Skip to content

Instantly share code, notes, and snippets.

View jni's full-sized avatar

Juan Nunez-Iglesias jni

391 followers · 9 following
View GitHub Profile
@jni
jni / error
Created January 10, 2015 01:28
sudo py.test fails on Travis
travis@debug-hs-11922-jni-python-1420819368:~/jni/cellom2tif$ py.test
============================= test session starts ==============================
platform linux2 -- Python 2.7.3 -- py-1.4.26 -- pytest-2.6.4
plugins: cov
collected 10 items
verify.py .
cellom2tif/cellom2tif.py ..
tests/test_cellom2tif.py .
tests/test_package.py ..
@jni
jni / output.txt
Created March 16, 2015 22:40
Python generators and piping demo
times2 start
range start
yielding 0
multiplying 0 by 2
yielding 1
multiplying 1 by 2
yielding 2
multiplying 2 by 2
yielding 3
multiplying 3 by 2
@jni
jni / gist:2d407549a3497605281d
Created April 15, 2015 10:53
keybase.md
### Keybase proof
I hereby claim:
* I am jni on github.
* I am jni (https://keybase.io/jni) on keybase.
* I have a public key whose fingerprint is 9917 C047 FE5D 7675 689F 03C1 E6C7 550F 653B E587
To claim this, I am signing this object:
@jni
jni / mb1_dm6.fa
Created September 28, 2015 08:20
First ~1MB of the D. melanogaster genome v6 FASTA file
This file has been truncated, but you can view the full file.
>chr2L
Cgacaatgcacgacagaggaagcagaacagatatttagattgcctctcat
tttctctcccatattatagggagaaatatgatcgcgtatgcgagagtagt
gccaacatattgtgctctttgattttttggcaacccaaaatggtggcgga
tgaaCGAGATGATAATATATTCAAGTTGCCGCTAATCAGAAATAAATTCA
TTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTG
CCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTATATTACCG
CAAACCCAAAAAgacaatacacgacagagagagagagcagcggagatatt
tagattgcctattaaatatgatcgcgtatgcgagagtagtgccaacatat
tgtgctctCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAA
@jni
jni / throughput.py
Last active September 28, 2015 08:55
Throughput of simple streaming of text data with Toolz/CyToolz
from IPython import get_ipython
import toolz as tz
from toolz import curried as c
fn = 'data/mb1_dm6.fa'
t = get_ipython().magic('timeit -o -q tz.pipe(fn, open, tz.last)')
print('Raw throughput (lines): %.2fMB/s' % (1 / t.best))
t = get_ipython().magic('timeit -o -q tz.pipe(fn, open, tz.concat, tz.last)')
print('Single character throughput: %.2fMB/s' % (1 / t.best))
def is_sequence(line):
return len(line) > 1 and not line.startswith('>')
@jni
jni / parking map.ipynb
Created February 23, 2016 22:14 — forked from manugarri/parking map.ipynb
Where the f*** can I park?
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
@jni
jni / programming-languages-in-ADS.ipynb
Last active July 6, 2018 04:35
Counting programming language mentions in astronomy papers
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
@jni
jni / karabiner.json
Last active November 13, 2017 02:26
Karabiner configuration file
{
"global": {
"check_for_updates_on_startup": true,
"show_in_menu_bar": true,
"show_profile_name_in_menu_bar": false
},
"profiles": [
{
"complex_modifications": {
"parameters": {
@jni
jni / tksyncplot.py
Created February 23, 2017 01:29
Tkinter asyncio matplotlib crash: long-running async tasks using matplotlib and launched by a tkinter GUI
import asyncio
import matplotlib
matplotlib.use('TkAgg')
import tkinter as tk
from tkinter import ttk
from skimage._shared._tempfile import temporary_file
import numpy as np
@asyncio.coroutine
@jni
jni / Chap 1 dub 2.ipynb
Created March 31, 2018 23:09 — forked from capissimo/Chap 1 dub 2
Chpater 1 from Elegant SciPy (rev 2)
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.