Kevin Bonham kescobo
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| input = open('rosalind_ini6.txt', 'r') | |
| input = input.read() | |
| words = [] | |
| list = {} | |
| for word in input.split(' '): | |
| words.append(word) | |
| for i in xrange(0, len(words)): |
kescobo
/ gist:ee69d7fd087c3e3192ca
Last active
August 29, 2015 14:12
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| import re | |
| #open file to read | |
| with open('test.fasta', 'r') as seqs: | |
| seqFile = (open('throwaway.txt', 'a+')) | |
| for line in seqs: | |
| if re.search('^>[a-zA-Z][a-zA-Z][a-zA-Z][a-zA-Z]', line): | |
| seqFile.close() |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| import annotated genomes | |
| for genome in genomes: | |
| write genome to genome_database | |
| database{ | |
| species_name: | |
| CDS{ | |
| annotation: | |
| aa sequence: | |
| nt sequence: |
kescobo
/ arthrobacter_genome.gb
Last active
January 11, 2016 18:24
Files and code for Biopython issue #747
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| LOCUS BW77_ACAGTG.R1_(paired)_contig_93 233 bp DNA linear UNK | |
| DEFINITION Contig BW77_ACAGTG.R1_(paired)_contig_93 from Arthrobacter sp. | |
| BW77 | |
| ACCESSION unknown | |
| FEATURES Location/Qualifiers | |
| source 1..233 | |
| /mol_type="genomic DNA" | |
| /db_xref="taxon: 6666666" | |
| /genome_md5="" | |
| /project="bewolfe_6666666" |
kescobo
/ gbk_to_faa.py
Last active
January 14, 2016 21:14
Python definitions to take genbank file containing multiple genomes and dividing them into fasta protein files, one file per genome. For Stackoverflow question http://stackoverflow.com/posts/34777323/
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| from operator import itemgetter | |
| from itertools import groupby | |
| def gbk_to_faa(some_genbank): | |
| source = None | |
| for record in SeqIO.parse(some_genbank, 'gb'): | |
| if source: | |
| if record.annotations['source'] != source: | |
| out_file.close() | |
| source = sub(r'\W+', "_", sub(r'\W$', "", record.annotations['source'])) |
kescobo
/ class_projects.py
Last active
March 28, 2018 14:47
— forked from Junuxx/class_projects.py
Solution for a StackOverflow scheduling problem
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ''' | |
| Created on 26 jan. 2016 | |
| @author: Jeroen Kools | |
| Based on the following StackOverflow question: | |
| https://stackoverflow.com/questions/35002027/maximizing-a-combination-of-a-series-of-values#comment57732451_35002027 | |
| - 19 students | |
| - 12 dates |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| function jaccarddistance(sketch1::MinHashSketch, sketch2::MinHashSketch) | |
| d = length(setdiff(sketch1.sketch, sketch2.sketch)) | |
| l = length(sketch1) | |
| return (l-d) / (l+d) | |
| end | |
| function newjd(sketch1::MinHashSketch, sketch2::MinHashSketch) | |
| matches = 0 | |
| sketchlen = length(sketch1) | |
| i = 1 |
kescobo
/ newminhash.jl
Created
March 18, 2017 16:14
Benchmarks for new implementation of kmerminhash
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| b1 = open(FASTAReader, | |
| "/Users/ksb/computation/science/genomes/kv_input/fasta/Brachybacterium_alimentarium_738_10.fna") | |
| seq1 = dna"" | |
| for s in b1 | |
| seq1 = seq1 * s.seq | |
| end | |
| length(seq1) # 4160958 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| _ | |
| _ _ _(_)_ | A fresh approach to technical computing | |
| (_) | (_) (_) | Documentation: https://docs.julialang.org | |
| _ _ _| |_ __ _ | Type "?help" for help. | |
| | | | | | | |/ _` | | | |
| | | |_| | | | (_| | | Version 0.6.0-rc1.0 (2017-05-07 00:00 UTC) | |
| _/ |\__'_|_|_|\__'_| | | |
| |__/ | x86_64-apple-darwin16.5.0 | |
| julia> using Plots |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| @HD VN:1.0 SO:unsorted | |
| @SQ SN:tig00000001 LN:4311805 | |
| @SQ SN:tig00000002 LN:66004 | |
| @SQ SN:tig00000004 LN:1036550 | |
| @SQ SN:tig00000005 LN:256226 | |
| @SQ SN:tig00000007 LN:150530 | |
| @SQ SN:tig00000008 LN:138168 | |
| @PG ID:bowtie2 PN:bowtie2 VN:2.3.2 CL:"/usr/local/bin/../Cellar/bowtie2/2.3.2/bin/bowtie2-align-s --wrapper basic-0 -x jb418 -S jb418.sam -1 ../../raw_reads/r1.fastq -2 ../../raw_reads/r2.fastq" | |
| HWI-D00742:45:H7W5YBCXX:1:1101:1219:2200 73 tig00000001 3359004 42 100M = 3359004 0 CCTGNGTGACGAAGACCACCTGGGCGACATGGACTTCAAGGTAGCCGGTACCGCCAAAGGTGTTACCGCGCTGCAGATGGACATCAAGATCNAGGGCATC DDDD#<<EHHHIIHIIIIIIIIIHHIIIIIIIIIIIIIIIIIHEHIIIIIIIIIIIIIIIHHIIIHIIIIIIIIHIEHIHIIIIIIIIGGH#<<EHFHIH AS:i:-2 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:4G86A8 YT:Z:UP | |
| HWI-D00742:45:H7W5YBCXX:1:1101:1219:2200 133 tig00000001 3359004 0 * = 3359004 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN #################################################################################################### |
OlderNewer