biostars 265811

answer.py

from pyfaidx import Fasta

# positions.txt:
# chr1 1 T
# chr1 100 C
# chr2 10 G
# ...

with open('positions.txt') as mut_table:
  # mutable Fasta modifies input file in-place
  # make sure you're editing a copy of the original file
  with Fasta('input.fasta', mutable=True) as fasta:
    for line in mut_table:
      rname, pos, base = line.rstrip().split()
      # convert 1-based to 0-based coordinates
      fasta[rname][int(pos) - 1] = base

Sorry to hear that you're having trouble. I've tried to reproduce your issue using the example you provided, however I do see that the sites are mutated when running the code in this gist.

$ cat input.fasta
>ACVR1_R206H_1
CACCGCTGGCGAGCCACTGTTCTTTAACAGTGTAATCTGGCGAGCCACTGTTCTTTGTACCAGAAGAATTC
>ACVR1_R206H_2
CACCGTCTGGCGAGCCACTGTTCTTCAACAGTGTAATCTGGCGAGCCACTGTTCTTTGTACCAGAGAATTC
>ACVR1_S290L_3
CACCGATCGTTGTACGACTATCTTTCATGAAATGGGATCGTTGTACGACTATCTTCAGCTTACTAGAATTC

$ cat positions.txt 
ACVR1_R206H_1 1 T
ACVR1_R206H_2 1 T
ACVR1_S290L_3 1 T
ACVR1_R206H_1 4 T
ACVR1_R206H_2 4 T
ACVR1_S290L_3 4 T

$ cat mutate_guides.py
from pyfaidx import Fasta

# positions.txt:
# chr1 1 T
# chr1 100 C
# chr2 10 G
# ...

with open('positions.txt') as mut_table:
  # mutable Fasta modifies input file in-place
  # make sure you're editing a copy of the original file
  with Fasta('input.fasta', mutable=True) as fasta:
    for line in mut_table:
      rname, pos, base = line.rstrip().split()
      # convert 1-based to 0-based coordinates
      fasta[rname][int(pos) - 1] = base

$ python --version
Python 3.6.5
$ pip freeze
pyfaidx==0.5.8
six==1.14.0

Running the script produces the expected output:

$ python mutate_guides.py
$ cat input.fasta
>ACVR1_R206H_1
TACTGCTGGCGAGCCACTGTTCTTTAACAGTGTAATCTGGCGAGCCACTGTTCTTTGTACCAGAAGAATTC
>ACVR1_R206H_2
TACTGTCTGGCGAGCCACTGTTCTTCAACAGTGTAATCTGGCGAGCCACTGTTCTTTGTACCAGAGAATTC
>ACVR1_S290L_3
TACTGATCGTTGTACGACTATCTTTCATGAAATGGGATCGTTGTACGACTATCTTCAGCTTACTAGAATTC

Hopefully this can give you a starting point to figure out what's going wrong. Do note that the Fasta(mutable=True) does mean that the FASTA file will be edited in-place, and so you'll want to run the script on a copy of your guide sequence file so that you can compare the changes to the original.