Created
January 5, 2015 15:44
-
-
Save mdshw5/c6b9f7c08d36b3a3c5b0 to your computer and use it in GitHub Desktop.
biostars 125610
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >c1042 | |
| ACCGTACCC | |
| >c1043 | |
| GCTACAGTTGAAAGGGGACCGTACCC | |
| >c1044 | |
| ATGAATAAAATAATTTTGTATCATAAATCGAGCTGTTAATTATT | |
| >c1045 | |
| TTCATATTTGTAGCTAAGCAGAGGCGAAGCGTTCTTGTATCG |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| from pyfaidx import Fasta | |
| fa = Fasta('125610.fa') | |
| for sequence in fa: | |
| if 'ACCGTACCC' in str(sequence): | |
| print('>' + sequence.name) | |
| print(sequence) |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment