This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| metaphlanToPhyloseq <- function( | |
| metaphlandir, | |
| metadat=NULL, | |
| simplify=TRUE){ | |
| ## tax is a matrix or data.frame with the table of taxonomic abundances, rows are taxa, columns are samples | |
| ## metadat is an optional data.frame of specimen metadata, rows are samples, columns are variables | |
| ## if simplify=TRUE, use only the most detailed level of taxa names in the final object | |
| ## metaphlanToPhyloseq("~/Downloads/metaphlan_bugs_list") | |
| .getMetaphlanTree <- function(removeGCF=TRUE, simplify=TRUE){ | |
| if (!requireNamespace("ape")) { |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >Illumina Single End Apapter 1 | |
| ACACTCTTTCCCTACACGACGCTGTTCCATCT | |
| >Illumina Single End Apapter 2 | |
| CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
| >Illumina Single End PCR Primer 1 | |
| AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT | |
| >Illumina Single End PCR Primer 2 | |
| CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
| >Illumina Single End Sequencing Primer | |
| ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| usage () | |
| { | |
| echo "" | |
| echo "Usage : `basename $0` <tableL6.txt> <L6_clean.tsv>" | |
| echo "" | |
| exit | |
| } | |
| if [ "$1" = "" ]; then |