Solution for https://courses.edx.org/courses/course-v1:ColumbiaX+DS102X+1T2016 - You are given the following five 14-long reads below. Map them to the sequence of the gene responsible for the ABO blood type , keeping in mind that each read might include a single nucleotide error. Report their respective starting positions along the gene (answers…

FindReadPositionInGenome.scala

// not optimized, just a quick way to code it up...

// data from: http://www.ncbi.nlm.nih.gov/nuccore/LC068776.1

val s1 = "ccggcctcgggaag"

val s2 = "ttgcggacgctagc"

val s3 = "tcgggctccccccg"

val s4 = "ggggggaaggcgga"

val s5 = "tctgtccccccccg"

val g =  "ggccgcctcccgcgcccctctgtcccctcccgtgttcggcctcgggaagtcggggcggcgggcggcgcgggccgggaggggtcgcctcgggctcaccccgccccagggccgccgggcggaaggcggaggccgagaccagacgcggagccatggccgaggtgttgcggacgctggccg"

// compares 2 strings and finds how many chars are different:
def similarity(source: String, dest: String): Int =
  source.zip(dest).foldLeft(0){ case (sum, (x,y)) => if(x == y) sum else sum + 1 }

// returns a closest match (Int, Int) with position (0 based) and how many chars were different:
def pos(read: String, gene: String): (Int, Int) = {
  gene.sliding(read.size, 1).zipWithIndex.map{ case (snip, pos) => pos -> similarity(snip, read) }.minBy(_._2)
}

// find position:
scala> pos(s1, g)
res25: (Int, Int) = (35,1)

// verify:
scala> g.substring(35, 35 + s1.size)
res32: String = tcggcctcgggaag

scala> s1
res33: String = ccggcctcgggaag

i am not sure about Scala?
could you please let me know the answers?

#in python :

s1 = "ccggcctcgggaag"
s2 = "ttgcggacgctagc"
s3 = "tcgggctccccccg"
s4 = "ggggggaaggcgga"
s5 = "tctgtccccccccg"
g = "ggccgcctcccgcgcccctctgtcccctcccgtgttcggcctcgggaagtcggggcggcgggcggcgcgggccgggaggggtcgcctcgggctcaccccgccccagggccgccgggcggaaggcggaggccgagaccagacgcggagccatggccgaggtgttgcggacgctggccg"

#turn G in diccionary
while(i+14<=len(g)):
dicc[i]=g[i:i+14]
i+=1

def lcs(X, Y, m, n):
if m == 0 or n == 0:
return 0
elif X[m-1] == Y[n-1]:
return 1 + lcs(X, Y, m-1, n-1)
else:
return max(lcs(X, Y, m, n-1), lcs(X, Y, m-1, n))

def search_pos(str1,dicci):
for i in range(163):
if (lcs(str1,dicci[i],len(str1),len(dicci[i])) == 13):
return (i+1)

print(search_post(s1,dicci))

I am not able to run the python code it give multiple errors
Can you help, please?