol", | |
| "pages": "e149", | |
| "pmid": 18578568, | |
| "type": "journal", | |
| "volume": "6" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": "World Health Organization", | |
| "type": "group" | |
| } | |
| ], | |
| "bookTitle": " Growing up unequal: gender and socioeconomic differences in young\n people's health and well-being. Health Behaviour in School-aged Children\n (HBSC) study", | |
| "date": "2016", | |
| "edition": "2", | |
| "id": "bib52", | |
| "publisher": { | |
| "name": [ | |
| "World Health Organization" | |
| ] | |
| }, | |
| "type": "book" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Zhang, YA", | |
| "preferred": "YA Zhang" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Salinas, I", | |
| "preferred": "I Salinas" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Li, J", | |
| "preferred": "J Li" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Parra, D", | |
| "preferred": "D Parra" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Bjork, S", | |
| "preferred": "S Bjork" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Xu, Z", | |
| "preferred": "Z Xu" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "LaPatra, SE", | |
| "preferred": "SE LaPatra" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Bartholomew, J", | |
| "preferred": "J Bartholomew" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Sunyer, JO", | |
| "preferred": "JO Sunyer" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "dataId": "GenBank: ADB81776.1", | |
| "date": "2010", | |
| "id": "bib53", | |
| "source": "NCBI", | |
| "title": "Polymeric immunoglobulin receptor [Oncorhynchus mykiss]", | |
| "type": "data" | |
| }, | |
| { | |
| "authors": [ | |
| { | |
| "name": { | |
| "index": "Zhong, M", | |
| "preferred": "M Zhong" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Snyder, M", | |
| "preferred": "M Snyder" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Slightam, C", | |
| "preferred": "C Slightam" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Kim, S", | |
| "preferred": "S Kim" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Murray, J", | |
| "preferred": "J Murray" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Waterston, R", | |
| "preferred": "R Waterston" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Gerstein, M", | |
| "preferred": "M Gerstein" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Niu, W", | |
| "preferred": "W Niu" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Janette, J", | |
| "preferred": "J Janette" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Raha, D", | |
| "preferred": "D Raha" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Agarwal, A", | |
| "preferred": "A Agarwal" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Reinke, V", | |
| "preferred": "V Reinke" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Sarov, M", | |
| "preferred": "M Sarov" | |
| }, | |
| "type": "person" | |
| }, | |
| { | |
| "name": { | |
| "index": "Hyman, A", | |
| "preferred": "A Hyman" | |
| }, | |
| "type": "person" | |
| } | |
| ], | |
| "dataId": "modENCODE_3369", | |
| "date": "2013", | |
| "id": "bib54", | |
| "source": "modMine", | |
| "title": "ChIP-Seq Identification of C. elegans TF Binding Sites", | |
| "type": "data", | |
| "uri": "http://intermine.modencode.org/release-33/report.do?id=77000379" | |
| } | |
| ], | |
| "appendices": [ | |
| { | |
| "content": [ | |
| { | |
| "content": [ | |
| { | |
| "text": "In order to prepare for this Kitchen sink we reviewed our archive and found common errors or miscommunication from the archive, tagging of <a href=\"#app1fig1\">Appendix 1\u2014Figure 1</a> is a classic example and here the tagging is updated. Appendices figures can also have figure supplements, for example <a href=\"#app1fig1s1\">Appendix 1\u2014Figure 1\u2014Figure Supplement 1</a> (<a href=\"#bib25\">Koch, 1959</a>).", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "If there is a caption to accompany the title it would display here (<a href=\"#bib25\">Koch, 1959</a>).", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.024", | |
| "id": "app1fig1", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-app1-fig1.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-app1-fig1.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-app1-fig1.jpg" | |
| } | |
| }, | |
| "label": "Appendix 1\u2014Figure 1", | |
| "title": "Appendix figure title.\n ", | |
| "type": "image" | |
| }, | |
| { | |
| "caption": [ | |
| { | |
| "text": "If there is a caption to accompany the title it would display here.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.025", | |
| "id": "app1fig1s1", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-app1-fig1-figsupp1.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-app1-fig1-figsupp1.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-app1-fig1-figsupp1.jpg" | |
| } | |
| }, | |
| "label": "Appendix 1\u2014Figure 1\u2014Figure Supplement 1", | |
| "title": "Appendix figure supplement title.", | |
| "type": "image" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This is the text of the content of subheading 1 within appendix 2. In some cases, authors will use 1.1, 1.2, 1.2.1, 1.2.2, 1.3 etc as prefixes to their headings. We retain this in the appendix sections only and allow them to cite these as Appendix 1.1, Appendix 1.2 etc in the main text. This is entirely optional on the part of the authors and articles may or may not include this style of heading/citation. This style of heading/citation is not allowed for main text headings.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "s8-1", | |
| "title": "1.1 Sub heading", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This is the text of the content of subheading 2 within appendix 2.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "This is the caption: A table containing interesting formating that is large enough to require landscape orientation in the PDF.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.039", | |
| "footnotes": [ | |
| { | |
| "text": [ | |
| { | |
| "text": "Footnotes not linked to content within the table text are usually to define abbreviations. For example:", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "WT, wild type.", | |
| "type": "paragraph" | |
| } | |
| ] | |
| } | |
| ], | |
| "id": "app1table1", | |
| "label": "Apendix 1\u2014Table 1", | |
| "tables": [ | |
| "<table>\n<thead>\n\n<tr>\n\n<th colspan=\"3\" rowspan=\"2\">\u2009</th>\n<th align=\"center\" colspan=\"8\">GLVs (percent IS plant<sup>-1</sup>)</th>\n<th align=\"center\" colspan=\"17\">TPS10 products (percent IS plant<sup>-1</sup>)</th>\n<th align=\"center\" colspan=\"10\">Non-target volatiles (percent IS plant<sup>-1</sup>)</th>\n</tr>\n<tr>\n<th align=\"center\" colspan=\"8\">(<i>Z</i>)-Hexen-3-ol</th>\n<th align=\"center\" colspan=\"10\">TAB</th><th align=\"center\" colspan=\"7\">TBF</th>\n<th align=\"center\" colspan=\"6\">\u03b1-Duprezianene</th>\n<th align=\"center\" colspan=\"4\">Germacrene A</th>\n</tr>\n</thead>\n<tbody>\n\n<tr>\n<td><b>Genotype</b></td>\n<td><b>Day n</b></td>\n<td><b>Night n</b></td>\n<td colspan=\"3\"><b>Day</b></td>\n<td colspan=\"5\"><b>Night</b></td>\n<td colspan=\"4\"><b>Day</b></td>\n<td colspan=\"6\"><b>Night</b></td>\n<td colspan=\"4\"><b>Day</b></td>\n<td colspan=\"3\"><b>Night</b></td>\n<td colspan=\"3\"><b>Day</b></td>\n<td colspan=\"3\"><b>Night</b></td>\n<td colspan=\"3\"><b>Day</b></td>\n<td><b>Night</b></td>\n</tr>\n<tr>\n<td><b>WT</b></td>\n<td>8</td><td>8</td>\n<td>0.99%</td>\n<td>\u00b1</td>\n<td>0.99%</td>\n<td>7.96%</td>\n<td>\u00b1</td>\n<td>4.25%</td>\n\n<td rowspan=\"2\" valign=\"middle\"><span class=\"author-callout-style-a1\">}</span></td>\n<td rowspan=\"2\" valign=\"middle\"><b><span class=\"author-callout-style-a1\">a</span></b><sub><b><span class=\"author-callout-style-a1\">lox</span></b></sub></td>\n<td>0.37%</td>\n<td>\u00b1</td>\n<td>0.29%</td>\n<td><b><span class=\"author-callout-style-a1\">a</span></b></td>\n<td colspan=\"3\">\u2014</td>\n<td>\u2009</td>\n<td rowspan=\"3\" valign=\"middle\"><span class=\"author-callout-style-a1\">}</span></td>\n<td rowspan=\"2\" valign=\"bottom\"><b><span class=\"author-callout-style-a1\">a</span></b><sub><b><span class=\"author-callout-style-a1\">TPS</span></b></sub></td>\n<td colspan=\"3\">\u2014</td>\n<td><b><span class=\"author-callout-style-a1\">a</span></b></td>\n<td colspan=\"3\">\u2014</td>\n\n<td><span class=\"author-callout-style-a2\">2.13%</span></td>\n<td><span class=\"author-callout-style-a2\">\u00b1</span></td>\n<td><span class=\"author-callout-style-a2\">0.85%</span></td>\n<td><span class=\"author-callout-style-a2\">0.96%</span></td>\n<td><span class=\"author-callout-style-a2\">\u00b1</span></td>\n<td><span class=\"author-callout-style-a2\">0.42%</span></td>\n<td><span class=\"author-callout-style-a2\">1.68%</span></td>\n<td><span class=\"author-callout-style-a2\">\u00b1</span></td>\n<td><span class=\"author-callout-style-a2\">0.98%</span></td>\n<td>\u2014</td>\n</tr>\n<tr>\n<td><b><i>TPS10</i></b></td>\n<td>7</td>\n<td>7</td>\n<td>2.37%</td>\n<td>\u00b1</td>\n<td>1.55%</td>\n<td>2.84%</td>\n<td>\u00b1</td>\n<td>0.63%</td>\n<td>18.97%</td>\n<td>\u00b1</td>\n<td>6.03%</td>\n\n<td><b><span class=\"author-callout-style-a3\">b</span></b></td>\n<td>0.94%</td>\n<td>\u00b1</td>\n<td>0.53%</td>\n<td rowspan=\"3\" valign=\"middle\"><span class=\"author-callout-style-a3\">}</span></td>\n<td>9.34%</td>\n<td>\u00b1</td>\n<td>3.44%</td>\n<td><b><span class=\"author-callout-style-a3\">b</span></b></td>\n<td>0.20%</td>\n<td>\u00b1</td>\n<td>0.20%</td>\n<td>9.47%</td>\n<td>\u00b1</td>\n<td>5.26%</td>\n<td>0.94%</td>\n<td>\u00b1</td>\n<td>0.26%</td>\n<td>2.78%</td>\n<td>\u00b1</td>\n<td>1.52%</td>\n<td>\u2014</td>\n</tr>\n<tr>\n<td><b><i>lox2/3</i></b></td>\n<td>7</td>\n<td>8</td>\n<td>0.13%</td>\n<td>\u00b1</td>\n<td>0.13%</td>\n<td>1.06%</td>\n<td>\u00b1</td>\n<td>0.64%</td>\n<td rowspan=\"2\" valign=\"middle\"><span class=\"author-callout-style-a3\">}</span></td>\n<td rowspan=\"2\" valign=\"middle\"><b><span class=\"author-callout-style-a3\">b</span></b><sub><b><span class=\"author-callout-style-a3\">lox</span></b></sub></td>\n<td colspan=\"3\">\u2014</td>\n<td><b><span class=\"author-callout-style-a1\">a</span></b></td>\n<td>0.15%</td>\n<td>\u00b1</td>\n<td>0.15%</td>\n<td rowspan=\"2\"><b><span class=\"author-callout-style-a3\">b</span></b><sub><b><span class=\"author-callout-style-a3\">TPS</span></b></sub></td>\n<td colspan=\"3\">\u2014</td>\n<td><b><span class=\"author-callout-style-a1\">a</span></b></td>\n<td colspan=\"3\">\u2014</td>\n<td>2.75%</td>\n<td>\u00b1</td>\n<td>1.12%</td>\n<td>0.60%</td>\n<td>\u00b1</td>\n<td>0.19%</td>\n<td>1.68%</td>\n<td>\u00b1</td>\n<td>1.49%</td>\n<td>\u2014</td>\n</tr>\n<tr>\n<td><b><i>lox2/3</i>x<i>TPS10</i></b></td>\n<td>7</td>\n<td>7</td>\n<td>0.07%</td>\n<td>\u00b1</td>\n<td>0.07%</td>\n<td>1.24%</td>\n<td>\u00b1</td>\n<td>0.84%</td>\n<td>7.39%</td>\n<td>\u00b1</td>\n<td>2.56%</td>\n<td><b><span class=\"author-callout-style-a3\">b</span></b></td>\n<td>2.08%</td>\n<td>\u00b1</td>\n<td>0.84%</td>\n<td>\u2009</td>\n<td>4.47%</td>\n<td>\u00b1</td>\n<td>1.70%</td>\n<td><b><span class=\"author-callout-style-a3\">b</span></b></td>\n<td>0.40%</td>\n<td>\u00b1</td>\n<td>0.40%</td>\n<td>3.02%</td>\n<td>\u00b1</td>\n<td>1.42%</td>\n<td>0.73%</td>\n<td>\u00b1</td>\n<td>0.31%</td>\n<td>0.66%</td>\n<td>\u00b1</td>\n<td>0.37%</td>\n<td>\u2014</td>\n</tr>\n</tbody>\n</table>" | |
| ], | |
| "title": "This is the title.", | |
| "type": "table" | |
| } | |
| ], | |
| "type": "figure" | |
| } | |
| ], | |
| "id": "s8-2", | |
| "title": "1.2 Sub heading", | |
| "type": "section" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.023", | |
| "id": "s8", | |
| "title": "Preparation", | |
| "type": "section" | |
| } | |
| ], | |
| "id": "appendix-1", | |
| "title": "Appendix 1" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This is an example of an appendix with an introductory paragraph of text preceding any section headers. There should be only one boxed-text element, which is a child of appendix. This boxed-text is the container of the sub-doi for the appendix. Aside from the appendix title, all content should be captured within the boxed-text.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "If there is a caption to accompany the title it would display here.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.027", | |
| "id": "app2fig1", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-app2-fig1.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-app2-fig1.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-app2-fig1.jpg" | |
| } | |
| }, | |
| "label": "Appendix 2\u2014Figure 1", | |
| "title": "Figure added to demonstrate that not only paragaphs but other forms of content may be included as a child of the boxed-text.", | |
| "type": "image" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "Generating the new rules involved negotation with varous vendors and downsteam hosts to ensure display would work for all instances. See <a href=\"#app2video1\">Appendix 2\u2014Video 1</a> and <a href=\"#app2table1\">Apendix 2\u2014Table 1</a>.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "doi": "10.7554/eLife.00666.028", | |
| "id": "app2video1", | |
| "label": "Appendix 2\u2014Video 1", | |
| "title": "\n A descirption of the eLife editorial process.\n ", | |
| "type": "video", | |
| "height": 720, | |
| "width": 1280, | |
| "image": "https://cdn.elifesciences.org/articles/00666/elife-00666-app2-video1.jpg", | |
| "sources": [ | |
| { | |
| "mediaType": "video/mp4; codecs=\"avc1.42E01E, mp4a.40.2\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/mp4/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-app2-video1.mp4" | |
| }, | |
| { | |
| "mediaType": "video/webm; codecs=\"vp8.0, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/webm/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-app2-video1.webm" | |
| }, | |
| { | |
| "mediaType": "video/ogg; codecs=\"theora, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/ogv/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-app2-video1.ogv" | |
| } | |
| ], | |
| "placeholder": { | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-app2-video1.jpg", | |
| "alt": "", | |
| "size": { | |
| "width": 1280, | |
| "height": 720 | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-app2-video1.jpg/full/full/0/default.jpg", | |
| "filename": "elife-00666-app2-video1.jpg" | |
| } | |
| } | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "Appendix table.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.029", | |
| "id": "app2table1", | |
| "label": "Apendix 2\u2014Table 1", | |
| "tables": [ | |
| "<table>\n<thead>\n<tr>\n<th>Name</th>\n<th>Units</th>\n<th>Value</th>\n</tr>\n</thead>\n<tbody>\n<tr>\n<td><i>E</i><sub>AMPA</sub></td>\n<td>mV</td>\n<td>0</td>\n</tr>\n<tr>\n<td><i>\u03c4</i><sub>AMPA</sub></td>\n<td>ms</td>\n<td>1</td>\n</tr>\n<tr>\n<td><i>E</i><sub>NMDA</sub></td>\n<td>mV</td>\n<td>0</td>\n</tr>\n<tr>\n<td><i>\u03c4</i><sub>NMDA</sub></td>\n<td>ms</td>\n<td>100</td>\n</tr>\n</tbody>\n</table>" | |
| ], | |
| "type": "table" | |
| } | |
| ], | |
| "type": "figure" | |
| } | |
| ], | |
| "id": "s9", | |
| "title": "Negotaition", | |
| "type": "section" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.026", | |
| "id": "appendix-2", | |
| "title": "Appendix 2" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "This is an example of an appendix with no sections.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.030", | |
| "id": "appendix-3", | |
| "title": "Appendix 3" | |
| } | |
| ], | |
| "acknowledgements": [ | |
| { | |
| "content": [ | |
| { | |
| "text": "We thank JATS4R, ExeterPremedia and PMC for their contributions.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "ack-1", | |
| "title": "Main thanks", | |
| "type": "section" | |
| }, | |
| { | |
| "content": [ | |
| { | |
| "text": "We need to allow authors to have sections in their acknowledgements.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "id": "ack-2", | |
| "title": "Sub-thanks", | |
| "type": "section" | |
| } | |
| ], | |
| "decisionLetter": { | |
| "content": [ | |
| { | |
| "text": "Thank you for submitting your article \"The eLife research article\" for consideration by <i>eLife</i>. Your article has been reviewed by three peer reviewers, one of whom, Joe Bloggs, is a member of our editorial board and also oversaw the process as Senior editor. John Doe (peer reviewer) has agreed to reveal his identity.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "You need to make sure the XML structure you creates works on the display of the PMC platform and also that there is enough information contained within the tagging to generate a typeset PDF from the XML with no additional information provided.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "description": [ | |
| { | |
| "text": "In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.029", | |
| "id": "SA1" | |
| }, | |
| "authorResponse": { | |
| "content": [ | |
| { | |
| "content": [ | |
| { | |
| "text": "The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "You need to make sure the XML structure you creates works on the display of the PMC platform and also that there is enough information contained within the tagging to generate a typeset PDF from the XML with no additional information provided.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "type": "excerpt" | |
| }, | |
| { | |
| "text": "In response to this comment, we validated the XML against the DTD (JATS 1) each time we made an update. We also regularly used the PMC validator to check our decisions against display on the PMC site, see <a href=\"#respfig1\">Author response image 1.</a>, <a href=\"#respvideo1\">Author response video 1</a> and <a href=\"#resptable1\">Author response table 1</a>.", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "Single figure: The header of an eLife article example on the HTML page.", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.031", | |
| "id": "respfig1", | |
| "image": { | |
| "alt": "", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-resp-fig1.tif", | |
| "size": { | |
| "width": null, | |
| "height": null | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-resp-fig1.tif/full/full/0/default.jpg", | |
| "filename": "elife-00666-resp-fig1.jpg" | |
| } | |
| }, | |
| "label": "Author response image 1", | |
| "type": "image" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "Author response table", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.032", | |
| "id": "resptable1", | |
| "label": "Author response Table 1", | |
| "tables": [ | |
| "<table>\n<thead>\n<tr>\n<th>Sample</th>\n<th>Same</th>\n<th>Difference more than 10%</th>\n</tr>\n</thead>\n<tbody>\n<tr>\n<td>DKO1.cell.1</td>\n<td>77.00%</td>\n<td>6.90%</td>\n</tr>\n<tr>\n<td>DKO1.cell.2</td>\n<td>78.80%</td>\n<td>7.20%</td>\n</tr>\n<tr>\n<td>DKO1.cell.3</td>\n<td>79.10%</td>\n<td>6.70%</td>\n</tr>\n<tr>\n<td>DKO1.exo.1</td>\n<td>78.90%</td>\n<td>6.50%</td>\n</tr>\n<tr>\n<td>DKO1.exo.2</td>\n<td>80.00%</td>\n<td>5.80%</td>\n</tr>\n<tr>\n<td>DKO1.exo.3</td>\n<td>86.80%</td>\n<td>2.30%</td>\n</tr>\n<tr>\n<td>DKS8.cell.1</td>\n<td>77.30%</td>\n<td>7.80%</td>\n</tr>\n<tr>\n<td>DKS8.cell.2</td>\n<td>79.70%</td>\n<td>6.70%</td>\n</tr>\n</tbody>\n</table>" | |
| ], | |
| "type": "table" | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "assets": [ | |
| { | |
| "caption": [ | |
| { | |
| "text": "Caption and/or a title is required for all author response assets", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.033", | |
| "id": "respvideo1", | |
| "label": "Author response video 1", | |
| "type": "video", | |
| "height": 720, | |
| "width": 1280, | |
| "image": "https://cdn.elifesciences.org/articles/00666/elife-00666-resp-video1.jpg", | |
| "sources": [ | |
| { | |
| "mediaType": "video/mp4; codecs=\"avc1.42E01E, mp4a.40.2\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/mp4/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-resp-video1.mp4" | |
| }, | |
| { | |
| "mediaType": "video/webm; codecs=\"vp8.0, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/webm/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-resp-video1.webm" | |
| }, | |
| { | |
| "mediaType": "video/ogg; codecs=\"theora, vorbis\"", | |
| "uri": "https://static-movie-usa.glencoesoftware.com/ogv/10.7554/657/f42a609b0e61fc41798dcba3cc0c87598bd2cf9f/elife-00666-resp-video1.ogv" | |
| } | |
| ], | |
| "placeholder": { | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-resp-video1.jpg", | |
| "alt": "", | |
| "size": { | |
| "width": 1280, | |
| "height": 720 | |
| }, | |
| "source": { | |
| "mediaType": "image/jpeg", | |
| "uri": "https://iiif.elifesciences.org/lax/00666%2Felife-00666-resp-video1.jpg/full/full/0/default.jpg", | |
| "filename": "elife-00666-resp-video1.jpg" | |
| } | |
| } | |
| } | |
| ], | |
| "type": "figure" | |
| }, | |
| { | |
| "text": "However, some decisions required some communication with PMC to discuss whether any of our updates could be accomodated by them - during this review we aimed to reduce the complexity of the XML structure and remove all formatting and bioler plate text required for a PDF display format. We also produced buisness rules {Insert table} in order to produce rules for the production systems and the website to follow. These buisness rules also informed the basis for a set of Schematron rules for our references.{Insert table}", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "If an author referes to a reference in the response letter it is cross linked to the reference in the reference list (<a href=\"#bib11\">Coyne and Orr, 1989</a>), however, if it is a new reference only cited in the decision letter or author response it is not added to the main reference link and is just listed as free text, for example, Butcher et al, 2006. If the author provides the reference it can be added as free text to the end of the letter, however, this is not a requirement .", | |
| "type": "paragraph" | |
| }, | |
| { | |
| "text": "Adding some MathML to the sub-article.<math> <mrow> <munder> <mo/> <mi>m</mi> </munder> <mrow> <msub> <mover accent=\"true\"> <mi>p</mi> <mo/> </mover> <mi>m</mi> </msub> <mo>=</mo> <mn>0</mn> </mrow> </mrow> </math>", | |
| "type": "paragraph" | |
| } | |
| ], | |
| "doi": "10.7554/eLife.00666.031", | |
| "id": "SA2" | |
| }, | |
| "stage": "published", | |
| "statusDate": "2099-01-01T00:00:00Z" | |
| } | |
| } |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment