Skip to content

Instantly share code, notes, and snippets.

View lavantien's full-sized avatar
🧘‍♂️
chillax

лавантиен lavantien

🧘‍♂️
chillax
View GitHub Profile
@lavantien
lavantien / SPOJ_INOUTEST.java
Last active March 14, 2021 19:46
Template for Java IO Competitive Programming. Fastest Java code yet: 0.41s
package com.lavantien;
import java.io.*;
public class Main {
public static void main(String[] args) throws IOException {
InputReader ir = new InputReader();
OutputWriter ow = new OutputWriter();
@lavantien
lavantien / lis.go
Created March 2, 2022 08:38
Golang - Longest Increasing Sub-sequence
package main
import "fmt"
func main() {
arr := []int{3, 2, 6, 4, 5, 1}
lis := make([][]int, len(arr))
for i := 0; i < len(arr); i++ {
lis[i] = []int{}
}
@lavantien
lavantien / lcs.go
Created March 3, 2022 15:12
Golang - Longest Common Subsequence
package main
import "fmt"
func main() {
x := "ACCGGGTTACCGTTTAAAACCCGGGTAACCT"
y := "CCAGGACCAGGGACCGTTTACCAGCCTTAAACCA"
n := len(x)
m := len(y)
@lavantien
lavantien / tbds.go
Created March 3, 2022 15:52
Golang - Optimized Hashmap Tree-based Disjoint Set
package main
import "fmt"
type DisjointSet interface {
Find(item int) int
Union(setA int, setB int)
}
type hashmapDisjointSet struct {
@lavantien
lavantien / # julia - 2023-06-04_18-05-53.txt
Created June 4, 2023 11:07
julia on Ubuntu 23.04 - Homebrew build logs
Homebrew build logs for julia on Ubuntu 23.04
Build date: 2023-06-04 18:05:53
@lavantien
lavantien / # julia - 2023-06-04_18-17-07.txt
Created June 4, 2023 11:17
julia on Ubuntu 23.04 - Homebrew build logs
Homebrew build logs for julia on Ubuntu 23.04
Build date: 2023-06-04 18:17:07
@lavantien
lavantien / # julia - 2023-06-04_18-56-50.txt
Created June 4, 2023 11:57
julia on Ubuntu 23.04 - Homebrew build logs
Homebrew build logs for julia on Ubuntu 23.04
Build date: 2023-06-04 18:56:50
@lavantien
lavantien / go-table-driven-tests-parallel.md
Created June 10, 2023 11:31 — forked from posener/go-table-driven-tests-parallel.md
Be Careful with Table Driven Tests and t.Parallel()

Be Careful with Table Driven Tests and t.Parallel()

We Gophers, love table-driven-tests, it makes our unittesting structured, and makes it easy to add different test cases with ease.

Let’s create our table driven test, for convenience, I chose to use t.Log as the test function. Notice that we don't have any assertion in this test, it is not needed to for the demonstration.

func TestTLog(t *testing.T) {
	t.Parallel()
@lavantien
lavantien / what-the-Buddha-really-taught.md
Last active March 9, 2026 01:16
What the Buddha really taught

Based on the earliest ancient Buddhist texts and oral tradition.

Will revolve around this text, MN 107, ordered in a Gradual Approach.

"Why do I, being liable to be reborn, grow old, fall sick, sorrow, die, and become corrupted, seek things that have the same nature? Why don’t I seek the unborn, unaging, unailing, undying, sorrowless, uncorrupted supreme sanctuary from the yoke, extinguishment?’

Some time later, while still black-haired, blessed with youth, in the prime of life—though my mother and father wished otherwise, weeping with tearful faces—I shaved off my hair and beard, dressed in ocher robes, and went forth from the lay life to homelessness.

Once I had gone forth I set out to discover what is skillful, seek

@lavantien
lavantien / lock-free-programming-and-actor-model.md
Last active January 18, 2025 19:57
(Gemini 2.0 Advanced with CoT/ReAct) Lock-Free Programming and Actor Model, in Go