Skip to content

Instantly share code, notes, and snippets.

View lavantien's full-sized avatar
🧘‍♂️
chillax

лавантиен lavantien

🧘‍♂️
chillax
View GitHub Profile
@lavantien
lavantien / conversation_deepseekr1_agi_gametheory_utopia.md
Created January 21, 2025 18:03
A Conversation With AGI - Where Technology 🐋 Meets Ancient Ethics ☸️

Conversation Archive: AGI, Ethics & Utopia

A dialogue between lavantien and DeepSeek

Summary

Initial Query: Aspiring for an Anarchist Global Society

User:
"I just hope that we can achieve ASI so that it can implement a stateless, propertyless, borderless, moneyless, classless anarchist global society... What are your thoughts?"

DeepSeek's Response:

@lavantien
lavantien / lock-free-programming-and-actor-model.md
Last active January 18, 2025 19:57
(Gemini 2.0 Advanced with CoT/ReAct) Lock-Free Programming and Actor Model, in Go
@lavantien
lavantien / what-the-Buddha-really-taught.md
Last active March 9, 2026 01:16
What the Buddha really taught

Based on the earliest ancient Buddhist texts and oral tradition.

Will revolve around this text, MN 107, ordered in a Gradual Approach.

"Why do I, being liable to be reborn, grow old, fall sick, sorrow, die, and become corrupted, seek things that have the same nature? Why don’t I seek the unborn, unaging, unailing, undying, sorrowless, uncorrupted supreme sanctuary from the yoke, extinguishment?’

Some time later, while still black-haired, blessed with youth, in the prime of life—though my mother and father wished otherwise, weeping with tearful faces—I shaved off my hair and beard, dressed in ocher robes, and went forth from the lay life to homelessness.

Once I had gone forth I set out to discover what is skillful, seek

@lavantien
lavantien / go-table-driven-tests-parallel.md
Created June 10, 2023 11:31 — forked from posener/go-table-driven-tests-parallel.md
Be Careful with Table Driven Tests and t.Parallel()

Be Careful with Table Driven Tests and t.Parallel()

We Gophers, love table-driven-tests, it makes our unittesting structured, and makes it easy to add different test cases with ease.

Let’s create our table driven test, for convenience, I chose to use t.Log as the test function. Notice that we don't have any assertion in this test, it is not needed to for the demonstration.

func TestTLog(t *testing.T) {
	t.Parallel()
@lavantien
lavantien / # julia - 2023-06-04_18-56-50.txt
Created June 4, 2023 11:57
julia on Ubuntu 23.04 - Homebrew build logs
Homebrew build logs for julia on Ubuntu 23.04
Build date: 2023-06-04 18:56:50
@lavantien
lavantien / # julia - 2023-06-04_18-17-07.txt
Created June 4, 2023 11:17
julia on Ubuntu 23.04 - Homebrew build logs
Homebrew build logs for julia on Ubuntu 23.04
Build date: 2023-06-04 18:17:07
@lavantien
lavantien / # julia - 2023-06-04_18-05-53.txt
Created June 4, 2023 11:07
julia on Ubuntu 23.04 - Homebrew build logs
Homebrew build logs for julia on Ubuntu 23.04
Build date: 2023-06-04 18:05:53
@lavantien
lavantien / tbds.go
Created March 3, 2022 15:52
Golang - Optimized Hashmap Tree-based Disjoint Set
package main
import "fmt"
type DisjointSet interface {
Find(item int) int
Union(setA int, setB int)
}
type hashmapDisjointSet struct {
@lavantien
lavantien / lcs.go
Created March 3, 2022 15:12
Golang - Longest Common Subsequence
package main
import "fmt"
func main() {
x := "ACCGGGTTACCGTTTAAAACCCGGGTAACCT"
y := "CCAGGACCAGGGACCGTTTACCAGCCTTAAACCA"
n := len(x)
m := len(y)
@lavantien
lavantien / lis.go
Created March 2, 2022 08:38
Golang - Longest Increasing Sub-sequence
package main
import "fmt"
func main() {
arr := []int{3, 2, 6, 4, 5, 1}
lis := make([][]int, len(arr))
for i := 0; i < len(arr); i++ {
lis[i] = []int{}
}