This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >segfault | |
| AACTGGAGCAGGTCCTGGTATTCTAACATTAATGTCTCCAGATGAACGCCCATAAACTTGGCTTTCACCTCAAACACTCC | |
| CACAGTCTCTGATGGCGAGATCTCGAAAATTGCATTCTTATACTGATTTGTCTGCAGATCATCGATGTCAATAAGCACTC | |
| CCTTCTCATGCAGACGGGCTGCTGTGTACTTCTGTGATACCTGCTTGCTCTTCTTTGCCTGTTTATCTCCAGGTTTCTTA | |
| GAAACTTTTCCCTTGCTCCCTAAATTGTCCATGCAGGTCTTGATGTACTGATTGTAGTAGTCAATCTGCTCGTTGTAGAA | |
| GGTTGCGGATGTCCTTGGCGATGTCATTGATTAGGTCCTGGTATTTCTTCTCAGGGTGTACTTTGCCCAACTCTCCCAGT | |
| CTTTGCAGGTTGCTCTTGATCTTGTCCTTCTTGCCTTGCAAAGTAAGACTGTCATCTACAACTGGTTTGGCTTGCTTCAT | |
| CTTCTCTGGGGTCTTTGCATCGCGAATGGCTCGCCGCTGCATAGCTCGCTGGTACTCTGCTTCCTGCTCAGGTGAAGCTA | |
| CAGTCTCCAGAATCTCAGTAAGTGTGTCTCCTGGCTGAAATCTGATCACATCTACTATGAGCCTCTTGGTGTTAAGGAGA | |
| AGAGTTTTGGCATCCATTTCAGCATTGGCCTCATCGGGAACATCAAATTTGTTGGTGAGGGTGAGGGAGACTTCTGTCTT |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| diff --git i/cutadapt/scripts/cutadapt.py w/cutadapt/scripts/cutadapt.py | |
| index 855721d..2eaf435 100755 | |
| --- i/cutadapt/scripts/cutadapt.py | |
| +++ w/cutadapt/scripts/cutadapt.py | |
| @@ -155,6 +155,7 @@ class AdapterCutter(object): | |
| # TODO write only one line, even for multiple matches | |
| for match in matches: | |
| seq = match.read.sequence | |
| + qualities = match.read.qualities | |
| if match is None: |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/usr/bin/env python3 | |
| """ | |
| Running this script is (intended to be) equivalent to running the following Snakefile: | |
| include: "pipeline.conf" # Should be an empty file | |
| shell.prefix("set -euo pipefail;") | |
| rule all: | |
| input: |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| """ | |
| Plot multiple figures into a single PDF with matplotlib, using the | |
| object-oriented interface. | |
| """ | |
| from matplotlib.backends.backend_pdf import FigureCanvasPdf, PdfPages | |
| from matplotlib.figure import Figure | |
| import numpy as np | |
| with PdfPages('multi.pdf') as pages: | |
| for i in range(10): |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| from pysam import AlignmentFile | |
| from pyfaidx import Fasta | |
| def has_mismatch_in_interval(reference, bamfile, chrom, start, end): | |
| """ | |
| Return whether there is a mismatch in the interval (start, end) in any read mapping to the given chromosome. | |
| reference -- a pyfaidx.Fasta object or something that behaves similarly | |
| """ | |
| for column in bamfile.pileup(chrom, start, end): |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| set -euo pipefail | |
| if [ $# -ne 1 -o x$1 == x-h -o x$1 == x--help ]; then | |
| echo \ | |
| "Usage: | |
| samtools sort -O bam -T prefix ... | bambai BAMPATH | |
| Read a sorted BAM file from standard input, write it to BAMPATH and | |
| index it at the same time (creating BAMPATH.bai)." |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/usr/bin/env python3 | |
| """ | |
| Mask low-quality bases in a FASTQ file with 'N'. | |
| Adjust cutoff_front and cutoff_back below to use | |
| different thresholds (currently: 20 at 5' end, | |
| 0 at 3' end). | |
| Usage: | |
| python3 qualmask.py input.fastq.gz > output.fastq |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| # A workaround for an issue with Nextflow (which may actually be a bash bug), | |
| # see <https://github.com/SciLifeLab/Sarek/issues/420> | |
| # | |
| # The problem is that Nextflow does not notice that a job has finished and | |
| # hangs indefinitely. | |
| # | |
| # This script looks for zombie processes that are children of a script named | |
| # .command.stub, and kills that script. This seems to let the pipeline continue |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/bin/bash | |
| # This script creates both | |
| # - environment.osx.lock.yml and | |
| # - environment.linux.lock.yml | |
| # regardless of the operating system it is running on. The trick is | |
| # temporarily setting the subdir and subdirs keys in .condarc to | |
| # what would be appropriate for the other operating system. | |
| # | |
| # It assumes that there exists a (manually managed) environment.yml file |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/usr/bin/env python3 | |
| """ | |
| Run with: | |
| fasta2fastq < in.fasta > out.fastq | |
| """ | |
| import dnaio | |
| import sys | |
| with dnaio.open(sys.stdin.buffer) as inf: | |
| with dnaio.open(sys.stdout.buffer, mode="w", fileformat="fastq") as outf: | |
| for record in inf: |
OlderNewer