Created
February 13, 2025 08:24
-
-
Save mvdbeek/8f19897e57dbe8a346f8c6ff02bfab81 to your computer and use it in GitHub Desktop.
workflow_manifest_v1.json
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| [ | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "main", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/Mass_spectrometry__LC-MS_preprocessing_with_XCMS.ga", | |
| "testParameterFiles": [ | |
| "/Mass_spectrometry__LC-MS_preprocessing_with_XCMS-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "workflow4metabolomics", | |
| "image": "https://raw.githubusercontent.com/workflow4metabolomics/workflow4metabolomics/master/images/logo/logo_w4m-0.1-black-orange.png", | |
| "url": "https://workflow4metabolomics.org" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow is composed with the XCMS tool R package (Smith, C.A. 2006) able to extract, filter, align and fill gapand the possibility to annotate isotopes, adducts and fragments using the CAMERA R package (Kuhl, C 2012).\n\n\nhttps://training.galaxyproject.org/training-material/topics/metabolomics/tutorials/lcms-preprocessing/tutorial.html ", | |
| "creator": [ | |
| { | |
| "class": "Organization", | |
| "image": "https://raw.githubusercontent.com/workflow4metabolomics/workflow4metabolomics/master/images/logo/logo_w4m-0.1-black-orange.png", | |
| "name": "workflow4metabolomics", | |
| "url": "https://workflow4metabolomics.org" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "release": "1.0", | |
| "name": "Mass spectrometry: LC-MS preprocessing with XCMS", | |
| "steps": { | |
| "0": { | |
| "annotation": "", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "", | |
| "name": "SampleMetadata" | |
| } | |
| ], | |
| "label": "SampleMetadata", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 151.0066585286458 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"tabular\"], \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "bf49de4d-c959-476c-86e1-6ae621bc915c", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "", | |
| "name": "Mass-spectrometry Dataset Collection" | |
| } | |
| ], | |
| "label": "Mass-spectrometry Dataset Collection", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 9, | |
| "top": 300.0066585286458 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"mzml\", \"mzxml\", \"mzdata\", \"netcdf\"], \"tag\": null, \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "93611663-3e2a-41d1-a659-52217d5be454", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/msnbase_readmsdata/msnbase_readmsdata/2.16.1+galaxy2", | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": { | |
| "input": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "MSnbase readMSData", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.msnbase.raw" | |
| } | |
| ], | |
| "position": { | |
| "left": 289, | |
| "top": 279.0066585286458 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/msnbase_readmsdata/msnbase_readmsdata/2.16.1+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "12def6edac2f", | |
| "name": "msnbase_readmsdata", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.16.1+galaxy2", | |
| "type": "tool", | |
| "uuid": "44237c6c-b5fa-42de-b3db-f0be6b59ddf6", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_plot_chromatogram/xcms_plot_chromatogram/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": { | |
| "images": { | |
| "id": 2, | |
| "output_name": "xsetRData" | |
| }, | |
| "sampleMetadata": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms plot chromatogram", | |
| "outputs": [ | |
| { | |
| "name": "ticsPdf", | |
| "type": "pdf" | |
| }, | |
| { | |
| "name": "bpisPdf", | |
| "type": "pdf" | |
| } | |
| ], | |
| "position": { | |
| "left": 574.9933374023435, | |
| "top": 3 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_plot_chromatogram/xcms_plot_chromatogram/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "024974037c4e", | |
| "name": "xcms_plot_chromatogram", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"images\": {\"__class__\": \"ConnectedValue\"}, \"sampleMetadata\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "b8f69b68-dd61-41c4-9339-d821b14b50dd", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": null, | |
| "output_name": "ticsPdf", | |
| "uuid": "4a8d8533-5b39-49e5-9eeb-b6fb29ecfad4" | |
| }, | |
| { | |
| "label": null, | |
| "output_name": "bpisPdf", | |
| "uuid": "a483b83e-9fc8-4d06-a5d4-a5d49840016d" | |
| } | |
| ] | |
| }, | |
| "4": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_xcmsset/abims_xcms_xcmsSet/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": { | |
| "image": { | |
| "id": 2, | |
| "output_name": "xsetRData" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms findChromPeaks (xcmsSet)", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.xcms.findchrompeaks" | |
| }, | |
| { | |
| "name": "log", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 572, | |
| "top": 264.0066585286458 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_xcmsset/abims_xcms_xcmsSet/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "b02d1992a43a", | |
| "name": "xcms_xcmsset", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"filterSection\": {\"filterAcquisitionNum\": \"\", \"filterRt\": \"\", \"filterMz\": \"\"}, \"image\": {\"__class__\": \"ConnectedValue\"}, \"methods\": {\"method\": \"CentWave\", \"__current_case__\": 0, \"ppm\": \"3.0\", \"peakwidth\": \"5,20\", \"CentWaveAdv\": {\"snthresh\": \"10\", \"prefilter\": \"3,5000\", \"mzCenterFun\": \"wMean\", \"integrate\": \"1\", \"mzdiff\": \"-0.001\", \"fitgauss\": false, \"noise\": \"1000\", \"verboseColumns\": false, \"peaklist\": false, \"CentWaveAdvROI\": {\"roiList\": {\"__class__\": \"RuntimeValue\"}, \"firstBaselineCheck\": true, \"roiScales\": \"\"}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "73ed7f35-a7a4-49d8-b2c8-bd1e06f705c3", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_merge/xcms_merge/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "images": { | |
| "id": 4, | |
| "output_name": "xsetRData" | |
| }, | |
| "sampleMetadata": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms findChromPeaks Merger", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.xcms.findchrompeaks" | |
| } | |
| ], | |
| "position": { | |
| "left": 849, | |
| "top": 210.0066585286458 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_merge/xcms_merge/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5bd125a3f3b0", | |
| "name": "xcms_merge", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"images\": {\"__class__\": \"ConnectedValue\"}, \"sampleMetadata\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "686849c4-b729-4998-8560-44d34b820ba6", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_group/abims_xcms_group/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "image": { | |
| "id": 5, | |
| "output_name": "xsetRData" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms groupChromPeaks (group)", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.xcms.group" | |
| }, | |
| { | |
| "name": "plotChromPeakDensity", | |
| "type": "pdf" | |
| }, | |
| { | |
| "name": "variableMetadata", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "dataMatrix", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 1129, | |
| "top": 176 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_group/abims_xcms_group/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "d45a786cbc40", | |
| "name": "xcms_group", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"image\": {\"__class__\": \"ConnectedValue\"}, \"methods\": {\"method\": \"PeakDensity\", \"__current_case__\": 0, \"bw\": \"5.0\", \"minFraction\": \"0.9\", \"minSamples\": \"1\", \"binSize\": \"0.01\", \"PeakDensityAdv\": {\"maxFeatures\": \"50\"}}, \"peaklist\": {\"peaklistBool\": true, \"__current_case__\": 0, \"convertRTMinute\": false, \"numDigitsMZ\": \"4\", \"numDigitsRT\": \"0\", \"intval\": \"into\", \"naTOzero\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "7d43b889-0799-4ec1-9b0f-1bff1c3a189b", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": null, | |
| "output_name": "plotChromPeakDensity", | |
| "uuid": "28f8a44d-db88-4bd8-89b3-bde0bc4948b8" | |
| } | |
| ] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_retcor/abims_xcms_retcor/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "image": { | |
| "id": 6, | |
| "output_name": "xsetRData" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms adjustRtime (retcor)", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.xcms.retcor" | |
| }, | |
| { | |
| "name": "rawVSadjustedPdf", | |
| "type": "pdf" | |
| } | |
| ], | |
| "position": { | |
| "left": 1412, | |
| "top": 232.0066585286458 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_retcor/abims_xcms_retcor/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "aa252eec9229", | |
| "name": "xcms_retcor", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"image\": {\"__class__\": \"ConnectedValue\"}, \"methods\": {\"method\": \"PeakGroups\", \"__current_case__\": 0, \"minFraction\": \"0.7\", \"extraPeaks\": \"1\", \"smooth_cond\": {\"smooth\": \"loess\", \"__current_case__\": 0, \"PeakGroupsSmoothLoessAdv\": {\"span\": \"0.2\", \"family\": \"gaussian\"}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "656670ac-dfae-41c8-a551-f3ff1f1bb61f", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": null, | |
| "output_name": "rawVSadjustedPdf", | |
| "uuid": "0bf0db72-a5f7-40cc-96a8-c200393d558d" | |
| } | |
| ] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/melpetera/intensity_checks/intens_check/1.2.8", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "dataMatrix_in": { | |
| "id": 6, | |
| "output_name": "dataMatrix" | |
| }, | |
| "sampleMetadata_in": { | |
| "id": 0, | |
| "output_name": "output" | |
| }, | |
| "variableMetadata_in": { | |
| "id": 6, | |
| "output_name": "variableMetadata" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Intensity Check", | |
| "outputs": [ | |
| { | |
| "name": "variableMetadata_out", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "graphs_out", | |
| "type": "pdf" | |
| } | |
| ], | |
| "position": { | |
| "left": 1366, | |
| "top": 495 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/melpetera/intensity_checks/intens_check/1.2.8", | |
| "tool_shed_repository": { | |
| "changeset_revision": "a31f3f802b2b", | |
| "name": "intensity_checks", | |
| "owner": "melpetera", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"__input_ext\": \"tabular\", \"chromInfo\": \"/shared/mfs/data/galaxy/mutable-config/tool-data/shared/ucsc/chrom/?.len\", \"dataMatrix_in\": {\"__class__\": \"ConnectedValue\"}, \"method_cond\": {\"method\": \"each_class\", \"__current_case__\": 1, \"class_col\": \"2\", \"chosen_stat\": [\"NA\"], \"test_fold_cond\": {\"test_fold\": \"No\", \"__current_case__\": 1}}, \"sampleMetadata_in\": {\"__class__\": \"ConnectedValue\"}, \"variableMetadata_in\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.2.8", | |
| "type": "tool", | |
| "uuid": "fcbec34b-b0d1-4d09-9873-a3c9c95399dc", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": null, | |
| "output_name": "graphs_out", | |
| "uuid": "80858377-f286-48d8-8b8e-edc70f4fbb95" | |
| } | |
| ] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_plot_chromatogram/xcms_plot_chromatogram/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "images": { | |
| "id": 7, | |
| "output_name": "xsetRData" | |
| }, | |
| "sampleMetadata": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms plot chromatogram", | |
| "outputs": [ | |
| { | |
| "name": "ticsPdf", | |
| "type": "pdf" | |
| }, | |
| { | |
| "name": "bpisPdf", | |
| "type": "pdf" | |
| } | |
| ], | |
| "position": { | |
| "left": 1716.9933374023435, | |
| "top": 0 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_plot_chromatogram/xcms_plot_chromatogram/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "024974037c4e", | |
| "name": "xcms_plot_chromatogram", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"images\": {\"__class__\": \"ConnectedValue\"}, \"sampleMetadata\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "95ef16c0-4b3f-44de-99b3-2c4ace994d5f", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": null, | |
| "output_name": "ticsPdf", | |
| "uuid": "72185083-b1c0-4b45-8a91-875873d4fdcb" | |
| }, | |
| { | |
| "label": null, | |
| "output_name": "bpisPdf", | |
| "uuid": "15c97a18-a8af-46da-9c2b-38e9126affa4" | |
| } | |
| ] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_group/abims_xcms_group/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "image": { | |
| "id": 7, | |
| "output_name": "xsetRData" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms groupChromPeaks (group)", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.xcms.group" | |
| }, | |
| { | |
| "name": "plotChromPeakDensity", | |
| "type": "pdf" | |
| }, | |
| { | |
| "name": "variableMetadata", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "dataMatrix", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 1689, | |
| "top": 518.0066585286459 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_group/abims_xcms_group/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "d45a786cbc40", | |
| "name": "xcms_group", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"image\": {\"__class__\": \"ConnectedValue\"}, \"methods\": {\"method\": \"PeakDensity\", \"__current_case__\": 0, \"bw\": \"5.0\", \"minFraction\": \"0.9\", \"minSamples\": \"1\", \"binSize\": \"0.01\", \"PeakDensityAdv\": {\"maxFeatures\": \"50\"}}, \"peaklist\": {\"peaklistBool\": true, \"__current_case__\": 0, \"convertRTMinute\": true, \"numDigitsMZ\": \"4\", \"numDigitsRT\": \"2\", \"intval\": \"into\", \"naTOzero\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "a6477b12-d89e-48b1-8572-9a86490211a4", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": null, | |
| "output_name": "plotChromPeakDensity", | |
| "uuid": "6547dcea-fd0c-4029-bb47-a71dc6432e70" | |
| } | |
| ] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_fillpeaks/abims_xcms_fillPeaks/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "image": { | |
| "id": 10, | |
| "output_name": "xsetRData" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms fillChromPeaks (fillPeaks)", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.xcms.fillpeaks" | |
| }, | |
| { | |
| "name": "variableMetadata", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "dataMatrix", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 1969, | |
| "top": 602.0066585286459 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_fillpeaks/abims_xcms_fillPeaks/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "26d77e9ceb49", | |
| "name": "xcms_fillpeaks", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"Adv\": {\"expandMz\": \"0\", \"expandRt\": \"0\", \"ppm\": \"0\"}, \"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"image\": {\"__class__\": \"ConnectedValue\"}, \"peaklist\": {\"peaklistBool\": \"True\", \"convertRTMinute\": true, \"numDigitsMZ\": \"4\", \"numDigitsRT\": \"2\", \"intval\": \"into\", \"naTOzero\": true}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "41073bd0-81ec-410c-a2bc-127be2044740", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "xcms fillChromPeaks dataMatrix", | |
| "output_name": "dataMatrix", | |
| "uuid": "b716b601-92fa-472c-993b-0769078d2b01" | |
| }, | |
| { | |
| "label": null, | |
| "output_name": "xsetRData", | |
| "uuid": "967392c7-016e-4d7e-8bf6-ce3628113345" | |
| } | |
| ] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/camera_annotate/abims_CAMERA_annotateDiffreport/2.2.6+camera1.48.0-galaxy1", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "image": { | |
| "id": 11, | |
| "output_name": "xsetRData" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "CAMERA.annotate", | |
| "outputs": [ | |
| { | |
| "name": "variableMetadata", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "rdata_quick_true", | |
| "type": "rdata.camera.quick" | |
| } | |
| ], | |
| "position": { | |
| "left": 2249, | |
| "top": 669.0066585286459 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/camera_annotate/abims_CAMERA_annotateDiffreport/2.2.6+camera1.48.0-galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4b9ab71be05e", | |
| "name": "camera_annotate", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"diffreport\": {\"options\": {\"option\": \"hide\", \"__current_case__\": 1}}, \"export\": {\"convertRTMinute\": true, \"numDigitsMZ\": \"4\", \"numDigitsRT\": \"2\", \"intval\": \"into\"}, \"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"findgeneral\": {\"ppm\": \"5\", \"mzabs\": \"0.015\"}, \"findisotopes\": {\"maxcharge\": \"2\", \"maxiso\": \"4\", \"minfrac\": \"0.5\"}, \"groupfwhm\": {\"sigma\": \"6\", \"perfwhm\": \"0.6\"}, \"image\": {\"__class__\": \"ConnectedValue\"}, \"quick_block\": {\"quick\": \"TRUE\", \"__current_case__\": 1, \"polarity\": \"quick\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.6+camera1.48.0-galaxy1", | |
| "type": "tool", | |
| "uuid": "7f7f0568-40cf-445b-8f4e-78a3af20109b", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "CAMERA.annotate variableMetadata", | |
| "output_name": "variableMetadata", | |
| "uuid": "9b321589-0f82-4f17-bf9b-faae8c353079" | |
| }, | |
| { | |
| "label": null, | |
| "output_name": "rdata_quick_true", | |
| "uuid": "5fd93902-b994-4124-8646-41b8f2c47b7d" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "metabolomics", | |
| "MS", | |
| "LC-MS", | |
| "workflow4metabolomics", | |
| "xcms", | |
| "GTN" | |
| ], | |
| "uuid": "4b4dda98-7422-4207-b9bd-62c11ce8e0f0", | |
| "version": 5 | |
| }, | |
| "updated": "2024-12-03T18:32:53.993123", | |
| "readme": "# Mass spectrometry: LC-MS preprocessing with XCMS \n\nThis workflow uses the XCMS tool R package [(Smith, C.A. 2006)](https://bioconductor.org/packages/release/bioc/html/xcms.html) to extract, filter, align and fill gaps, and uses the CAMERA R package [(Kuhl, C 2012)](https://bioconductor.org/packages/release/bioc/html/CAMERA.html) to annotate isotopes, adducts and fragments.\n\n🎓 For more information see the [Galaxy Training Network tutorial: Mass spectrometry: LC-MS preprocessing with XCMS](https://training.galaxyproject.org/training-material/topics/metabolomics/tutorials/lcms-preprocessing/tutorial.html)\n\n## Inputs\n### sampleMetadata\nThe sampleMetadata tabular file corresponds to a table containing information about your samples\n\nA sample metadata file contains various information for each of your raw files:\n- Classes which will be used during the preprocessing steps\n- Analytical batches which will be useful for a batch correction step, along with sample types (pool/sample) and injection order\n- Different experimental conditions which can be used for statistics\n- Any information about samples that you want to keep, in a column format\n\nThe content of your sample metadata file has to be filled by you, since it is not contained in your raw data. Note that you can either:\n- Upload an existing metadata file\n- Use a template to create one (because it can be painful to get the sample list without misspelling or omission)\n - Generate a template with the `xcms get a sampleMetadata file` tool available in Galaxy\n - Fill it using your favorite table editor (Excel, LibreOffice)\n - Upload it within Galaxy\n\n**Formats:** tab-separated values as tsv, tab, txt, ...\n\n### Mass-spectrometry Dataset Collection\nMass-spectrometry data files gathered in a Galaxy Dataser Collection\n\n**Formats:** open format as mzXML, mzMl, mzData and netCDF\n\n## Main steps\n1. MSnbase readMSData: read the mzXML and prepare for xcms\n2. XCMS findChromPeaks: peak picking\n3. XCMS groupChromPeaks: determining shared ions across samples\n4. XCMS adjustRtime: retention time correction\n5. XCMS fillChromPeaks: integrating areas of missing peaks\n6. CAMERA.annotate: annotation\n", | |
| "changelog": "# Changelog\n\nAll notable changes to this project will be documented in this file.\n\n## [1.0] - 2023-11-22\n\nFirst release\n\n", | |
| "diagrams": "# Workflow diagrams\n\n## Mass spectrometry: LC-MS preprocessing with XCMS\n\n```mermaid\ngraph LR\n0[\"ℹ️ SampleMetadata\"]@{ shape: doc }\n1[\"ℹ️ Mass-spectrometry Dataset Collection\"]@{ shape: docs }\n2[\"MSnbase readMSData\"]@{ shape: process }\n1 --> 2\n3[\"xcms plot chromatogram\"]@{ shape: process }\n2 --> 3\n0 --> 3\n4[\"xcms findChromPeaks (xcmsSet)\"]@{ shape: process }\n2 --> 4\n5[\"xcms findChromPeaks Merger\"]@{ shape: process }\n4 --> 5\n0 --> 5\n6[\"xcms groupChromPeaks (group)\"]@{ shape: process }\n5 --> 6\n7[\"xcms adjustRtime (retcor)\"]@{ shape: process }\n6 --> 7\n8[\"Intensity Check\"]@{ shape: process }\n6 --> 8\n0 --> 8\n6 --> 8\n9[\"xcms plot chromatogram\"]@{ shape: process }\n7 --> 9\n0 --> 9\n10[\"xcms groupChromPeaks (group)\"]@{ shape: process }\n7 --> 10\n11[\"xcms fillChromPeaks (fillPeaks)\"]@{ shape: process }\n10 --> 11\n12[\"CAMERA.annotate\"]@{ shape: process }\n11 --> 12\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/lcms-preprocessing/main", | |
| "dockstore_id": 24508, | |
| "categories": [], | |
| "collections": [ | |
| "Computational Chemistry" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test outline for Mass_spectrometry__LC-MS_preprocessing_with_XCMS", | |
| "job": { | |
| "SampleMetadata": { | |
| "class": "File", | |
| "identifier": "sampleMetadata.tsv", | |
| "location": "https://zenodo.org/records/10130758/files/sampleMetadata_12samp_completed.tsv", | |
| "filetype": "tabular" | |
| }, | |
| "Mass-spectrometry Dataset Collection": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "class": "File", | |
| "identifier": "Blanc05.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/Blanc05.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "Blanc10.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/Blanc10.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "Blanc16.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/Blanc16.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "HU_neg_048.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/HU_neg_048.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "HU_neg_090.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/HU_neg_090.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "HU_neg_123.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/HU_neg_123.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "HU_neg_157.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/HU_neg_157.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "HU_neg_173.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/HU_neg_173.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "HU_neg_192.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/HU_neg_192.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "QC1_002.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/QC1_002.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "QC1_008.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/QC1_008.mzML", | |
| "filetype": "mzml" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "QC1_014.mzML", | |
| "location": "https://zenodo.org/record/10130758/files/QC1_014.mzML", | |
| "filetype": "mzml" | |
| } | |
| ] | |
| } | |
| }, | |
| "outputs": { | |
| "xcms fillChromPeaks dataMatrix": { | |
| "file": "test-data/xset.merged.groupChromPeaks.adjustRtime.groupChromPeaks.fillpeaks.dataMatrix.tsv" | |
| }, | |
| "CAMERA.annotate variableMetadata": { | |
| "file": "test-data/xset.merged.groupChromPeaks.adjustRtime.groupChromPeaks.fillChromPeaks.annotate.variableMetadata.tsv" | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/metabomics/lcms-preprocessing" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "main", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/Mass-spectrometry__GCMS-with-metaMS.ga", | |
| "testParameterFiles": [ | |
| "/Mass-spectrometry__GCMS-with-metaMS-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "workflow4metabolomics", | |
| "image": "https://raw.githubusercontent.com/workflow4metabolomics/workflow4metabolomics/master/images/logo/logo_w4m-0.1-black-orange.png", | |
| "url": "https://workflow4metabolomics.org/" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow is composed with the XCMS tool R package (Smith, C.A. 2006) able to extract and the metaMS R package (Wehrens, R 2014) for the field of untargeted metabolomics. \n\nhttps://training.galaxyproject.org/training-material/topics/metabolomics/tutorials/gcms/tutorial.html", | |
| "creator": [ | |
| { | |
| "class": "Organization", | |
| "image": "https://raw.githubusercontent.com/workflow4metabolomics/workflow4metabolomics/master/images/logo/logo_w4m-0.1-black-orange.png", | |
| "name": "workflow4metabolomics", | |
| "url": "https://workflow4metabolomics.org/" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "release": "0.1", | |
| "license": "MIT", | |
| "name": "Mass spectrometry: GCMS with metaMS", | |
| "steps": { | |
| "0": { | |
| "annotation": "", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "", | |
| "name": "Mass-spectrometry Dataset Collection" | |
| } | |
| ], | |
| "label": "Mass-spectrometry Dataset Collection", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 15, | |
| "top": 101 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "27aea272-13ef-4ab2-81ef-329830985fe0", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "", | |
| "name": "sampleMetadata" | |
| } | |
| ], | |
| "label": "sampleMetadata", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 314 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "a3d47eb1-e815-4219-86c0-23ce34b662d7", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/msnbase_readmsdata/msnbase_readmsdata/2.16.1+galaxy2", | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MSnbase readMSData", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "MSnbase readMSData", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.msnbase.raw" | |
| } | |
| ], | |
| "position": { | |
| "left": 295, | |
| "top": 80 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/msnbase_readmsdata/msnbase_readmsdata/2.16.1+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "12def6edac2f", | |
| "name": "msnbase_readmsdata", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input\": {\"__class__\": \"RuntimeValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.16.1+galaxy2", | |
| "type": "tool", | |
| "uuid": "60192f76-c4a8-4505-a24e-e730fe87694e", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_xcmsset/abims_xcms_xcmsSet/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": { | |
| "image": { | |
| "id": 2, | |
| "output_name": "xsetRData" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms findChromPeaks (xcmsSet)", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.xcms.findchrompeaks" | |
| }, | |
| { | |
| "name": "log", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 575, | |
| "top": 311 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_xcmsset/abims_xcms_xcmsSet/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "b02d1992a43a", | |
| "name": "xcms_xcmsset", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"filterSection\": {\"filterAcquisitionNum\": \"\", \"filterRt\": \"\", \"filterMz\": \"\"}, \"image\": {\"__class__\": \"ConnectedValue\"}, \"methods\": {\"method\": \"MatchedFilter\", \"__current_case__\": 1, \"fwhm\": \"5\", \"binSize\": \"0.5\", \"MatchedFilterAdv\": {\"impute_cond\": {\"impute\": \"none\", \"__current_case__\": 0}, \"sigma\": null, \"max\": \"500\", \"snthresh\": \"2\", \"steps\": \"2\", \"mzdiff\": \"0.5\", \"peaklist\": false}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "117244c7-a9b0-4143-bfba-48c6cca56ee5", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_plot_chromatogram/xcms_plot_chromatogram/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": { | |
| "images": { | |
| "id": 3, | |
| "output_name": "xsetRData" | |
| }, | |
| "sampleMetadata": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms plot chromatogram", | |
| "outputs": [ | |
| { | |
| "name": "ticsPdf", | |
| "type": "pdf" | |
| }, | |
| { | |
| "name": "bpisPdf", | |
| "type": "pdf" | |
| } | |
| ], | |
| "position": { | |
| "left": 915, | |
| "top": 0 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_plot_chromatogram/xcms_plot_chromatogram/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "024974037c4e", | |
| "name": "xcms_plot_chromatogram", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"__input_ext\": \"rdata.xcms.findchrompeaks\", \"chromInfo\": \"/shared/ifbstor1/galaxy/mutable-config/tool-data/shared/ucsc/chrom/?.len\", \"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"images\": {\"__class__\": \"ConnectedValue\"}, \"sampleMetadata\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "a5e5e89e-4521-49b4-9554-1004cefb3842", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": null, | |
| "output_name": "bpisPdf", | |
| "uuid": "98f84d78-fb87-4ba8-9781-d4935013f052" | |
| }, | |
| { | |
| "label": null, | |
| "output_name": "ticsPdf", | |
| "uuid": "3a9785ad-afad-410f-8f17-6f7b9644f37b" | |
| } | |
| ] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_merge/xcms_merge/3.12.0+galaxy0", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "images": { | |
| "id": 3, | |
| "output_name": "xsetRData" | |
| }, | |
| "sampleMetadata": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "xcms findChromPeaks Merger", | |
| "outputs": [ | |
| { | |
| "name": "xsetRData", | |
| "type": "rdata.xcms.findchrompeaks" | |
| } | |
| ], | |
| "position": { | |
| "left": 861, | |
| "top": 521 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lecorguille/xcms_merge/xcms_merge/3.12.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5bd125a3f3b0", | |
| "name": "xcms_merge", | |
| "owner": "lecorguille", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"__input_ext\": \"rdata.xcms.findchrompeaks\", \"chromInfo\": \"/shared/ifbstor1/galaxy/mutable-config/tool-data/shared/ucsc/chrom/?.len\", \"file_load_section\": {\"file_load_conditional\": {\"file_load_select\": \"no\", \"__current_case__\": 0}}, \"images\": {\"__class__\": \"ConnectedValue\"}, \"sampleMetadata\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.12.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "cb2b0664-f992-4e0b-8a40-58c83a0e47f9", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/yguitton/metams_rungc/metams_runGC/3.0.0+metaMS1.24.0-galaxy0", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "input": { | |
| "id": 5, | |
| "output_name": "xsetRData" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "metaMS.runGC", | |
| "outputs": [ | |
| { | |
| "name": "peaktable", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "sampleMetadata", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "variableMetadata", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "dataMatrix", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "peakspectra", | |
| "type": "txt" | |
| }, | |
| { | |
| "name": "rungcRData", | |
| "type": "rdata" | |
| } | |
| ], | |
| "position": { | |
| "left": 1140, | |
| "top": 202 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/yguitton/metams_rungc/metams_runGC/3.0.0+metaMS1.24.0-galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "93508ea69eb5", | |
| "name": "metams_rungc", | |
| "owner": "yguitton", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"options_rifilter\": {\"option\": \"false\", \"__current_case__\": 1}, \"settings\": {\"setting\": \"usersettings\", \"__current_case__\": 1, \"options_rtrange\": {\"option\": \"hide\", \"__current_case__\": 1}, \"rtdiff\": \"0.05\", \"minfeat\": \"5\", \"simthreshold\": \"0.7\", \"minclassfraction\": \"0.5\", \"minclasssize\": \"3\", \"options_db\": {\"option\": \"hide\", \"__current_case__\": 1}, \"options_ri\": {\"option\": \"hide\", \"__current_case__\": 1}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.0.0+metaMS1.24.0-galaxy0", | |
| "type": "tool", | |
| "uuid": "4f636be8-c31f-474e-8c47-8fd644710863", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "metaMS.runGC dataMatrix", | |
| "output_name": "dataMatrix", | |
| "uuid": "2ad0157b-8587-47ba-8481-3e8b6c2fe7f2" | |
| }, | |
| { | |
| "label": null, | |
| "output_name": "peaktable", | |
| "uuid": "2f467902-d943-431b-89d5-731911e06f2d" | |
| } | |
| ] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/ethevenot/checkformat/checkFormat/3.0.0", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "dataMatrix_in": { | |
| "id": 6, | |
| "output_name": "dataMatrix" | |
| }, | |
| "sampleMetadata_in": { | |
| "id": 1, | |
| "output_name": "output" | |
| }, | |
| "variableMetadata_in": { | |
| "id": 6, | |
| "output_name": "variableMetadata" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Check Format", | |
| "outputs": [ | |
| { | |
| "name": "dataMatrix_out", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "sampleMetadata_out", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "variableMetadata_out", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "information", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 1496, | |
| "top": 281 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/ethevenot/checkformat/checkFormat/3.0.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e7c5811ec12f", | |
| "name": "checkformat", | |
| "owner": "ethevenot", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"dataMatrix_in\": {\"__class__\": \"ConnectedValue\"}, \"makeNameL\": \"FALSE\", \"sampleMetadata_in\": {\"__class__\": \"ConnectedValue\"}, \"variableMetadata_in\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.0.0", | |
| "type": "tool", | |
| "uuid": "a3701788-b7fd-4eb9-adf1-d3834a935567", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/ethevenot/multivariate/Multivariate/2.3.10", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "dataMatrix_in": { | |
| "id": 7, | |
| "output_name": "dataMatrix_out" | |
| }, | |
| "sampleMetadata_in": { | |
| "id": 7, | |
| "output_name": "sampleMetadata_out" | |
| }, | |
| "variableMetadata_in": { | |
| "id": 7, | |
| "output_name": "variableMetadata_out" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Multivariate", | |
| "outputs": [ | |
| { | |
| "name": "sampleMetadata_out", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "variableMetadata_out", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "figure", | |
| "type": "pdf" | |
| }, | |
| { | |
| "name": "information", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 1827, | |
| "top": 293 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/ethevenot/multivariate/Multivariate/2.3.10", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5526f8258e8a", | |
| "name": "multivariate", | |
| "owner": "ethevenot", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advCpt\": {\"opcC\": \"full\", \"__current_case__\": 1, \"scaleC\": \"standard\", \"permI\": \"20\", \"log10L\": \"FALSE\", \"algoC\": \"default\", \"crossvalI\": \"3\"}, \"advGph\": {\"opgC\": \"full\", \"__current_case__\": 1, \"typeC\": \"summary\", \"parMahalC\": \"NA\", \"parAsColC\": \"class\", \"parLabVc\": \"none\", \"parPc1I\": \"1\", \"parPc2I\": \"2\", \"parCexN\": \"0.8\"}, \"dataMatrix_in\": {\"__class__\": \"ConnectedValue\"}, \"orthoI\": \"0\", \"predI\": \"NA\", \"respC\": \"none\", \"sampleMetadata_in\": {\"__class__\": \"ConnectedValue\"}, \"save_rdata\": false, \"testL\": \"FALSE\", \"variableMetadata_in\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.3.10", | |
| "type": "tool", | |
| "uuid": "52e89249-a543-441c-8da6-60b7e40178b2", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "Multivariate variableMetadata", | |
| "output_name": "variableMetadata_out", | |
| "uuid": "376507dd-94ff-4bf1-8481-5fe5ed61918e" | |
| }, | |
| { | |
| "label": "Multivariate sampleMetadata", | |
| "output_name": "sampleMetadata_out", | |
| "uuid": "d574dc78-9310-44e9-a6c3-b02b104e598c" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "metabolomics", | |
| "MS", | |
| "workflow4metabolomics", | |
| "GC-MS", | |
| "GTN", | |
| "metaMS" | |
| ], | |
| "uuid": "a2b0d4f7-164c-40d3-ac34-f248db18bbef", | |
| "version": 2 | |
| }, | |
| "updated": "2024-12-03T18:32:53.992254", | |
| "readme": "# Mass spectrometry: GCMS with metaMS \n\nThis workflow uses the XCMS tool R package [(Smith, C.A. 2006)](https://bioconductor.org/packages/release/bioc/html/xcms.html) to extract, filter, align and fill gaps, and uses the CAMERA R package [(Kuhl, C 2012)](https://bioconductor.org/packages/release/bioc/html/CAMERA.html) to annotate isotopes, adducts and fragments.\n\nThis workflow is composed with the XCMS tool R package [(Smith, C.A. 2006)](https://bioconductor.org/packages/release/bioc/html/xcms.html) to extract and the metaMS R package [(Wehrens, R 2014)](https://bioconductor.org/packages/release/bioc/html/metaMS.html) for the field of untargeted metabolomics. \n\n🎓 For more information see the [Galaxy Training Network tutorial: Mass spectrometry: GC-MS analysis with metaMS package](https://training.galaxyproject.org/training-material/topics/metabolomics/tutorials/gcms/tutorial.html)\n\n## Inputs\n### sampleMetadata\nThe sampleMetadata tabular file corresponds to a table containing information about your samples\n\nA sample metadata file contains various information for each of your raw files:\n- Classes which will be used during the preprocessing steps\n- Analytical batches which will be useful for a batch correction step, along with sample types (pool/sample) and injection order\n- Different experimental conditions which can be used for statistics\n- Any information about samples that you want to keep, in a column format\n\nThe content of your sample metadata file has to be filled by you, since it is not contained in your raw data. Note that you can either:\n- Upload an existing metadata file\n- Use a template to create one (because it can be painful to get the sample list without misspelling or omission)\n - Generate a template with the `xcms get a sampleMetadata file` tool available in Galaxy\n - Fill it using your favorite table editor (Excel, LibreOffice)\n - Upload it within Galaxy\n\n**Formats:** tab-separated values as tsv, tab, txt, ...\n\n### Mass-spectrometry Dataset Collection\nMass-spectrometry data files gathered in a Galaxy Dataser Collection\n\n**Formats:** open format as mzXML, mzMl, mzData and netCDF\n\n## Main steps\n1. MSnbase readMSData: read the mzXML and prepare for xcms\n2. XCMS findChromPeaks: peak picking\n3. metaMS.runGC: definition of pseudo-spectra\n", | |
| "changelog": "# Changelog\n\nAll notable changes to this project will be documented in this file.\n\n## [0.1] - 2023-11-22\n\nFirst release\n", | |
| "diagrams": "# Workflow diagrams\n\n## Mass spectrometry: GCMS with metaMS\n\n```mermaid\ngraph LR\n0[\"ℹ️ Mass-spectrometry Dataset Collection\"]@{ shape: docs }\n1[\"ℹ️ sampleMetadata\"]@{ shape: doc }\n2[\"MSnbase readMSData\"]@{ shape: process }\n0 --> 2\n3[\"xcms findChromPeaks (xcmsSet)\"]@{ shape: process }\n2 --> 3\n4[\"xcms plot chromatogram\"]@{ shape: process }\n3 --> 4\n1 --> 4\n5[\"xcms findChromPeaks Merger\"]@{ shape: process }\n3 --> 5\n1 --> 5\n6[\"metaMS.runGC\"]@{ shape: process }\n5 --> 6\n7[\"Check Format\"]@{ shape: process }\n6 --> 7\n1 --> 7\n6 --> 7\n8[\"Multivariate\"]@{ shape: process }\n7 --> 8\n7 --> 8\n7 --> 8\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/gcms-metams/main", | |
| "dockstore_id": 24516, | |
| "categories": [], | |
| "collections": [ | |
| "Computational Chemistry" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test outline for Mass-spectrometry__GCMS-with-metaMS.ga", | |
| "job": { | |
| "sampleMetadata": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/3631074/files/sampleMetadata.tsv", | |
| "filetype": "tabular" | |
| }, | |
| "Mass-spectrometry Dataset Collection": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "class": "File", | |
| "identifier": "alg11.mzData", | |
| "location": "https://zenodo.org/record/3631074/files/alg11.mzData", | |
| "filetype": "mzdata" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "alg2.mzData", | |
| "location": "https://zenodo.org/record/3631074/files/alg2.mzData", | |
| "filetype": "mzdata" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "alg3.mzData", | |
| "location": "https://zenodo.org/record/3631074/files/alg3.mzData", | |
| "filetype": "mzdata" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "alg7.mzData", | |
| "location": "https://zenodo.org/record/3631074/files/alg7.mzData", | |
| "filetype": "mzdata" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "alg8.mzData", | |
| "location": "https://zenodo.org/record/3631074/files/alg8.mzData", | |
| "filetype": "mzdata" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "alg9.mzData", | |
| "location": "https://zenodo.org/record/3631074/files/alg9.mzData", | |
| "filetype": "mzdata" | |
| } | |
| ] | |
| } | |
| }, | |
| "outputs": { | |
| "metaMS.runGC dataMatrix": { | |
| "path": "test-data/metaMS.runGC_dataMatrix.tabular", | |
| "lines_diff": 10 | |
| }, | |
| "Multivariate variableMetadata": { | |
| "asserts": [ | |
| { | |
| "that": "has_n_lines", | |
| "n": 42 | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "Unknown 1\tUnknown\t0.0046\t19.499\t-0.17" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "Unknown 41\tUnknown\t0.0039\t14.857\t-0.08" | |
| } | |
| ] | |
| }, | |
| "Multivariate sampleMetadata": { | |
| "asserts": [ | |
| { | |
| "that": "has_n_lines", | |
| "n": 7 | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "alg11\tFWS_100perNaCl\t-6.2" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "alg8\tFWS_5percNaCL\t-0.6" | |
| } | |
| ] | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/metabomics/gcms-metams" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "COVID-19-PE-ARTIC-ILLUMINA", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/pe-artic-variation.ga", | |
| "testParameterFiles": [ | |
| "/pe-artic-variation-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Wolfgang Maier", | |
| "orcid": "0000-0002-9464-6640" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "The workflow for Illumina-sequenced ARTIC data builds on the RNASeq workflow for paired-end data using the same steps for mapping and variant calling, but adds extra logic for trimming ARTIC primer sequences off reads with the ivar package. In addition, this workflow uses ivar also to identify amplicons affected by ARTIC primer-binding site mutations and tries to exclude reads derived from such tainted amplicons when calculating allele-frequencies of other variants.", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-9464-6640", | |
| "name": "Wolfgang Maier" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "name": "COVID-19: variation analysis on ARTIC PE data", | |
| "release": "0.5.3", | |
| "steps": { | |
| "0": { | |
| "annotation": "Illumina reads from ARTIC assay with fastqsanger encoding", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Illumina reads from ARTIC assay with fastqsanger encoding", | |
| "name": "Paired Collection" | |
| } | |
| ], | |
| "label": "Paired Collection", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0.0, | |
| "top": 506.796875 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"fastqsanger\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list:paired\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "dfab5b21-4abb-4269-978d-7c7e24479e4a", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Fasta sequence for Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Fasta sequence for Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome", | |
| "name": "NC_045512.2 FASTA sequence of SARS-CoV-2" | |
| } | |
| ], | |
| "label": "NC_045512.2 FASTA sequence of SARS-CoV-2", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 269.78125, | |
| "top": 883.5625 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"fasta\", \"fasta.gz\"], \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "03043a6d-ee9e-4af5-abf4-f960beb6b4e9", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "BED file containing ARTIC primer positions. Can be retrieved from https://usegalaxy.eu/u/wolfgang-maier/h/covid-19-resources", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "BED file containing ARTIC primer positions. Can be retrieved from https://usegalaxy.eu/u/wolfgang-maier/h/covid-19-resources", | |
| "name": "ARTIC primer BED" | |
| } | |
| ], | |
| "label": "ARTIC primer BED", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 962.171875, | |
| "top": 326.90625 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"bed\"], \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "cd6caddf-88ee-47a2-b91d-141fd90b046f", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "Used by ivar trim and ivar removereads for assigning primers to amplicons. Should have one line of tab-separated primer names per amplicon. Can be retrieved from https://usegalaxy.eu/u/wolfgang-maier/h/covid-19-resources", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Used by ivar trim and ivar removereads for assigning primers to amplicons. Should have one line of tab-separated primer names per amplicon. Can be retrieved from https://usegalaxy.eu/u/wolfgang-maier/h/covid-19-resources", | |
| "name": "ARTIC primers to amplicon assignments" | |
| } | |
| ], | |
| "label": "ARTIC primers to amplicon assignments", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 961.625, | |
| "top": 431.5625 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"tabular\"], \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "686cdb4d-a3da-468f-af92-8b04e1824ae0", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "Minimum allele-frequency required for a candidate primer binding site mutation to trigger amplicon removal. Variants with AF values below this threshold are treated as possible false-positives, which are not worth the coverage loss associated with amplicon removal.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Minimum allele-frequency required for a candidate primer binding site mutation to trigger amplicon removal. Variants with AF values below this threshold are treated as possible false-positives, which are not worth the coverage loss associated with amplicon removal.", | |
| "name": "Read removal minimum AF" | |
| } | |
| ], | |
| "label": "Read removal minimum AF", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 1093.265625, | |
| "top": 46.640625 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 0.1, \"parameter_type\": \"float\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "29f15ec0-8fa4-4476-b649-cf68ea096744", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "Maximum allele-frequency allowed for a primer binding site mutation to trigger amplicon removal. Variants with AF values above this threshold are treated as fixed variants, which won't generate amplicon bias.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Maximum allele-frequency allowed for a primer binding site mutation to trigger amplicon removal. Variants with AF values above this threshold are treated as fixed variants, which won't generate amplicon bias.", | |
| "name": "Read removal maximum AF" | |
| } | |
| ], | |
| "label": "Read removal maximum AF", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 1094.515625, | |
| "top": 156.640625 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 1.0, \"parameter_type\": \"float\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "b13941c0-31c0-419d-a619-7474c24a582c", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "At any given variant site use the amplicon bias-corrected recall only if the depth of coverage of the site retains at least this value after amplicon removal.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "At any given variant site use the amplicon bias-corrected recall only if the depth of coverage of the site retains at least this value after amplicon removal.", | |
| "name": "Minimum DP required after amplicon bias correction" | |
| } | |
| ], | |
| "label": "Minimum DP required after amplicon bias correction", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 2171.5625, | |
| "top": 0.0 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 1, \"parameter_type\": \"integer\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "e33b575d-e44e-451e-a2ba-5c253fdc9e5a", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "7": { | |
| "annotation": "At any given variant site use the amplicon bias-corrected recall only if the depth of variant-supporting reads at the site retains at least this value after amplicon removal.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "At any given variant site use the amplicon bias-corrected recall only if the depth of variant-supporting reads at the site retains at least this value after amplicon removal.", | |
| "name": "Minimum DP_ALT required after amplicon bias correction" | |
| } | |
| ], | |
| "label": "Minimum DP_ALT required after amplicon bias correction", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 2172.34375, | |
| "top": 117.796875 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 10, \"parameter_type\": \"integer\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "07e46388-c546-4425-8702-caf5d19667c1", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy1", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "single_paired|paired_input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool fastp", | |
| "name": "single_paired" | |
| } | |
| ], | |
| "label": null, | |
| "name": "fastp", | |
| "outputs": [ | |
| { | |
| "name": "output_paired_coll", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "report_html", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "report_json", | |
| "type": "json" | |
| } | |
| ], | |
| "position": { | |
| "left": 217.765625, | |
| "top": 618.734375 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionreport_json": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "report_json" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "d60c3f704da0", | |
| "name": "fastp", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_options\": {\"quality_filtering_options\": {\"disable_quality_filtering\": false, \"qualified_quality_phred\": null, \"unqualified_percent_limit\": null, \"n_base_limit\": null}, \"length_filtering_options\": {\"disable_length_filtering\": false, \"length_required\": null, \"length_limit\": null}, \"low_complexity_filter\": {\"enable_low_complexity_filter\": false, \"complexity_threshold\": null}}, \"output_options\": {\"report_html\": true, \"report_json\": true}, \"overrepresented_sequence_analysis\": {\"overrepresentation_analysis\": false, \"overrepresentation_sampling\": null}, \"read_mod_options\": {\"polyg_tail_trimming\": {\"trimming_select\": \"\", \"__current_case__\": 1, \"poly_g_min_len\": null}, \"polyx_tail_trimming\": {\"polyx_trimming_select\": \"\", \"__current_case__\": 1}, \"umi_processing\": {\"umi\": false, \"umi_loc\": \"\", \"umi_len\": null, \"umi_prefix\": \"\"}, \"cutting_by_quality_options\": {\"cut_by_quality5\": false, \"cut_by_quality3\": false, \"cut_window_size\": null, \"cut_mean_quality\": null}, \"base_correction_options\": {\"correction\": false}}, \"single_paired\": {\"single_paired_selector\": \"paired_collection\", \"__current_case__\": 2, \"paired_input\": {\"__class__\": \"ConnectedValue\"}, \"adapter_trimming_options\": {\"disable_adapter_trimming\": false, \"adapter_sequence1\": \"\", \"adapter_sequence2\": \"\", \"detect_adapter_for_pe\": false}, \"global_trimming_options\": {\"trim_front1\": null, \"trim_tail1\": null, \"trim_front2\": null, \"trim_tail2\": null}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.23.4+galaxy1", | |
| "type": "tool", | |
| "uuid": "849d9cac-14b8-4e45-823d-5747709e8b60", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "fastp_html_report", | |
| "output_name": "report_html", | |
| "uuid": "341566b1-181a-4bb0-9d0f-37db45003b22" | |
| }, | |
| { | |
| "label": "fastp_json_report", | |
| "output_name": "report_json", | |
| "uuid": "04955ac5-df51-41ff-bd19-a0a99c7ef761" | |
| }, | |
| { | |
| "label": "fastp_reads_output", | |
| "output_name": "output_paired_coll", | |
| "uuid": "8685689a-fbae-4a3e-b88b-7b4d212bafde" | |
| } | |
| ] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 4, | |
| "output_name": "output" | |
| }, | |
| "components_3|param_type|component_value": { | |
| "id": 5, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 1331.390625, | |
| "top": 45.046875 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"( ( DP4[2] + DP4[3] ) >= ( \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" * DP ) ) & ( ( DP4[2] + DP4[3] ) <= ( \"}}, {\"__index__\": 3, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" * DP ) )\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "d163b9b9-ee13-4b2b-8d64-b6d77758fac9", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 6, | |
| "output_name": "output" | |
| }, | |
| "components_3|param_type|component_value": { | |
| "id": 7, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 2400.96875, | |
| "top": 39.765625 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"( DP > \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" ) & ( ( AF * DP ) >= ( \"}}, {\"__index__\": 3, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" - 0.5 ) )\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "258a1a99-145b-42a0-b858-5220b4199946", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "fastq_input|fastq_input1": { | |
| "id": 8, | |
| "output_name": "output_paired_coll" | |
| }, | |
| "reference_source|ref_file": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Map with BWA-MEM", | |
| "name": "fastq_input" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Map with BWA-MEM", | |
| "name": "reference_source" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Map with BWA-MEM", | |
| "outputs": [ | |
| { | |
| "name": "bam_output", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 455.09375, | |
| "top": 352.5625 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188dc7a68e6", | |
| "name": "bwa", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": \"\"}, \"output_sort\": \"coordinate\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.7.17.2", | |
| "type": "tool", | |
| "uuid": "3b5d7080-c168-4bf7-946d-9045c0a4bc4c", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "mapped_reads", | |
| "output_name": "bam_output", | |
| "uuid": "d9641fec-7639-47c3-881f-74165e0b5889" | |
| } | |
| ] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "input": { | |
| "id": 11, | |
| "output_name": "bam_output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Samtools view", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputsam", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 664.6875, | |
| "top": 569.921875 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutputsam": { | |
| "action_arguments": { | |
| "newname": "Mapped read pairs (filtered bwa-mem result)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "6be888be75f9", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"quality\": \"20\", \"library\": \"\", \"cigarcons\": null, \"inclusive_filter\": [\"1\"], \"exclusive_filter\": [\"4\", \"8\", \"256\"], \"exclusive_filter_all\": null, \"tag\": null, \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"fraction\", \"__current_case__\": 0, \"factor\": \"1.0\", \"seed\": null}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": false, \"adv_output\": {\"readtags\": [], \"collapsecigar\": false}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.15.1+galaxy2", | |
| "type": "tool", | |
| "uuid": "2f7744df-3811-4b7f-8f1f-cf8bf0ec7a0b", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "filtered_mapped_reads", | |
| "output_name": "outputsam", | |
| "uuid": "1f75f9a7-8793-4c9e-b64d-5219a1e266db" | |
| } | |
| ] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "reads": { | |
| "id": 12, | |
| "output_name": "outputsam" | |
| }, | |
| "reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Realign reads", | |
| "name": "reads" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Realign reads", | |
| "name": "reference_source" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Realign reads", | |
| "outputs": [ | |
| { | |
| "name": "realigned", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 893.5, | |
| "top": 616.53125 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "aa35ee7f3ab2", | |
| "name": "lofreq_viterbi", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv_options\": {\"keepflags\": false, \"bq2_handling\": {\"replace_bq2\": \"keep\", \"__current_case__\": 0, \"defqual\": \"2\"}}, \"reads\": {\"__class__\": \"ConnectedValue\"}, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy0", | |
| "type": "tool", | |
| "uuid": "67b3fe84-0164-4494-9cfc-0bd0c86d7a2a", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "realigned_primer_trimmed_filtered_mapped_reads", | |
| "output_name": "realigned", | |
| "uuid": "a9186bec-17b7-4993-89d8-dcaf5a0f89a9" | |
| } | |
| ] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.5", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "input": { | |
| "id": 12, | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Samtools stats", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Samtools stats", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 918.8125, | |
| "top": 922.90625 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.5", | |
| "tool_shed_repository": { | |
| "changeset_revision": "fed4aa48ba09", | |
| "name": "samtools_stats", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cov_threshold\": null, \"coverage_cond\": {\"coverage_select\": \"no\", \"__current_case__\": 0}, \"filter_by_flags\": {\"filter_flags\": \"nofilter\", \"__current_case__\": 1}, \"gc_depth\": null, \"input\": {\"__class__\": \"ConnectedValue\"}, \"insert_size\": null, \"most_inserts\": null, \"read_group\": null, \"read_length\": null, \"remove_dups\": false, \"remove_overlaps\": false, \"sparse\": false, \"split_output_cond\": {\"split_output_selector\": \"no\", \"__current_case__\": 0}, \"trim_quality\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.0.5", | |
| "type": "tool", | |
| "uuid": "271efb08-46c0-4801-9869-b9948dfdebb4", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "mapped_reads_stats", | |
| "output_name": "output", | |
| "uuid": "7d923dc5-84b5-4f32-90ce-5d97b87ec3e1" | |
| } | |
| ] | |
| }, | |
| "15": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1", | |
| "errors": null, | |
| "id": 15, | |
| "input_connections": { | |
| "reads": { | |
| "id": 13, | |
| "output_name": "realigned" | |
| }, | |
| "strategy|reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Insert indel qualities", | |
| "name": "reads" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Insert indel qualities", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 1122.875, | |
| "top": 618.046875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "971e07ca4456", | |
| "name": "lofreq_indelqual", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"reads\": {\"__class__\": \"ConnectedValue\"}, \"strategy\": {\"selector\": \"dindel\", \"__current_case__\": 1, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy1", | |
| "type": "tool", | |
| "uuid": "70897728-2744-4a82-9b7d-38190594fec6", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "realigned_primer_trimmed_filtered_mapped_reads_with_indel_quals", | |
| "output_name": "output", | |
| "uuid": "a3c94ad6-de7b-4b2f-8374-34c5bbff7d55" | |
| } | |
| ] | |
| }, | |
| "16": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.4.2+galaxy0", | |
| "errors": null, | |
| "id": 16, | |
| "input_connections": { | |
| "amplicons|amplicon_info": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "input_bam": { | |
| "id": 15, | |
| "output_name": "output" | |
| }, | |
| "primer|input_bed": { | |
| "id": 2, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool ivar trim", | |
| "name": "amplicons" | |
| }, | |
| { | |
| "description": "runtime parameter for tool ivar trim", | |
| "name": "input_bam" | |
| }, | |
| { | |
| "description": "runtime parameter for tool ivar trim", | |
| "name": "primer" | |
| } | |
| ], | |
| "label": null, | |
| "name": "ivar trim", | |
| "outputs": [ | |
| { | |
| "name": "output_bam", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 1325.6875, | |
| "top": 364.9375 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput_bam": { | |
| "action_arguments": { | |
| "newname": "Fully processed reads for variant calling (primer-trimmed, realigned reads with added indelquals)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_bam" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.4.2+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "0893a1dbb807", | |
| "name": "ivar_trim", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"amplicons\": {\"filter_by\": \"yes\", \"__current_case__\": 1, \"amplicon_info\": {\"__class__\": \"ConnectedValue\"}}, \"inc_primers\": true, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"min_len\": \"1\", \"min_qual\": \"0\", \"primer\": {\"source\": \"history\", \"__current_case__\": 0, \"input_bed\": {\"__class__\": \"ConnectedValue\"}}, \"primer_pos_wiggle\": \"0\", \"trimmed_length\": {\"filter\": \"auto\", \"__current_case__\": 1}, \"window_width\": \"4\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.4.2+galaxy0", | |
| "type": "tool", | |
| "uuid": "7730e635-853f-4f9f-9451-bffbe6aedd15", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "primer_trimmed_filtered_mapped_reads", | |
| "output_name": "output_bam", | |
| "uuid": "a03a0ced-394c-4b52-ab17-e596ed15469d" | |
| } | |
| ] | |
| }, | |
| "17": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2", | |
| "errors": null, | |
| "id": 17, | |
| "input_connections": { | |
| "reads": { | |
| "id": 16, | |
| "output_name": "output_bam" | |
| }, | |
| "reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Call variants", | |
| "name": "reads" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Call variants", | |
| "name": "reference_source" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Call variants", | |
| "outputs": [ | |
| { | |
| "name": "variants", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 1560.453125, | |
| "top": 527.5 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4805fe3d8fda", | |
| "name": "lofreq_call", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"call_control\": {\"set_call_options\": \"yes\", \"__current_case__\": 1, \"coverage\": {\"min_cov\": \"5\", \"max_depth\": \"1000000\"}, \"pe\": {\"use_orphan\": false}, \"bc_quals\": {\"min_bq\": \"30\", \"min_alt_bq\": \"30\", \"alt_bq\": {\"modify\": \"\", \"__current_case__\": 0}}, \"align_quals\": {\"alnqual\": {\"use_alnqual\": \"\", \"__current_case__\": 0, \"alnqual_choice\": {\"alnquals_to_use\": \"\", \"__current_case__\": 1, \"extended_baq\": true}}}, \"map_quals\": {\"min_mq\": \"20\", \"use_mq\": {\"no_mq\": \"\", \"__current_case__\": 0, \"max_mq\": \"255\"}}, \"source_qual\": {\"use_src_qual\": {\"src_qual\": \"\", \"__current_case__\": 0}}, \"joint_qual\": {\"min_jq\": \"0\", \"min_alt_jq\": \"0\", \"def_alt_jq\": \"0\"}}, \"filter_control\": {\"filter_type\": \"set_custom\", \"__current_case__\": 3, \"sig\": \"0.0005\", \"bonf\": \"0\", \"others\": false}, \"reads\": {\"__class__\": \"ConnectedValue\"}, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}, \"regions\": {\"restrict_to_region\": \"genome\", \"__current_case__\": 0}, \"variant_types\": \"--call-indels\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy2", | |
| "type": "tool", | |
| "uuid": "422c7955-7768-4745-95db-b6882f37cd4b", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "preliminary_variants_1", | |
| "output_name": "variants", | |
| "uuid": "f4a5e53e-f13e-419d-b729-a5177022406e" | |
| } | |
| ] | |
| }, | |
| "18": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3", | |
| "errors": null, | |
| "id": 18, | |
| "input_connections": { | |
| "input1": { | |
| "id": 16, | |
| "output_name": "output_bam" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool QualiMap BamQC", | |
| "name": "input1" | |
| } | |
| ], | |
| "label": null, | |
| "name": "QualiMap BamQC", | |
| "outputs": [ | |
| { | |
| "name": "raw_data", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "output_html", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 1497.5625, | |
| "top": 772.0 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "19ece8afbaab", | |
| "name": "qualimap_bamqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"duplicate_skipping\": [\"0\"], \"input1\": {\"__class__\": \"ConnectedValue\"}, \"per_base_coverage\": false, \"plot_specific\": {\"n_bins\": \"400\", \"paint_chromosome_limits\": true, \"genome_gc_distr\": null, \"homopolymer_size\": \"3\"}, \"stats_regions\": {\"region_select\": \"all\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.2d+galaxy3", | |
| "type": "tool", | |
| "uuid": "e2c69f7d-e6fd-4c9a-bbfd-05b70e5b2129", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "bamqc_raw_output", | |
| "output_name": "raw_data", | |
| "uuid": "cd94a67a-edb4-4f54-b71a-ba6c138c8e1a" | |
| }, | |
| { | |
| "label": "bamqc_html_output", | |
| "output_name": "output_html", | |
| "uuid": "2358cbeb-7bfc-434a-9b5e-decc2021cd8f" | |
| } | |
| ] | |
| }, | |
| "19": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "errors": null, | |
| "id": 19, | |
| "input_connections": { | |
| "filter_expression|expr": { | |
| "id": 9, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 17, | |
| "output_name": "variants" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "filter_expression" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "SnpSift Filter", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 1753.1875, | |
| "top": 326.265625 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": {\"__class__\": \"ConnectedValue\"}}, \"filtering\": {\"mode\": \"entries\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy1", | |
| "type": "tool", | |
| "uuid": "a2b784b0-28c1-45e3-93b8-d1d9d598de01", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "filtered_preliminary_variants", | |
| "output_name": "output", | |
| "uuid": "f0948734-a0aa-4dfe-938f-98b63293898c" | |
| } | |
| ] | |
| }, | |
| "20": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "errors": null, | |
| "id": 20, | |
| "input_connections": { | |
| "filter_expression|expr": { | |
| "id": 10, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 17, | |
| "output_name": "variants" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "filter_expression" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "SnpSift Filter", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 2648.703125, | |
| "top": 531.546875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": {\"__class__\": \"ConnectedValue\"}}, \"filtering\": {\"mode\": \"entries\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy1", | |
| "type": "tool", | |
| "uuid": "b96f89fd-30c1-4e70-ae70-ca37121e3c61", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "preliminary_variants_1_filtered", | |
| "output_name": "output", | |
| "uuid": "e9c3d008-71df-43b6-919a-c482fc0572ee" | |
| } | |
| ] | |
| }, | |
| "21": { | |
| "annotation": "", | |
| "content_id": "__FILTER_FAILED_DATASETS__", | |
| "errors": null, | |
| "id": 21, | |
| "input_connections": { | |
| "input": { | |
| "id": 18, | |
| "output_name": "raw_data" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Filter failed datasets", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Filter failed datasets", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1730.21875, | |
| "top": 783.796875 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "__FILTER_FAILED_DATASETS__", | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "e4e04a37-f4bf-41d7-9470-5c96125ebc49", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "22": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/ivar_removereads/1.4.2+galaxy0", | |
| "errors": null, | |
| "id": 22, | |
| "input_connections": { | |
| "amplicons|amplicon_info": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "input_bam": { | |
| "id": 16, | |
| "output_name": "output_bam" | |
| }, | |
| "input_bed": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "variants_tsv": { | |
| "id": 19, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool ivar removereads", | |
| "name": "amplicons" | |
| }, | |
| { | |
| "description": "runtime parameter for tool ivar removereads", | |
| "name": "input_bam" | |
| }, | |
| { | |
| "description": "runtime parameter for tool ivar removereads", | |
| "name": "input_bed" | |
| }, | |
| { | |
| "description": "runtime parameter for tool ivar removereads", | |
| "name": "variants_tsv" | |
| } | |
| ], | |
| "label": null, | |
| "name": "ivar removereads", | |
| "outputs": [ | |
| { | |
| "name": "output_bam", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 1949.546875, | |
| "top": 48.96875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/ivar_removereads/1.4.2+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "69797fa273c3", | |
| "name": "ivar_removereads", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"amplicons\": {\"computed\": \"no\", \"__current_case__\": 1, \"amplicon_info\": {\"__class__\": \"ConnectedValue\"}}, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"input_bed\": {\"__class__\": \"ConnectedValue\"}, \"variants_tsv\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.4.2+galaxy0", | |
| "type": "tool", | |
| "uuid": "af7d3b75-d16c-43c7-82e4-3f1388edd22c", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "amplicon_removal_output", | |
| "output_name": "output_bam", | |
| "uuid": "abe39037-7f89-4b93-9431-b0287bcee2d6" | |
| } | |
| ] | |
| }, | |
| "23": { | |
| "annotation": "", | |
| "content_id": "__FLATTEN__", | |
| "errors": null, | |
| "id": 23, | |
| "input_connections": { | |
| "input": { | |
| "id": 21, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Flatten collection", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Flatten collection", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1955.65625, | |
| "top": 789.5 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "__FLATTEN__", | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"join_identifier\": \"_\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "396c9b85-8ec7-405a-a742-5b47e40cf0de", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "bamqc_raw_output_flattened", | |
| "output_name": "output", | |
| "uuid": "b3942cb8-ac12-4b37-88d2-6c25dc58b636" | |
| } | |
| ] | |
| }, | |
| "24": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2", | |
| "errors": null, | |
| "id": 24, | |
| "input_connections": { | |
| "reads": { | |
| "id": 22, | |
| "output_name": "output_bam" | |
| }, | |
| "reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Call variants", | |
| "name": "reads" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Call variants", | |
| "name": "reference_source" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Call variants", | |
| "outputs": [ | |
| { | |
| "name": "variants", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 2204.984375, | |
| "top": 334.296875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4805fe3d8fda", | |
| "name": "lofreq_call", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"call_control\": {\"set_call_options\": \"yes\", \"__current_case__\": 1, \"coverage\": {\"min_cov\": \"5\", \"max_depth\": \"1000000\"}, \"pe\": {\"use_orphan\": false}, \"bc_quals\": {\"min_bq\": \"30\", \"min_alt_bq\": \"30\", \"alt_bq\": {\"modify\": \"\", \"__current_case__\": 0}}, \"align_quals\": {\"alnqual\": {\"use_alnqual\": \"\", \"__current_case__\": 0, \"alnqual_choice\": {\"alnquals_to_use\": \"\", \"__current_case__\": 1, \"extended_baq\": true}}}, \"map_quals\": {\"min_mq\": \"20\", \"use_mq\": {\"no_mq\": \"\", \"__current_case__\": 0, \"max_mq\": \"255\"}}, \"source_qual\": {\"use_src_qual\": {\"src_qual\": \"\", \"__current_case__\": 0}}, \"joint_qual\": {\"min_jq\": \"0\", \"min_alt_jq\": \"0\", \"def_alt_jq\": \"0\"}}, \"filter_control\": {\"filter_type\": \"set_custom\", \"__current_case__\": 3, \"sig\": \"0.0005\", \"bonf\": \"0\", \"others\": false}, \"reads\": {\"__class__\": \"ConnectedValue\"}, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}, \"regions\": {\"restrict_to_region\": \"genome\", \"__current_case__\": 0}, \"variant_types\": \"--call-indels\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy2", | |
| "type": "tool", | |
| "uuid": "bef93d5b-c023-459c-888c-ac3382515322", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "preliminary_variants_2", | |
| "output_name": "variants", | |
| "uuid": "6a59b687-340f-4ef6-b908-31fd69bd081e" | |
| } | |
| ] | |
| }, | |
| "25": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", | |
| "errors": null, | |
| "id": 25, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 8, | |
| "output_name": "report_json" | |
| }, | |
| "results_1|software_cond|output_0|type|input": { | |
| "id": 14, | |
| "output_name": "output" | |
| }, | |
| "results_2|software_cond|input": { | |
| "id": 23, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "stats", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "plots", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 2186.515625, | |
| "top": 925.765625 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionstats": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "stats" | |
| }, | |
| "RenameDatasetActionhtml_report": { | |
| "action_arguments": { | |
| "newname": "Preprocessing and mapping reports" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "html_report" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "abfd8a6544d7", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastp\", \"__current_case__\": 7, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 24, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"stats\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"qualimap\", \"__current_case__\": 20, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.11+galaxy1", | |
| "type": "tool", | |
| "uuid": "ee2b164f-213b-4d95-9ab7-febdf5a71085", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "preprocessing_and_mapping_reports", | |
| "output_name": "html_report", | |
| "uuid": "935dfa12-2c9a-4e44-85fa-a2daa3e04683" | |
| }, | |
| { | |
| "label": "preprocessing_and_mapping_plots", | |
| "output_name": "plots", | |
| "uuid": "97cbd06a-8be5-4e1f-802b-7928c94de928" | |
| } | |
| ] | |
| }, | |
| "26": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.15.1+galaxy3", | |
| "errors": null, | |
| "id": 26, | |
| "input_connections": { | |
| "input_file": { | |
| "id": 17, | |
| "output_name": "variants" | |
| }, | |
| "sec_annofile|annofile|annotations": { | |
| "id": 24, | |
| "output_name": "variants" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "input_file" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "sec_annotate" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "sec_annotate" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "sec_restrict" | |
| } | |
| ], | |
| "label": null, | |
| "name": "bcftools annotate", | |
| "outputs": [ | |
| { | |
| "name": "output_file", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 2409.21875, | |
| "top": 689.4375 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.15.1+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3f62d4939d54", | |
| "name": "bcftools_annotate", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"output_type\": \"v\", \"sec_annofile\": {\"columns\": \"QUAL,INFO\", \"annofile\": {\"anno_fmt\": \"vcf\", \"__current_case__\": 1, \"annotations\": {\"__class__\": \"ConnectedValue\"}}, \"mark_sites\": \"-AmpliconBias\", \"min_overlap\": \"\", \"set_id\": \"\"}, \"sec_annotate\": {\"remove\": \"\", \"rename_chrs\": {\"__class__\": \"RuntimeValue\"}, \"rename_annots\": {\"__class__\": \"RuntimeValue\"}}, \"sec_restrict\": {\"include\": \"\", \"exclude\": \"\", \"collapse\": null, \"regions\": {\"regions_src\": \"__none__\", \"__current_case__\": 0}, \"regions_overlap\": null, \"samples\": \"\", \"invert_samples\": false, \"samples_file\": {\"__class__\": \"RuntimeValue\"}, \"invert_samples_file\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.15.1+galaxy3", | |
| "type": "tool", | |
| "uuid": "c466b7da-f50c-4093-9eb5-c014ba41c1b8", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "variants_fixed_partial", | |
| "output_name": "output_file", | |
| "uuid": "7c918bc9-7234-497c-9349-e977bc261510" | |
| } | |
| ] | |
| }, | |
| "27": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "errors": null, | |
| "id": 27, | |
| "input_connections": { | |
| "filter_expression|expr": { | |
| "id": 10, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 24, | |
| "output_name": "variants" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "filter_expression" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "SnpSift Filter", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 2655.703125, | |
| "top": 349.046875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": {\"__class__\": \"ConnectedValue\"}}, \"filtering\": {\"mode\": \"entries\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy1", | |
| "type": "tool", | |
| "uuid": "c3d5ad01-385e-4405-bdc1-51f01dee4071", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "preliminary_variants_2_filtered", | |
| "output_name": "output", | |
| "uuid": "b7f7c28f-1a7c-4098-bb84-b82fbfea2321" | |
| } | |
| ] | |
| }, | |
| "28": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/vcfvcfintersect/vcfvcfintersect/1.0.0_rc3+galaxy0", | |
| "errors": null, | |
| "id": 28, | |
| "input_connections": { | |
| "reference_source|ref_file": { | |
| "id": 1, | |
| "output_name": "output" | |
| }, | |
| "vcf_input1": { | |
| "id": 27, | |
| "output_name": "output" | |
| }, | |
| "vcf_input2": { | |
| "id": 20, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool VCF-VCFintersect:", | |
| "name": "reference_source" | |
| }, | |
| { | |
| "description": "runtime parameter for tool VCF-VCFintersect:", | |
| "name": "vcf_input1" | |
| }, | |
| { | |
| "description": "runtime parameter for tool VCF-VCFintersect:", | |
| "name": "vcf_input2" | |
| } | |
| ], | |
| "label": null, | |
| "name": "VCF-VCFintersect:", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 2885.859375, | |
| "top": 501.0 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/vcfvcfintersect/vcfvcfintersect/1.0.0_rc3+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "166c4f50525f", | |
| "name": "vcfvcfintersect", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv_options\": {\"adv_options_selector\": \"no\", \"__current_case__\": 0}, \"invert\": true, \"isect_union\": \"-i\", \"loci\": false, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"vcf_input1\": {\"__class__\": \"ConnectedValue\"}, \"vcf_input2\": {\"__class__\": \"ConnectedValue\"}, \"window_size\": \"0\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0_rc3+galaxy0", | |
| "type": "tool", | |
| "uuid": "816eeae7-4ad5-4f2d-b709-285931d2be4b", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "lost_filter_passing_variants", | |
| "output_name": "out_file1", | |
| "uuid": "2b336081-1278-4a1d-9991-58d0d33adfcf" | |
| } | |
| ] | |
| }, | |
| "29": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.15.1+galaxy3", | |
| "errors": null, | |
| "id": 29, | |
| "input_connections": { | |
| "input_file": { | |
| "id": 26, | |
| "output_name": "output_file" | |
| }, | |
| "sec_annofile|annofile|annotations": { | |
| "id": 28, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "input_file" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "sec_annotate" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "sec_annotate" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "sec_restrict" | |
| } | |
| ], | |
| "label": null, | |
| "name": "bcftools annotate", | |
| "outputs": [ | |
| { | |
| "name": "output_file", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 3112.953125, | |
| "top": 656.28125 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.15.1+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3f62d4939d54", | |
| "name": "bcftools_annotate", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"output_type\": \"v\", \"sec_annofile\": {\"columns\": \"QUAL,INFO\", \"annofile\": {\"anno_fmt\": \"vcf\", \"__current_case__\": 1, \"annotations\": {\"__class__\": \"ConnectedValue\"}}, \"mark_sites\": \"+AmpliconBias\", \"min_overlap\": \"\", \"set_id\": \"\"}, \"sec_annotate\": {\"remove\": \"\", \"rename_chrs\": {\"__class__\": \"RuntimeValue\"}, \"rename_annots\": {\"__class__\": \"RuntimeValue\"}}, \"sec_restrict\": {\"include\": \"\", \"exclude\": \"\", \"collapse\": null, \"regions\": {\"regions_src\": \"__none__\", \"__current_case__\": 0}, \"regions_overlap\": null, \"samples\": \"\", \"invert_samples\": false, \"samples_file\": {\"__class__\": \"RuntimeValue\"}, \"invert_samples_file\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.15.1+galaxy3", | |
| "type": "tool", | |
| "uuid": "c466b7da-f50c-4093-9eb5-c014ba41c1b7", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "variants_fixed", | |
| "output_name": "output_file", | |
| "uuid": "d06d1e97-0016-48f7-9f93-4d68a0d99dde" | |
| } | |
| ] | |
| }, | |
| "30": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1", | |
| "errors": null, | |
| "id": 30, | |
| "input_connections": { | |
| "infile": { | |
| "id": 29, | |
| "output_name": "output_file" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Replace Text", | |
| "name": "infile" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Replace Text", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3338.28125, | |
| "top": 745.546875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \"^##INFO=<ID=AmpliconBias,.+$\", \"replace_pattern\": \"##INFO=<ID=AmpliconBias,Number=0,Type=Flag,Description=\\\"Indicates that the AF value of the variant could not be corrected for potential amplicon bias.\\\">\"}, {\"__index__\": 1, \"find_pattern\": \"^##INFO=<ID=AF,.+$\", \"replace_pattern\": \"##INFO=<ID=AF,Number=1,Type=Float,Description=\\\"Lofreq Allele Frequency; Fraction of variant-supporting bases with q > --min-bq among all bases at the site\\\">\"}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "490dbabb-04ee-426d-a8e5-e2ec9e59de3a", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "variants_fixed_header", | |
| "output_name": "outfile", | |
| "uuid": "d96147a4-6d8b-426f-9c51-f77efc81a08b" | |
| } | |
| ] | |
| }, | |
| "31": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "errors": null, | |
| "id": 31, | |
| "input_connections": { | |
| "input": { | |
| "id": 30, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "input" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "intervals" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "transcripts" | |
| } | |
| ], | |
| "label": "SnpEff eff covid19 version", | |
| "name": "SnpEff eff:", | |
| "outputs": [ | |
| { | |
| "name": "snpeff_output", | |
| "type": "vcf" | |
| }, | |
| { | |
| "name": "statsFile", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 3566.25, | |
| "top": 598.96875 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionsnpeff_output": { | |
| "action_arguments": { | |
| "newname": "Final (SnpEff-) annotated variants" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "snpeff_output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2a3a00c1fa0a", | |
| "name": "snpeff_sars_cov_2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"annotations\": [\"-formatEff\", \"-classic\"], \"chr\": \"\", \"csvStats\": false, \"filter\": {\"specificEffects\": \"no\", \"__current_case__\": 0}, \"filterOut\": [\"-no-downstream\", \"-no-intergenic\", \"-no-upstream\"], \"generate_stats\": true, \"genome_version\": \"NC_045512.2\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"inputFormat\": \"vcf\", \"intervals\": {\"__class__\": \"RuntimeValue\"}, \"noLog\": true, \"offset\": \"default\", \"outputConditional\": {\"outputFormat\": \"vcf\", \"__current_case__\": 0}, \"transcripts\": {\"__class__\": \"RuntimeValue\"}, \"udLength\": \"0\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.5covid19", | |
| "type": "tool", | |
| "uuid": "a6b0b8e1-a914-4f59-95d4-87fc47ed4171", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "annotated_variants", | |
| "output_name": "snpeff_output", | |
| "uuid": "ded982f4-601c-4d3c-888d-92716a47bb5c" | |
| }, | |
| { | |
| "label": "annotated_variants_stats", | |
| "output_name": "statsFile", | |
| "uuid": "890819cb-f5a8-416d-a6f7-39a448fd2cd4" | |
| } | |
| ] | |
| }, | |
| "32": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0", | |
| "errors": null, | |
| "id": 32, | |
| "input_connections": { | |
| "invcf": { | |
| "id": 31, | |
| "output_name": "snpeff_output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Lofreq filter", | |
| "name": "invcf" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Lofreq filter", | |
| "outputs": [ | |
| { | |
| "name": "outvcf", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 3802.5, | |
| "top": 614.625 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutvcf": { | |
| "action_arguments": { | |
| "newname": "Final (SnpEff-) annotated variants with strand-bias soft filter applied" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outvcf" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "7dfca164d2e3", | |
| "name": "lofreq_filter", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"af\": {\"af_min\": \"0.0\", \"af_max\": \"0.0\"}, \"coverage\": {\"cov_min\": \"0\", \"cov_max\": \"0\"}, \"filter_by_type\": {\"keep_only\": \"\", \"__current_case__\": 0, \"qual\": {\"snvqual_filter\": {\"snvqual\": \"no\", \"__current_case__\": 0}, \"indelqual_filter\": {\"indelqual\": \"no\", \"__current_case__\": 0}}}, \"flag_or_drop\": \"--print-all\", \"invcf\": {\"__class__\": \"ConnectedValue\"}, \"sb\": {\"sb_filter\": {\"strand_bias\": \"mtc\", \"__current_case__\": 2, \"sb_alpha\": \"0.001\", \"sb_mtc\": \"fdr\", \"sb_compound\": true, \"sb_indels\": false}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy0", | |
| "type": "tool", | |
| "uuid": "4c9e8621-e930-4593-b0be-d84304f86ad4", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "annotated_softfiltered_variants", | |
| "output_name": "outvcf", | |
| "uuid": "7af82fbc-67e3-46ca-9b17-95de59de8cf5" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "COVID-19", | |
| "ARTIC", | |
| "covid19.galaxyproject.org" | |
| ], | |
| "uuid": "864427b0-d25a-499c-b437-f83f2d6b83f2" | |
| }, | |
| "updated": "2024-12-03T18:32:54.040098", | |
| "readme": "COVID-19: variation analysis on ARTIC PE data\n---------------------------------------------\n\nThe workflow for Illumina-sequenced ampliconic data builds on the RNASeq workflow\nfor paired-end data using the same steps for mapping and variant calling, but\nadds extra logic for trimming amplicon primer sequences off reads with the ivar\npackage. In addition, this workflow uses ivar also to identify amplicons\naffected by primer-binding site mutations and, if possible, excludes reads\nderived from such \"tainted\" amplicons when calculating allele-frequencies\nof other variants.\n", | |
| "changelog": "# Changelog\n\n## [0.5.3] 2024-10-01\n\n### Tool updates\n\n- `toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy0` updated to `toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy0` updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1`\n\n## [0.5.2] 2024-03-05\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.9+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2`\n- `toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.2+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.5`\n- `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.3.1+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.4.2+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2c+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/ivar_removereads/1.3.1+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/ivar_removereads/1.4.2+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.10` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.15.1+galaxy3`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/1.1.2` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy0`\n\n## [0.5.1] 2023-11-20\n\n- Fix author in dockstore\n- Use zenodo link instead of googleapis for fastq in test\n- Update output test\n\n## [0.5] - 2022-02-08\n\n### Fixed\n\n- Base selection of variants that should trigger amplicon removal on unbiased\n AF values recalculated from DP4 and DP fields instead of on AF values\n provided by lofreq call.\n\n https://github.com/CSB5/lofreq/issues/80 means that lofreq-calculated AF\n values are lower bounds of true AFs when bases are excluded from calling\n based on base quality. The extent of AF underestimation depends on the\n fraction of bases with sub-threshold (30 for this workflow) base qualities.\n\n By recalculating AFs as (DP4[2] + DP4[3]) / DP we are avoiding this issue.\n From this version on we also add a proper description to the header INFO\n line description of the AF field to be explicit about the meaning of lofreq's\n AF value.\n\n### Changed\n\n- Increase/deactivate the default upper AF threshold for biased amplicon detection\n\n By increasing the default AF threshold to 1.0 amplicon removal now gets\n triggered by default for all primer binding site mutations with unbiased\n (see AF discussion above) AF > 0.1.\n\n This change is intended to allow removal of amplicons resulting from even\n trace amounts of contamination when the intended target of the amplicon\n primers drops out because of mutations severely impacting primer binding.\n The expectation is that this would either remove contamination-contributed\n variants (like contributed by traces of delta virus in omicron preparations\n in omicron-triggered amplicon dropout regions), or at least cause them\n getting flagged as AmpliconBias calls at the VCF level.\n The exact consequences of this change need to be evaluated, but users can\n restore the previous behavior by reducing the upper AF threshold back to 0.9,\n which will reduce the extent of attempted amplicon removals substantially.\n\n- Make the amplicon bias correction more robust and better interoperable with\n the [Reporting workflow](https://github.com/iwc-workflows/sars-cov-2-variation-reporting).\n\n First and second (after amplicon removal) round of variant calling are now\n carried out with identical lofreq parameter settings.\n bcftools annotate is then used to carry over the bias-corrected call stats to\n the variant calls obtained in the first round. At the same time, both variant\n call lists are filtered with identical DP and DP_ALT filters and stats of\n filter-passing variants from the first round that fail to pass those filters\n after the second round of calling aretransferred back to the initial\n bcftools annotate output.\n If the DP and DP_ALT thresholds are chosen as in the Reporting workflow (as\n is the case with the default settings), this ensures that no initially called\n variant gets lost as a consequence of amplicon bias correction and that no\n initially filter-passing variant gets filtered out after correction.\n The AmpliconBias INFO flag is used to mark all such variants, for which\n amplicon bias correction was skipped to rescue the call.\n\n- Upgrade the Galaxy wrapper versions of ivar trim and ivar removereads.\n\n This makes it easy for users to calculate primer amplicon info from suitable\n primer scheme bed files instead of passing the info as a separate file.\n This workflow sticks to the previous behavior to avoid new requirements on\n primer names.\n- Upgrade fastp to 0.23.2.\n This update restores plots contained in the tools html output, should\n provide better performance for compressed input data, but also has a moderate\n effect on trimming results.\n- Upgrade other tools to their latest versions or wrapper versions:\n\n - bwa_mem to wrapper version 0.7.17.2\n - lofreq_call to wrapper version 2.1.5+galaxy1\n - multiqc to version 1.11\n\n None of these are expected to change the variant output produced by the\n workflow.\n\n### Added\n\n- Add a step to filter out failed datasets before flattening the Qualimap BamQC\n data for use by MultiQC.\n\n Qualimap BamQC fails on empty BAM input and trying to flatten the resulting\n collection containing failed datasets would cause the invocation of the\n workflow to fail.\n\n## [0.4.2] 2021-12-13\n\n### Added\n\n- Added GitHub Actions workflow. No functional changes.\n\n## [0.4.1] 2021-07-23\n\n### Added\n\nAdded RO-Crate metadata file. No functional changes.\n\n## [0.4] - 2021-06-16\n\n### Changed\n\n- Upgrade multiqc to 1.9+galaxy1\n\n## [0.3] - 2021-05-19\n\n### Changed\n\nThis version brings a number of tweaks to the ivar-dependent steps of the\nworkflow. Together, these are expected to make variant allele frequency\ncalculations more precise, in general, and robust in the face of an increasing\nnumber of variants at primer binding sites:\n\n- Upgrade ivar from version 1.2.2 to 1.3.1\n This affects ivar trim and ivar removereads\n- Use the newly introduced -f option of ivar trim to exclude read pairs from\n further analysis that extend beyond amplicon boundaries.\n This change should be benefitial for accurate AF calculations in general,\n but in particular for corrected AF values after removal of biased amplicons,\n where aberrant read pairs often represent a larger fraction of the remaining\n reads.\n- Run ivar trim only after realignment and addition of indel qualities by\n lofeq. This should make sure that indels close to primer sequences are\n seen as read-internal events.\n- Turn the lower and upper thresholds for variant AF that triggers readremoval\n into workflow input parameters and adjust their defaults to trigger read\n removal only in more obvious cases of non-fixed variants.\n- Require a minimum depth of coverage for recalled variants after read removal\n of 20 to ensure reliable AF values.\n This change also prevents situations where variants are recalled successfully\n after read removal, but are later excluded from variant reports generated by\n the reporting workflow due to that workflow's min_dp_alt >= 10 filter.\n\n## [0.2]\n\n### Changed\n\n- Turn the AmpliconRemoval variant FILTER into an AmpliconBias INFO flag\n- Apply the strand-bias filter only after variant annotation with snpEff. By\n producing fully annotated VCFs with and without filtering, downstream\n workflows can easily be switched between filtered/unfiltered input data\n\n### Fixed\n\n- Make sure the header information about the added flag gets propagated to the\n final VCF\n\n## [0.1]\n\n- Initial version of COVID-19: variation analysis on ARTIC PE data workflow\n", | |
| "diagrams": "# Workflow diagrams\n\n## COVID-19: variation analysis on ARTIC PE data\n\n```mermaid\ngraph LR\n0[\"ℹ️ Paired Collection\"]@{ shape: docs }\n1[\"ℹ️ NC_045512.2 FASTA sequence of SARS-CoV-2\"]@{ shape: doc }\n2[\"ℹ️ ARTIC primer BED\"]@{ shape: doc }\n3[\"ℹ️ ARTIC primers to amplicon assignments\"]@{ shape: doc }\n4[\"ℹ️ Read removal minimum AF\"]@{ shape: lean-l }\n5[\"ℹ️ Read removal maximum AF\"]@{ shape: lean-l }\n6[\"ℹ️ Minimum DP required after amplicon bias correction\"]@{ shape: lean-l }\n7[\"ℹ️ Minimum DP_ALT required after amplicon bias correction\"]@{ shape: lean-l }\n8[\"fastp\"]@{ shape: process }\n0 --> 8\n9[\"Compose text parameter value\"]@{ shape: process }\n4 --> 9\n5 --> 9\n10[\"Compose text parameter value\"]@{ shape: process }\n6 --> 10\n7 --> 10\n11[\"Map with BWA-MEM\"]@{ shape: process }\n8 --> 11\n1 --> 11\n12[\"Samtools view\"]@{ shape: process }\n11 --> 12\n13[\"Realign reads\"]@{ shape: process }\n12 --> 13\n1 --> 13\n14[\"Samtools stats\"]@{ shape: process }\n12 --> 14\n15[\"Insert indel qualities\"]@{ shape: process }\n13 --> 15\n1 --> 15\n16[\"ivar trim\"]@{ shape: process }\n3 --> 16\n15 --> 16\n2 --> 16\n17[\"Call variants\"]@{ shape: process }\n16 --> 17\n1 --> 17\n18[\"QualiMap BamQC\"]@{ shape: process }\n16 --> 18\n19[\"SnpSift Filter\"]@{ shape: process }\n9 --> 19\n17 --> 19\n20[\"SnpSift Filter\"]@{ shape: process }\n10 --> 20\n17 --> 20\n21[\"Filter failed datasets\"]@{ shape: process }\n18 --> 21\n22[\"ivar removereads\"]@{ shape: process }\n3 --> 22\n16 --> 22\n2 --> 22\n19 --> 22\n23[\"Flatten collection\"]@{ shape: process }\n21 --> 23\n24[\"Call variants\"]@{ shape: process }\n22 --> 24\n1 --> 24\n25[\"MultiQC\"]@{ shape: process }\n8 --> 25\n14 --> 25\n23 --> 25\n26[\"bcftools annotate\"]@{ shape: process }\n17 --> 26\n24 --> 26\n27[\"SnpSift Filter\"]@{ shape: process }\n10 --> 27\n24 --> 27\n28[\"VCF-VCFintersect:\"]@{ shape: process }\n1 --> 28\n27 --> 28\n20 --> 28\n29[\"bcftools annotate\"]@{ shape: process }\n26 --> 29\n28 --> 29\n30[\"Replace Text\"]@{ shape: process }\n29 --> 30\n31[\"SnpEff eff covid19 version\"]@{ shape: process }\n30 --> 31\n32[\"Lofreq filter\"]@{ shape: process }\n31 --> 32\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/sars-cov-2-pe-illumina-artic-variant-calling/COVID-19-PE-ARTIC-ILLUMINA", | |
| "dockstore_id": 16247, | |
| "categories": [ | |
| "COVID-19" | |
| ], | |
| "collections": [ | |
| "SARS-COV-2" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test workflow execution using paired end illumina ARTIC accession", | |
| "job": { | |
| "NC_045512.2 FASTA sequence of SARS-CoV-2": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/4555735/files/NC_045512.2_reference.fasta?download=1", | |
| "filetype": "fasta" | |
| }, | |
| "ARTIC primer BED": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/4555735/files/ARTIC_nCoV-2019_v3.bed?download=1", | |
| "filetype": "bed" | |
| }, | |
| "ARTIC primers to amplicon assignments": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/4555735/files/ARTIC_amplicon_info_v3.tsv?download=1", | |
| "filetype": "tabular" | |
| }, | |
| "Paired Collection": { | |
| "class": "Collection", | |
| "collection_type": "list:paired", | |
| "elements": [ | |
| { | |
| "class": "Collection", | |
| "type": "paired", | |
| "identifier": "SRR11578257", | |
| "elements": [ | |
| { | |
| "identifier": "forward", | |
| "class": "File", | |
| "location": "https://zenodo.org/records/10174466/files/SRR11578257_R1.fastq.gz?download=1" | |
| }, | |
| { | |
| "identifier": "reverse", | |
| "class": "File", | |
| "location": "https://zenodo.org/records/10174466/files/SRR11578257_R2.fastq.gz?download=1" | |
| } | |
| ] | |
| } | |
| ] | |
| } | |
| }, | |
| "outputs": { | |
| "annotated_softfiltered_variants": { | |
| "attributes": {}, | |
| "element_tests": { | |
| "SRR11578257": { | |
| "asserts": { | |
| "has_line": { | |
| "line": "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO" | |
| }, | |
| "has_text_matching": { | |
| "expression": "NC_045512.2\t20209\t.\tAGTAGAAATT\tA\t[0-9]*\tPASS\tDP=[0-9]*;AF=0.9[0-9]*;SB=24;DP4=[0-9]*,[0-9]*,[0-9]*,[0-9]*;INDEL;HRUN=1;EFF=CODON_CHANGE_PLUS_CODON_DELETION\\(MODERATE||agtagaaattta/ata|SRNL6649I|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|A\\),CODON_CHANGE_PLUS_CODON_DELETION\\(MODERATE||agtagaaattta/ata|SRNL197I|345|ORF1ab|protein_coding|CODING|YP_009725310.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON\\)" | |
| } | |
| } | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "COVID-19-SE-WGS-ILLUMINA", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/se-wgs-variation.ga", | |
| "testParameterFiles": [ | |
| "/se-wgs-variation-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Wolfgang Maier", | |
| "orcid": "0000-0002-9464-6640" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflows performs single end read mapping with bowtie2 followed by sensitive variant calling across a wide range of AFs with lofreq", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-9464-6640", | |
| "name": "Wolfgang Maier" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "name": "COVID-19: variation analysis on WGS SE data", | |
| "release": "0.1.5", | |
| "steps": { | |
| "0": { | |
| "annotation": "Illumina reads with fastqsanger encoding", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Illumina reads with fastqsanger encoding", | |
| "name": "Single End Collection" | |
| } | |
| ], | |
| "label": "Single End Collection", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0.0, | |
| "top": 189.96875 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"fastqsanger\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "fac0f79d-54bd-4c26-b18e-2804067a6522", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Fasta sequence for Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Fasta sequence for Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome", | |
| "name": "NC_045512.2 FASTA sequence of SARS-CoV-2" | |
| } | |
| ], | |
| "label": "NC_045512.2 FASTA sequence of SARS-CoV-2", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 95.984375, | |
| "top": 601.984375 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"fasta\", \"fasta.gz\"], \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "c9a062f4-3154-47de-b482-d8168a70f939", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy0", | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": { | |
| "single_paired|in1": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool fastp", | |
| "name": "single_paired" | |
| } | |
| ], | |
| "label": null, | |
| "name": "fastp", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "report_html", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "report_json", | |
| "type": "json" | |
| } | |
| ], | |
| "position": { | |
| "left": 237.53125, | |
| "top": 0.0 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionreport_json": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "report_json" | |
| }, | |
| "RenameDatasetActionout1": { | |
| "action_arguments": { | |
| "newname": "Trimmed and quality-filtered reads (fastp result)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "c59d48774d03", | |
| "name": "fastp", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_options\": {\"quality_filtering_options\": {\"disable_quality_filtering\": false, \"qualified_quality_phred\": null, \"unqualified_percent_limit\": null, \"n_base_limit\": null}, \"length_filtering_options\": {\"disable_length_filtering\": false, \"length_required\": null, \"length_limit\": null}, \"low_complexity_filter\": {\"enable_low_complexity_filter\": false, \"complexity_threshold\": null}}, \"output_options\": {\"report_html\": true, \"report_json\": true}, \"overrepresented_sequence_analysis\": {\"overrepresentation_analysis\": false, \"overrepresentation_sampling\": null}, \"read_mod_options\": {\"polyg_tail_trimming\": {\"trimming_select\": \"\", \"__current_case__\": 1, \"poly_g_min_len\": null}, \"polyx_tail_trimming\": {\"polyx_trimming_select\": \"\", \"__current_case__\": 1}, \"umi_processing\": {\"umi\": false, \"umi_loc\": \"\", \"umi_len\": null, \"umi_prefix\": \"\"}, \"cutting_by_quality_options\": {\"cut_by_quality5\": false, \"cut_by_quality3\": false, \"cut_window_size\": null, \"cut_mean_quality\": null}, \"base_correction_options\": {\"correction\": false}}, \"single_paired\": {\"single_paired_selector\": \"single\", \"__current_case__\": 0, \"in1\": {\"__class__\": \"ConnectedValue\"}, \"adapter_trimming_options\": {\"disable_adapter_trimming\": false, \"adapter_sequence1\": \"\"}, \"global_trimming_options\": {\"trim_front1\": null, \"trim_tail1\": null}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.23.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "226bdff2-28d7-46ec-9a17-887d577056f6", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "preprocessed_reads", | |
| "output_name": "out1", | |
| "uuid": "21a2c281-bb1a-4632-9cdc-f67b7465041a" | |
| }, | |
| { | |
| "label": "fastp_html_report", | |
| "output_name": "report_html", | |
| "uuid": "d31c518e-b26c-42e7-9d62-c4adde285a27" | |
| } | |
| ] | |
| }, | |
| "3": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0", | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": { | |
| "library|input_1": { | |
| "id": 2, | |
| "output_name": "out1" | |
| }, | |
| "reference_genome|own_file": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Bowtie2", | |
| "name": "library" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Bowtie2", | |
| "name": "reference_genome" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Bowtie2", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bam" | |
| }, | |
| { | |
| "name": "mapping_stats", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 476.203125, | |
| "top": 210.890625 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionmapping_stats": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "mapping_stats" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Mapped reads (bowtie2 result)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "0d4acadabb04", | |
| "name": "bowtie2", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false}, \"reference_genome\": {\"source\": \"history\", \"__current_case__\": 1, \"own_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"set_id_auto\", \"__current_case__\": 2}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.5.3+galaxy0", | |
| "type": "tool", | |
| "uuid": "befd5b2a-7f19-48bf-9133-55dddc3791f2", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "mapped_reads", | |
| "output_name": "output", | |
| "uuid": "cea7a009-c5b0-418f-82b0-4a379ece0fe5" | |
| } | |
| ] | |
| }, | |
| "4": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": { | |
| "inputFile": { | |
| "id": 3, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MarkDuplicates", | |
| "name": "inputFile" | |
| } | |
| ], | |
| "label": null, | |
| "name": "MarkDuplicates", | |
| "outputs": [ | |
| { | |
| "name": "metrics_file", | |
| "type": "txt" | |
| }, | |
| { | |
| "name": "outFile", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 752.484375, | |
| "top": 362.140625 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3f254c5ced1d", | |
| "name": "picard", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"__input_ext\": \"bam\", \"assume_sorted\": true, \"barcode_tag\": \"\", \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"inputFile|__identifier__\": \"SRR11247078\", \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": true, \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.1.1.0", | |
| "type": "tool", | |
| "uuid": "298f0df2-22f1-405d-92b3-272f73e3ef5b", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "markduplicates_stats", | |
| "output_name": "metrics_file", | |
| "uuid": "873c1736-4a15-4805-a1ee-e64808b10a0a" | |
| }, | |
| { | |
| "label": "markduplicates_reads", | |
| "output_name": "outFile", | |
| "uuid": "10acc683-8d34-4017-892e-21c7bea450eb" | |
| } | |
| ] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 2, | |
| "output_name": "report_json" | |
| }, | |
| "results_1|software_cond|input": { | |
| "id": 3, | |
| "output_name": "mapping_stats" | |
| }, | |
| "results_2|software_cond|output_0|input": { | |
| "id": 4, | |
| "output_name": "metrics_file" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "stats", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 831.90625, | |
| "top": 18.71875 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionplots": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "plots" | |
| }, | |
| "HideDatasetActionstats": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "stats" | |
| }, | |
| "RenameDatasetActionhtml_report": { | |
| "action_arguments": { | |
| "newname": "Preprocessing and mapping reports" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "html_report" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "abfd8a6544d7", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastp\", \"__current_case__\": 7, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 17, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.11+galaxy1", | |
| "type": "tool", | |
| "uuid": "cba65a56-8563-4777-8a87-b4c0158d8015", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "preprocessing_and_mapping_reports", | |
| "output_name": "html_report", | |
| "uuid": "01575724-b29c-465d-b9f0-8577ce82fd00" | |
| } | |
| ] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "reads": { | |
| "id": 4, | |
| "output_name": "outFile" | |
| }, | |
| "reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Realign reads", | |
| "name": "reads" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Realign reads", | |
| "name": "reference_source" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Realign reads", | |
| "outputs": [ | |
| { | |
| "name": "realigned", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 980.125, | |
| "top": 538.46875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "aa35ee7f3ab2", | |
| "name": "lofreq_viterbi", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv_options\": {\"keepflags\": false, \"bq2_handling\": {\"replace_bq2\": \"keep\", \"__current_case__\": 0, \"defqual\": \"2\"}}, \"reads\": {\"__class__\": \"ConnectedValue\"}, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy0", | |
| "type": "tool", | |
| "uuid": "967ad159-752b-4117-82f8-7fa9296897eb", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "realigned_deduplicated_mapped_reads", | |
| "output_name": "realigned", | |
| "uuid": "d42cf1f6-fe7e-4559-8d47-d881ff16308e" | |
| } | |
| ] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "reads": { | |
| "id": 6, | |
| "output_name": "realigned" | |
| }, | |
| "strategy|reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Insert indel qualities", | |
| "name": "reads" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Insert indel qualities", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 1217.5, | |
| "top": 636.09375 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Fully processed reads for variant calling (deduplicated, realigned reads with added indelquals)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "971e07ca4456", | |
| "name": "lofreq_indelqual", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"reads\": {\"__class__\": \"ConnectedValue\"}, \"strategy\": {\"selector\": \"dindel\", \"__current_case__\": 1, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy1", | |
| "type": "tool", | |
| "uuid": "b2abc152-bdea-418f-af6b-566f83418ffb", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "realigned_deduplicated_mapped_reads_with_indel_quals", | |
| "output_name": "output", | |
| "uuid": "9fc19a53-7ff5-4e69-9aa2-05400670ff3b" | |
| } | |
| ] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "reads": { | |
| "id": 7, | |
| "output_name": "output" | |
| }, | |
| "reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Call variants", | |
| "name": "reads" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Call variants", | |
| "name": "reference_source" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Call variants", | |
| "outputs": [ | |
| { | |
| "name": "variants", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 1450.90625, | |
| "top": 733.734375 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4805fe3d8fda", | |
| "name": "lofreq_call", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"call_control\": {\"set_call_options\": \"yes\", \"__current_case__\": 1, \"coverage\": {\"min_cov\": \"5\", \"max_depth\": \"1000000\"}, \"pe\": {\"use_orphan\": false}, \"bc_quals\": {\"min_bq\": \"30\", \"min_alt_bq\": \"30\", \"alt_bq\": {\"modify\": \"\", \"__current_case__\": 0}}, \"align_quals\": {\"alnqual\": {\"use_alnqual\": \"\", \"__current_case__\": 0, \"alnqual_choice\": {\"alnquals_to_use\": \"\", \"__current_case__\": 1, \"extended_baq\": true}}}, \"map_quals\": {\"min_mq\": \"20\", \"use_mq\": {\"no_mq\": \"\", \"__current_case__\": 0, \"max_mq\": \"255\"}}, \"source_qual\": {\"use_src_qual\": {\"src_qual\": \"\", \"__current_case__\": 0}}, \"joint_qual\": {\"min_jq\": \"0\", \"min_alt_jq\": \"0\", \"def_alt_jq\": \"0\"}}, \"filter_control\": {\"filter_type\": \"set_custom\", \"__current_case__\": 3, \"sig\": \"0.0005\", \"bonf\": \"0\", \"others\": false}, \"reads\": {\"__class__\": \"ConnectedValue\"}, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}, \"regions\": {\"restrict_to_region\": \"genome\", \"__current_case__\": 0}, \"variant_types\": \"--call-indels\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy2", | |
| "type": "tool", | |
| "uuid": "c1515432-2f61-498d-9dcd-b44da6f923c7", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "called_variant", | |
| "output_name": "variants", | |
| "uuid": "1f968e8a-6574-4002-b2c6-a7faf96111ef" | |
| } | |
| ] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "invcf": { | |
| "id": 8, | |
| "output_name": "variants" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Lofreq filter", | |
| "name": "invcf" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Lofreq filter", | |
| "outputs": [ | |
| { | |
| "name": "outvcf", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 1498.515625, | |
| "top": 612.421875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "7dfca164d2e3", | |
| "name": "lofreq_filter", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"af\": {\"af_min\": \"0.0\", \"af_max\": \"0.0\"}, \"coverage\": {\"cov_min\": \"0\", \"cov_max\": \"0\"}, \"filter_by_type\": {\"keep_only\": \"\", \"__current_case__\": 0, \"qual\": {\"snvqual_filter\": {\"snvqual\": \"no\", \"__current_case__\": 0}, \"indelqual_filter\": {\"indelqual\": \"no\", \"__current_case__\": 0}}}, \"flag_or_drop\": \"--print-all\", \"invcf\": {\"__class__\": \"ConnectedValue\"}, \"sb\": {\"sb_filter\": {\"strand_bias\": \"mtc\", \"__current_case__\": 2, \"sb_alpha\": \"0.001\", \"sb_mtc\": \"fdr\", \"sb_compound\": true, \"sb_indels\": false}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy0", | |
| "type": "tool", | |
| "uuid": "f9db3062-6214-4c07-a006-001277dc0be5", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "soft_filtered_variants", | |
| "output_name": "outvcf", | |
| "uuid": "9f6aebda-a899-4303-b186-7ae5faff79e2" | |
| } | |
| ] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "input": { | |
| "id": 9, | |
| "output_name": "outvcf" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "input" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "intervals" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "transcripts" | |
| } | |
| ], | |
| "label": "SnpEff eff covid19 version", | |
| "name": "SnpEff eff:", | |
| "outputs": [ | |
| { | |
| "name": "snpeff_output", | |
| "type": "vcf" | |
| }, | |
| { | |
| "name": "statsFile", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 1544.40625, | |
| "top": 285.5 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionsnpeff_output": { | |
| "action_arguments": { | |
| "newname": "Final (SnpEff-)annotated variants" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "snpeff_output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2a3a00c1fa0a", | |
| "name": "snpeff_sars_cov_2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"annotations\": [\"-formatEff\", \"-classic\"], \"chr\": \"\", \"csvStats\": false, \"filter\": {\"specificEffects\": \"no\", \"__current_case__\": 0}, \"filterOut\": [\"-no-downstream\", \"-no-intergenic\", \"-no-upstream\", \"-no-utr\"], \"generate_stats\": true, \"genome_version\": \"NC_045512.2\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"inputFormat\": \"vcf\", \"intervals\": {\"__class__\": \"RuntimeValue\"}, \"noLog\": true, \"offset\": \"default\", \"outputConditional\": {\"outputFormat\": \"vcf\", \"__current_case__\": 0}, \"transcripts\": {\"__class__\": \"RuntimeValue\"}, \"udLength\": \"0\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.5covid19", | |
| "type": "tool", | |
| "uuid": "6b370dfb-970b-49c2-8060-c017f50508e8", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "annotated_variants", | |
| "output_name": "snpeff_output", | |
| "uuid": "c9297840-841f-430d-81c9-bfd721b8203b" | |
| }, | |
| { | |
| "label": "annotated_variants_stats", | |
| "output_name": "statsFile", | |
| "uuid": "adfc092c-6cae-410c-b86c-36fdb0703e9b" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "COVID-19", | |
| "covid19.galaxyproject.org" | |
| ], | |
| "uuid": "5171bc59-590c-4e97-8db8-004f73928627", | |
| "version": 6 | |
| }, | |
| "updated": "2024-12-03T18:32:54.041389", | |
| "readme": "COVID-19: variation analysis on WGS SE data\n-------------------------------------------\n\nThis workflows performs single end read mapping with bowtie2 followed by\nsensitive variant calling across a wide range of AFs with lofreq and variant\nannotation with snpEff 4.5covid19.\n", | |
| "changelog": "# Changelog\n\n## [0.1.5] 2024-03-05\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.20.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.3.4.2` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.2` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.8+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy2`\n\n## [0.1.4] 2023-11-20\n\n- Fix author in dockstore\n- Fix input fastq URL for test\n- Update output test\n\n## [0.1.3] 2021-12-13\n\n### Added\n- Added GitHub Actions workflow. No functional changes.\n\n## [0.1.2] 2021-07-23\n\n### Added\n\nAdded RO-Crate metadata file. No functional changes.\n\n## [0.1.1] 2021-06-14\n\n### Fixed\n\nFix reference to test file in .dockstore.yml\n\n## [0.1]\n\n- Initial version of COVID-19: variation analysis on WGS SE data workflow\n", | |
| "diagrams": "# Workflow diagrams\n\n## COVID-19: variation analysis on WGS SE data\n\n```mermaid\ngraph LR\n0[\"ℹ️ Single End Collection\"]@{ shape: docs }\n1[\"ℹ️ NC_045512.2 FASTA sequence of SARS-CoV-2\"]@{ shape: doc }\n2[\"fastp\"]@{ shape: process }\n0 --> 2\n3[\"Bowtie2\"]@{ shape: process }\n2 --> 3\n1 --> 3\n4[\"MarkDuplicates\"]@{ shape: process }\n3 --> 4\n5[\"MultiQC\"]@{ shape: process }\n2 --> 5\n3 --> 5\n4 --> 5\n6[\"Realign reads\"]@{ shape: process }\n4 --> 6\n1 --> 6\n7[\"Insert indel qualities\"]@{ shape: process }\n6 --> 7\n1 --> 7\n8[\"Call variants\"]@{ shape: process }\n7 --> 8\n1 --> 8\n9[\"Lofreq filter\"]@{ shape: process }\n8 --> 9\n10[\"SnpEff eff covid19 version\"]@{ shape: process }\n9 --> 10\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/sars-cov-2-se-illumina-wgs-variant-calling/COVID-19-SE-WGS-ILLUMINA", | |
| "dockstore_id": 16244, | |
| "categories": [ | |
| "COVID-19" | |
| ], | |
| "collections": [ | |
| "SARS-COV-2" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test workflow execution using paired end illumina accession", | |
| "job": { | |
| "NC_045512.2 FASTA sequence of SARS-CoV-2": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/4555735/files/NC_045512.2_reference.fasta?download=1" | |
| }, | |
| "Single End Collection": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "identifier": "SRR11605118", | |
| "class": "File", | |
| "location": "https://www.be-md.ncbi.nlm.nih.gov/Traces/sra-reads-be/fastq?acc=SRR11605118" | |
| } | |
| ] | |
| } | |
| }, | |
| "outputs": { | |
| "annotated_variants": { | |
| "attributes": {}, | |
| "element_tests": { | |
| "SRR11605118": { | |
| "asserts": { | |
| "has_line": { | |
| "line": "#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO" | |
| }, | |
| "has_text_matching": { | |
| "expression": "NC_045512.2\t16111\t.\tC\tT\t[0-9.]*\tPASS\tDP=[0-9]*;AF=0.[89][0-9]*;SB=0;DP4=[0-9]*,[0-9]*,[0-9]*,[0-9]*;EFF=SYNONYMOUS_CODING\\(LOW|SILENT|Cta/Tta|L5283|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T\\),SYNONYMOUS_CODING\\(LOW|SILENT|Cta/Tta|L891|931|ORF1ab|protein_coding|CODING|YP_009725307.1|2|T|WARNING_TRANSCRIPT_NO_START_CODON\\)" | |
| } | |
| } | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/sars-cov-2-variant-calling/sars-cov-2-se-illumina-wgs-variant-calling" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "SARS-COV-2-ILLUMINA-AMPLICON-IVAR-PANGOLIN-NEXTCLADE", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/pe-wgs-ivar-analysis.ga", | |
| "authors": [ | |
| { | |
| "name": "Peter van Heusden", | |
| "orcid": "0000-0001-6553-5274" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "Find and annotate variants in ampliconic SARS-CoV-2 Illumina sequencing data and classify samples with pangolin and nextclade", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0001-6553-5274", | |
| "name": "Peter van Heusden" | |
| } | |
| ], | |
| "release": "0.2.3", | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "name": "SARS-CoV-2 Illumina Amplicon pipeline - iVar based", | |
| "steps": { | |
| "0": { | |
| "annotation": "FASTQ format Illumina Reads (Amplicon Protocol)", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "FASTQ format Illumina Reads (Amplicon Protocol)", | |
| "name": "Paired read collection for samples" | |
| } | |
| ], | |
| "label": "Paired read collection for samples", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 2, | |
| "top": 33.99998474121094 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "ce39f6b7-b9f6-4431-8831-7a284fe826a7", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "SARS-CoV-2 reference genome (typically MN908947.3)", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "SARS-CoV-2 reference genome (typically MN908947.3)", | |
| "name": "Reference FASTA" | |
| } | |
| ], | |
| "label": "Reference FASTA", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 279.99998474121094 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "25167e70-195c-4cda-9219-dbfe2f70c863", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "Primer BED file (from ARTIC project or similar)", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Primer BED file (from ARTIC project or similar)", | |
| "name": "Primer BED" | |
| } | |
| ], | |
| "label": "Primer BED", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 6, | |
| "top": 391.49998474121094 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "6c8951a5-f254-4564-8d17-f78e018077ec", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "Specify the proportion of reads that need to agree with each other to call a variant. This is a floating point value between 0 and 1. ", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Specify the proportion of reads that need to agree with each other to call a variant. This is a floating point value between 0 and 1. ", | |
| "name": "Read fraction to call variant" | |
| } | |
| ], | |
| "label": "Read fraction to call variant", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 34.35003662109375, | |
| "top": 635.9999847412109 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 0.7, \"parameter_type\": \"float\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "57a3622f-6908-4c1d-b88d-3bc318ac9d73", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "Minimum base quality score to count a base towards the sequence consensus.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Minimum base quality score to count a base towards the sequence consensus.", | |
| "name": "Minimum quality score to call base" | |
| } | |
| ], | |
| "label": "Minimum quality score to call base", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 29.4000244140625, | |
| "top": 802.0000457763672 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 20, \"parameter_type\": \"integer\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "00fdc318-b4b7-404e-900b-54087a891f55", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.2+galaxy0", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "single_paired|paired_input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "fastp: Trimmed Illumina Reads", | |
| "name": "fastp", | |
| "outputs": [ | |
| { | |
| "name": "output_paired_coll", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "report_html", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "report_json", | |
| "type": "json" | |
| } | |
| ], | |
| "position": { | |
| "left": 280.00001525878906, | |
| "top": 0 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_paired_coll": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_paired_coll" | |
| }, | |
| "HideDatasetActionreport_html": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "report_html" | |
| }, | |
| "HideDatasetActionreport_json": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "report_json" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.2+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "65b93b623c77", | |
| "name": "fastp", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_options\": {\"quality_filtering_options\": {\"disable_quality_filtering\": false, \"qualified_quality_phred\": null, \"unqualified_percent_limit\": null, \"n_base_limit\": null}, \"length_filtering_options\": {\"disable_length_filtering\": false, \"length_required\": null, \"length_limit\": null}, \"low_complexity_filter\": {\"enable_low_complexity_filter\": false, \"complexity_threshold\": null}}, \"output_options\": {\"report_html\": true, \"report_json\": true}, \"overrepresented_sequence_analysis\": {\"overrepresentation_analysis\": false, \"overrepresentation_sampling\": null}, \"read_mod_options\": {\"polyg_tail_trimming\": {\"trimming_select\": \"\", \"__current_case__\": 1, \"poly_g_min_len\": null}, \"polyx_tail_trimming\": {\"polyx_trimming_select\": \"\", \"__current_case__\": 1}, \"umi_processing\": {\"umi\": false, \"umi_loc\": \"\", \"umi_len\": null, \"umi_prefix\": \"\"}, \"cutting_by_quality_options\": {\"cut_by_quality5\": false, \"cut_by_quality3\": false, \"cut_window_size\": null, \"cut_mean_quality\": null}, \"base_correction_options\": {\"correction\": false}}, \"single_paired\": {\"single_paired_selector\": \"paired_collection\", \"__current_case__\": 2, \"paired_input\": {\"__class__\": \"ConnectedValue\"}, \"adapter_trimming_options\": {\"disable_adapter_trimming\": false, \"adapter_sequence1\": \"\", \"adapter_sequence2\": \"\"}, \"global_trimming_options\": {\"trim_front1\": null, \"trim_tail1\": null, \"trim_front2\": null, \"trim_tail2\": null}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.23.2+galaxy0", | |
| "type": "tool", | |
| "uuid": "fb6601de-99e2-4271-813d-0e97027e54c7", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "If the reference is named MN908947.3 (Genbank name of SARS-CoV-2 reference genome), rename it to NC_045512.2 (RefSeq name of SARS-CoV-2 reference genome)", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "infile": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Rename reference to NC_045512.2", | |
| "name": "Text transformation", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 270.00001525878906, | |
| "top": 274.49998474121094 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "ddf54b12c295", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"code\": \"/^>/s/^>MN908947.3/>NC_045512.2/\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "5828628c-ef20-428d-b76e-8d502a8d3097", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "fastq_input|fastq_input1": { | |
| "id": 5, | |
| "output_name": "output_paired_coll" | |
| }, | |
| "reference_source|ref_file": { | |
| "id": 6, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Map with BWA-MEM", | |
| "outputs": [ | |
| { | |
| "name": "bam_output", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 558.0000152587891, | |
| "top": 95.99998474121094 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionbam_output": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "bam_output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188dc7a68e6", | |
| "name": "bwa", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": \"\"}, \"output_sort\": \"coordinate\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.7.17.2", | |
| "type": "tool", | |
| "uuid": "11cea040-0e8a-4b53-8d16-7bd55f9e1074", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.4", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "input": { | |
| "id": 7, | |
| "output_name": "bam_output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Samtools stats", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 836, | |
| "top": 95.99998474121094 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.4", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3a0efe14891f", | |
| "name": "samtools_stats", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cov_threshold\": null, \"coverage_cond\": {\"coverage_select\": \"no\", \"__current_case__\": 0}, \"filter_by_flags\": {\"filter_flags\": \"nofilter\", \"__current_case__\": 1}, \"gc_depth\": null, \"input\": {\"__class__\": \"ConnectedValue\"}, \"insert_size\": null, \"most_inserts\": null, \"read_group\": null, \"read_length\": null, \"remove_dups\": false, \"remove_overlaps\": false, \"sparse\": false, \"split_output_cond\": {\"split_output_selector\": \"no\", \"__current_case__\": 0}, \"trim_quality\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.0.4", | |
| "type": "tool", | |
| "uuid": "217c653d-84a7-49dd-ba0f-601bb651ee7d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "input": { | |
| "id": 7, | |
| "output_name": "bam_output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputsam", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 839.3500366210938, | |
| "top": 295.6666717529297 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutputsam": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5826298f6a73", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"quality\": \"20\", \"library\": \"\", \"cigarcons\": null, \"inclusive_filter\": [\"1\", \"2\"], \"exclusive_filter\": null, \"exclusive_filter_all\": null, \"tag\": null, \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"fraction\", \"__current_case__\": 0, \"factor\": \"1.0\", \"seed\": null}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": false, \"adv_output\": {\"readtags\": [], \"collapsecigar\": false}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.15.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "1972d86f-45de-4b7b-aca2-e53ccc240fb8", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "input1": { | |
| "id": 9, | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "QualiMap BamQC", | |
| "outputs": [ | |
| { | |
| "name": "raw_data", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "output_html", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 1114, | |
| "top": 172.99998474121094 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_html": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_html" | |
| }, | |
| "HideDatasetActionraw_data": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "raw_data" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "19ece8afbaab", | |
| "name": "qualimap_bamqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"duplicate_skipping\": [\"0\"], \"input1\": {\"__class__\": \"ConnectedValue\"}, \"per_base_coverage\": false, \"plot_specific\": {\"n_bins\": \"400\", \"paint_chromosome_limits\": true, \"genome_gc_distr\": null, \"homopolymer_size\": \"3\"}, \"stats_regions\": {\"region_select\": \"all\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.2d+galaxy3", | |
| "type": "tool", | |
| "uuid": "a0720c38-9db1-494e-8976-8baa83f69613", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.4.2+galaxy0", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "input_bam": { | |
| "id": 9, | |
| "output_name": "outputsam" | |
| }, | |
| "primer|input_bed": { | |
| "id": 2, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "ivar trim", | |
| "outputs": [ | |
| { | |
| "name": "output_bam", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 1114, | |
| "top": 415.99998474121094 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.4.2+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "0893a1dbb807", | |
| "name": "ivar_trim", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"amplicons\": {\"filter_by\": \"yes_compute\", \"__current_case__\": 0}, \"inc_primers\": true, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"min_len\": \"30\", \"min_qual\": \"20\", \"primer\": {\"source\": \"history\", \"__current_case__\": 0, \"input_bed\": {\"__class__\": \"ConnectedValue\"}}, \"primer_pos_wiggle\": \"0\", \"trimmed_length\": {\"filter\": \"auto\", \"__current_case__\": 1}, \"window_width\": \"4\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.4.2+galaxy0", | |
| "type": "tool", | |
| "uuid": "8841f373-8ce6-4aba-aefa-70acd5daff73", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "primer_trimmed_bam", | |
| "output_name": "output_bam", | |
| "uuid": "ebdd8f89-6559-44a9-9616-c57b78e7a915" | |
| } | |
| ] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "__FLATTEN__", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "input": { | |
| "id": 10, | |
| "output_name": "raw_data" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Flatten collection", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1392, | |
| "top": 218.99998474121094 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "__FLATTEN__", | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"join_identifier\": \"_\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "f2fe26ec-f30b-4bc7-9dd6-62f3c9538ae7", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_variants/ivar_variants/1.4.2+galaxy1", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "input_bam": { | |
| "id": 11, | |
| "output_name": "output_bam" | |
| }, | |
| "min_freq": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "min_qual": { | |
| "id": 4, | |
| "output_name": "output" | |
| }, | |
| "ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool ivar variants", | |
| "name": "output_format" | |
| } | |
| ], | |
| "label": null, | |
| "name": "ivar variants", | |
| "outputs": [ | |
| { | |
| "name": "output_variants_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_variants_vcf", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 1414, | |
| "top": 448.49998474121094 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_variants_vcf": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_variants_vcf" | |
| }, | |
| "RenameDatasetActionoutput_variants_tabular": { | |
| "action_arguments": { | |
| "newname": "ivar variants tabular output on #{input}" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_variants_tabular" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_variants/ivar_variants/1.4.2+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "045d6d00f606", | |
| "name": "ivar_variants", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"min_freq\": {\"__class__\": \"ConnectedValue\"}, \"min_qual\": {\"__class__\": \"ConnectedValue\"}, \"output_format\": {\"choice\": \"tabular_and_vcf\", \"__current_case__\": 1, \"pass_only\": false, \"gtf\": {\"__class__\": \"RuntimeValue\"}}, \"ref\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.4.2+galaxy1", | |
| "type": "tool", | |
| "uuid": "0b2aa4bf-69dd-4ccc-b0a2-4a734848e2b8", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "ivar_variants_tabular", | |
| "output_name": "output_variants_tabular", | |
| "uuid": "319f50e1-71fb-445e-b3e3-8015d2787f5f" | |
| } | |
| ] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_consensus/ivar_consensus/1.4.2+galaxy0", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "input_bam": { | |
| "id": 11, | |
| "output_name": "output_bam" | |
| }, | |
| "min_freq": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "min_qual": { | |
| "id": 4, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "ivar consensus", | |
| "outputs": [ | |
| { | |
| "name": "consensus", | |
| "type": "fasta" | |
| } | |
| ], | |
| "position": { | |
| "left": 1392, | |
| "top": 780.9999847412109 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionconsensus": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "consensus" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_consensus/ivar_consensus/1.4.2+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "17f911830a8c", | |
| "name": "ivar_consensus", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"depth_action\": \"-n N\", \"filter_depth\": \"false\", \"gap\": \"true\", \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"min_depth\": \"50\", \"min_freq\": {\"__class__\": \"ConnectedValue\"}, \"min_indel_freq\": \"0.8\", \"min_qual\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.4.2+galaxy0", | |
| "type": "tool", | |
| "uuid": "5fb477e6-e7ac-4e02-a31f-335228becdf3", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "15": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", | |
| "errors": null, | |
| "id": 15, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 5, | |
| "output_name": "report_json" | |
| }, | |
| "results_1|software_cond|output_0|type|input": { | |
| "id": 8, | |
| "output_name": "output" | |
| }, | |
| "results_2|software_cond|input": { | |
| "id": 12, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Quality Control Report", | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "stats", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 1670, | |
| "top": 97.99998474121094 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionstats": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "stats" | |
| }, | |
| "RenameDatasetActionhtml_report": { | |
| "action_arguments": { | |
| "newname": "Quality Control report" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "html_report" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "abfd8a6544d7", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastp\", \"__current_case__\": 7, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 24, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"stats\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"qualimap\", \"__current_case__\": 20, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.11+galaxy1", | |
| "type": "tool", | |
| "uuid": "d03312e1-3b85-4883-b601-6081acf7503d", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "bamqc_report_html", | |
| "output_name": "html_report", | |
| "uuid": "0489d543-59ec-4f03-be4c-d13b14b03ac7" | |
| } | |
| ] | |
| }, | |
| "16": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "errors": null, | |
| "id": 16, | |
| "input_connections": { | |
| "input": { | |
| "id": 13, | |
| "output_name": "output_variants_vcf" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "intervals" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "transcripts" | |
| } | |
| ], | |
| "label": "Annotated variants", | |
| "name": "SnpEff eff:", | |
| "outputs": [ | |
| { | |
| "name": "snpeff_output", | |
| "type": "vcf" | |
| }, | |
| { | |
| "name": "statsFile", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 2174, | |
| "top": 447.99998474121094 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionstatsFile": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "statsFile" | |
| }, | |
| "RenameDatasetActionsnpeff_output": { | |
| "action_arguments": { | |
| "newname": "Annotated variants" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "snpeff_output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2a3a00c1fa0a", | |
| "name": "snpeff_sars_cov_2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"annotations\": null, \"chr\": \"\", \"csvStats\": false, \"filter\": {\"specificEffects\": \"no\", \"__current_case__\": 0}, \"filterOut\": null, \"generate_stats\": true, \"genome_version\": \"NC_045512.2\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"inputFormat\": \"vcf\", \"intervals\": {\"__class__\": \"RuntimeValue\"}, \"noLog\": true, \"offset\": \"default\", \"outputConditional\": {\"outputFormat\": \"vcf\", \"__current_case__\": 0}, \"transcripts\": {\"__class__\": \"RuntimeValue\"}, \"udLength\": \"0\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.5covid19", | |
| "type": "tool", | |
| "uuid": "a8b63b67-2795-4e21-8614-f7d24cec2224", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "snpeff_annotated_vcf", | |
| "output_name": "snpeff_output", | |
| "uuid": "8f6057ec-4a34-4c49-ad4b-f0d93ba33878" | |
| } | |
| ] | |
| }, | |
| "17": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", | |
| "errors": null, | |
| "id": 17, | |
| "input_connections": { | |
| "infile": { | |
| "id": 14, | |
| "output_name": "consensus" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Consensus genome (masked for depth)", | |
| "name": "Text transformation", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1670, | |
| "top": 802.0000457763672 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Consensus genome" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "ddf54b12c295", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"code\": \"/^>/s/Consensus_(.*)_threshold_.*/\\\\1/\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "877a609d-d2fa-430d-8b78-2b484af52bda", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "ivar_consensus_genome", | |
| "output_name": "output", | |
| "uuid": "cabe916a-b8ba-49e1-af9d-30dad1bd44ae" | |
| } | |
| ] | |
| }, | |
| "18": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1", | |
| "errors": null, | |
| "id": 18, | |
| "input_connections": { | |
| "inputs": { | |
| "id": 17, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Concatenate datasets", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1913, | |
| "top": 913.5000457763672 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "Combined Consensus Genomes" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "d698c222f354", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "87e8ec0a-d8e8-48f3-b943-04c75152fec2", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "combined_multifasta", | |
| "output_name": "out_file1", | |
| "uuid": "d58378c8-fe46-4cab-9317-5991a3561221" | |
| } | |
| ] | |
| }, | |
| "19": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pangolin/pangolin/4.3+galaxy1", | |
| "errors": null, | |
| "id": 19, | |
| "input_connections": { | |
| "input1": { | |
| "id": 18, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Pangolin", | |
| "outputs": [ | |
| { | |
| "name": "output1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2177, | |
| "top": 830.5000457763672 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pangolin/pangolin/4.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2f1019071464", | |
| "name": "pangolin", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"alignment\": false, \"constellations\": {\"source\": \"default\", \"__current_case__\": 0}, \"db\": {\"__current_case__\": 0, \"source\": \"download\"}, \"engine\": {\"analysis_mode\": \"usher\", \"__current_case__\": 0, \"pangolin_data\": {\"source\": \"default\", \"__current_case__\": 0}}, \"expanded_lineage\": false, \"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"max_ambig\": \"0.5\", \"min_length\": \"10000\", \"usher\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "15ff9812-4ff9-4ac2-9f95-c65bab4eb070", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "all_samples_pangolin", | |
| "output_name": "output1", | |
| "uuid": "a0468d09-08a4-43de-be10-4dc4e6973b99" | |
| } | |
| ] | |
| }, | |
| "20": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/nextclade/nextclade/2.7.0+galaxy0", | |
| "errors": null, | |
| "id": 20, | |
| "input_connections": { | |
| "input_fasta": { | |
| "id": 18, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Nextclade", | |
| "name": "input_fasta" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Nextclade", | |
| "outputs": [ | |
| { | |
| "name": "report_tsv", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2176, | |
| "top": 999.0000457763672 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/nextclade/nextclade/2.7.0+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "128ba8da994f", | |
| "name": "nextclade", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv\": {\"advanced_options\": \"no\", \"__current_case__\": 1}, \"db\": {\"source\": \"download\", \"__current_case__\": 1}, \"include_header\": true, \"input_fasta\": {\"__class__\": \"RuntimeValue\"}, \"organism\": \"sars-cov-2\", \"outputs\": [\"report_tsv\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.7.0+galaxy0", | |
| "type": "tool", | |
| "uuid": "4b821f22-47f8-4251-bc32-5aa167498ba7", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "all_samples_nextclade", | |
| "output_name": "report_tsv", | |
| "uuid": "4cd1f6bd-be94-43c3-9d4a-773f178b96c4" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "COVID-19", | |
| "ARTIC", | |
| "iwc" | |
| ], | |
| "uuid": "3d86e5fc-cad1-4e21-8ecc-d0e6637899bc", | |
| "version": 1 | |
| }, | |
| "updated": "2024-12-03T18:32:54.039375", | |
| "readme": "# COVID-19 sequence analysis on Illumina Amplicon PE data\n\nThis workflow implements an [iVar](https://github.com/andersen-lab/ivar) based analysis similar to\nthe one in [ncov2019-artic-nf](https://github.com/connor-lab/ncov2019-artic-nf), [covid-19-signal](https://github.com/jaleezyy/covid-19-signal/) and the Thiagen [Titan workflow](https://github.com/theiagen/public_health_viral_genomics). These workflows (written in Nextflow, Snakemake and WDL) are widely in use in [COG UK](https://www.cogconsortium.uk/), [CanCOGeN](https://www.genomecanada.ca/en/cancogen) and some US state public health laboratories.\n\nThis workflow is also the subject of a Galaxy Training Network tutorial (currently a [Work in Progress](https://github.com/galaxyproject/training-material/pull/2633)).\nIt differs from [this workflow](https://github.com/galaxyproject/iwc/tree/main/workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling) in\nthat it does not use `lofreq` and is aimed at rapid analysis of majority variants and lineage/clade assignment with `pangolin` and `nextclade`.\n\nTODO:\n\n1. Add support for QC using negative and positive controls\n2. Integrate with phylogeny tools including IQTree and UShER (and possibly more).\n", | |
| "changelog": "# Changelog\n\n## [0.3] 2022-11-22\n\n- update all tools:\n - fastp from 0.20.1 to 0.23.2\n - bwa_mem from 0.7.17.1 to 0.7.17.2\n - samtools_stats from 2.0.2 to 2.0.4\n - samtools_view from 1.9 to 1.15.1\n - ivar_trim from 1.3.1 to 1.4.2\n - ivar_variants from 1.3.1 to 1.4.2\n - ivar_consensus from 1.3.1 to 1.4.2\n - multiqc from 1.9 to 1.11\n - pangolin from 3.1.14 to 4.3\n - nextclade from 1.4.1 to 2.7.0\n\n## [0.2.3] 2022-05-25\n\n### Changed\n- Changed creator ORCID to absolute URI\n\n## [0.2.2] 2021-12-13\n\n### Added\n- Added GitHub Actions workflow. No functional changes.\n\n## [0.2.1] 2021-11-04\n\n### Added\n- Added .workflowhub.yml\n\n## [0.2] - 2021-10-13\n\n### Changed\n\n- Upgrade pangolin to 3.1.14 \n - this is a bugfix release that addresses problems with commas in sequence IDs\n- Upgrade nextclade to 1.4.1\n - nextclade has a new way of dealing with the nextclade database, so it is now downloaded using nextclade itself\n - the latest release supports detecting and reporting frameshifts\n - version 1.4.1 fixes a problem with formatting columns that was present in previous versions\n- A header line is now part of the tabular reports produced by both pangolin and nextclade\n- The aligned primer-trimmed reads BAM and the multi-fasta combined consensus genomes datasets are no longer hidden as part of the workflow execution\n\n## [0.1] - 2021-06-20\n\n- Initial version of SARS-CoV-2 Illumina Amplicon pipeline - iVar based for IWC\n", | |
| "diagrams": "# Workflow diagrams\n\n## SARS-CoV-2 Illumina Amplicon pipeline - iVar based\n\n```mermaid\ngraph LR\n0[\"ℹ️ Paired read collection for samples\"]@{ shape: docs }\n1[\"ℹ️ Reference FASTA\"]@{ shape: doc }\n2[\"ℹ️ Primer BED\"]@{ shape: doc }\n3[\"ℹ️ Read fraction to call variant\"]@{ shape: lean-l }\n4[\"ℹ️ Minimum quality score to call base\"]@{ shape: lean-l }\n5[\"fastp: Trimmed Illumina Reads\"]@{ shape: process }\n0 --> 5\n6[\"Rename reference to NC_045512.2\"]@{ shape: process }\n1 --> 6\n7[\"Map with BWA-MEM\"]@{ shape: process }\n5 --> 7\n6 --> 7\n8[\"Samtools stats\"]@{ shape: process }\n7 --> 8\n9[\"Samtools view\"]@{ shape: process }\n7 --> 9\n10[\"QualiMap BamQC\"]@{ shape: process }\n9 --> 10\n11[\"ivar trim\"]@{ shape: process }\n9 --> 11\n2 --> 11\n12[\"Flatten collection\"]@{ shape: process }\n10 --> 12\n13[\"ivar variants\"]@{ shape: process }\n11 --> 13\n3 --> 13\n4 --> 13\n1 --> 13\n14[\"ivar consensus\"]@{ shape: process }\n11 --> 14\n3 --> 14\n4 --> 14\n15[\"Quality Control Report\"]@{ shape: process }\n5 --> 15\n8 --> 15\n12 --> 15\n16[\"Annotated variants\"]@{ shape: process }\n13 --> 16\n17[\"Consensus genome (masked for depth)\"]@{ shape: process }\n14 --> 17\n18[\"Concatenate datasets\"]@{ shape: process }\n17 --> 18\n19[\"Pangolin\"]@{ shape: process }\n18 --> 19\n20[\"Nextclade\"]@{ shape: process }\n18 --> 20\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/sars-cov-2-pe-illumina-artic-ivar-analysis/SARS-COV-2-ILLUMINA-AMPLICON-IVAR-PANGOLIN-NEXTCLADE", | |
| "dockstore_id": 16951, | |
| "categories": [ | |
| "COVID-19" | |
| ], | |
| "collections": [ | |
| "SARS-COV-2" | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-ivar-analysis" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "COVID-19-CONSENSUS-CONSTRUCTION", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/consensus-from-variation.ga", | |
| "testParameterFiles": [ | |
| "/consensus-from-variation-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Wolfgang Maier", | |
| "orcid": "0000-0002-9464-6640" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "Build a consensus sequence from FILTER PASS variants with intrasample allele-frequency above a configurable consensus threshold.\nHard-mask regions with low coverage (but not consensus variants within them) and ambiguous sites.", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-9464-6640", | |
| "name": "Wolfgang Maier" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "name": "COVID-19: consensus construction", | |
| "release": "0.4.2", | |
| "steps": { | |
| "0": { | |
| "annotation": "Collection of VCFs produced by upstream workflows for variation analysis", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Collection of VCFs produced by upstream workflows for variation analysis", | |
| "name": "Variant calls" | |
| } | |
| ], | |
| "label": "Variant calls", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0.0, | |
| "top": 306.13330078125 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "fca4e710-87a7-4cb6-9ff1-f9a8dc84ca37", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Only variant calls with an allele-frequency greater this value will be considered consensus variants.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Only variant calls with an allele-frequency greater this value will be considered consensus variants.", | |
| "name": "min-AF for consensus variant" | |
| } | |
| ], | |
| "label": "min-AF for consensus variant", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 0.45001220703125, | |
| "top": 469.0 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 0.75, \"parameter_type\": \"float\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "52664bd7-b500-40a1-935b-8ac6df7003e5", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "consensus_af_threshold", | |
| "output_name": "output", | |
| "uuid": "0d802d31-bb4c-41e3-8e84-c1d99b914ee9" | |
| } | |
| ] | |
| }, | |
| "2": { | |
| "annotation": "Variant calls with an allele frequency higher than this value, but lower than the AF threshold for consensus variants will be considered questionable and the respective sites be masked (with Ns) in the consensus sequence.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Variant calls with an allele frequency higher than this value, but lower than the AF threshold for consensus variants will be considered questionable and the respective sites be masked (with Ns) in the consensus sequence.", | |
| "name": "min-AF for failed variants" | |
| } | |
| ], | |
| "label": "min-AF for failed variants", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 0.45001220703125, | |
| "top": 640.6500244140625 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 0.25, \"parameter_type\": \"float\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "a2a15cce-94ec-4a76-a3ff-3ea898e9c678", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "non_consensus_af_threshold", | |
| "output_name": "output", | |
| "uuid": "16c62493-ad4b-46da-8790-a8094d01a130" | |
| } | |
| ] | |
| }, | |
| "3": { | |
| "annotation": "Fully processed BAMs as generated by upstream workflows for variation analysis. Note: for ARTIC data, these BAMs should NOT have undergone processing with ivar removereads.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Fully processed BAMs as generated by upstream workflows for variation analysis. Note: for ARTIC data, these BAMs should NOT have undergone processing with ivar removereads.", | |
| "name": "aligned reads data for depth calculation" | |
| } | |
| ], | |
| "label": "aligned reads data for depth calculation", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 581.3167114257812, | |
| "top": 395.16668701171875 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"bam\"], \"tag\": null, \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "23ae69ea-f9a7-4d5f-85f5-63b9d2bd2c50", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "Sites in the viral genome covered by less than this number of reads are considered questionable and will be masked (with Ns) in the consensus sequence independent of whether a variant has been called at them or not.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Sites in the viral genome covered by less than this number of reads are considered questionable and will be masked (with Ns) in the consensus sequence independent of whether a variant has been called at them or not.", | |
| "name": "Depth-threshold for masking" | |
| } | |
| ], | |
| "label": "Depth-threshold for masking", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 585.25, | |
| "top": 557.8499755859375 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 5, \"parameter_type\": \"integer\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "cfdc65b0-8393-4ee3-9e27-16b23135fbec", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "depth_threshold", | |
| "output_name": "output", | |
| "uuid": "f677edfd-5faf-44af-8e20-c5e6d72ba24a" | |
| } | |
| ] | |
| }, | |
| "5": { | |
| "annotation": "The SARS-CoV-2 reference genome", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "The SARS-CoV-2 reference genome", | |
| "name": "Reference genome" | |
| } | |
| ], | |
| "label": "Reference genome", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 2283.8167114257812, | |
| "top": 346.1500244140625 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "4a2c6df2-fb1e-42d8-96d5-6765ca85c214", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 282.79998779296875, | |
| "top": 285.3500061035156 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"( ( FILTER = 'PASS' ) | ( na FILTER ) ) & ( ( DP4[2] + DP4[3] ) >= ( \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" * DP ) )\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "8ec54933-36d6-404c-b0a6-5a14b04eb30e", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "components_3|param_type|component_value": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 233.0, | |
| "top": 802.0166625976562 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"( ( DP4[2] + DP4[3] ) > ( \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" * DP ) ) & ( ( DP4[2] + DP4[3] ) < ( \"}}, {\"__index__\": 3, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" * DP ) ) & ( ( FILTER = 'PASS' ) | ( na FILTER ) )\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "51ac3588-c801-4551-8345-b04cc3571fea", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "input_type|input": { | |
| "id": 3, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bedtools Genome Coverage", | |
| "name": "input_type" | |
| } | |
| ], | |
| "label": null, | |
| "name": "bedtools Genome Coverage", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bedgraph" | |
| } | |
| ], | |
| "position": { | |
| "left": 880.7999877929688, | |
| "top": 403.3499755859375 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Depth of coverage" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "a1a923cd89e8", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"d\": false, \"dz\": false, \"five\": false, \"input_type\": {\"input_type_select\": \"bam\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"report\": {\"report_select\": \"bg\", \"__current_case__\": 0, \"zero_regions\": true, \"scale\": \"1.0\"}, \"split\": true, \"strand\": \"\", \"three\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.30.0", | |
| "type": "tool", | |
| "uuid": "d89684f5-5a49-4b4c-821b-6c8a87f3a46e", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "coverage_depth", | |
| "output_name": "output", | |
| "uuid": "df923e92-8241-4c8b-9983-4773b753a144" | |
| } | |
| ] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 4, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 879.3167114257812, | |
| "top": 559.8499755859375 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c4 < \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "089b2659-d4c8-44c8-9ecc-ffe71676e650", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "filter_expression|expr": { | |
| "id": 6, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "filter_expression" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "SnpSift Filter", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 485.2833251953125, | |
| "top": 0.0 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Consensus variants" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": {\"__class__\": \"ConnectedValue\"}}, \"filtering\": {\"mode\": \"entries\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy1", | |
| "type": "tool", | |
| "uuid": "3673b687-1ba0-42f2-ba13-fa3130462079", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "consensus_variants", | |
| "output_name": "output", | |
| "uuid": "1db759fb-634a-4b5f-abd9-a0579a003570" | |
| } | |
| ] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "filter_expression|expr": { | |
| "id": 7, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "filter_expression" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "SnpSift Filter", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 456.66668701171875, | |
| "top": 733.3499755859375 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Filter-failed variants" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": {\"__class__\": \"ConnectedValue\"}}, \"filtering\": {\"mode\": \"entries\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy1", | |
| "type": "tool", | |
| "uuid": "fb232cba-e3b2-43f9-bb1f-a9ebc69c9b97", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "filter_failed_variants", | |
| "output_name": "output", | |
| "uuid": "73373a44-4651-49c2-813d-e4ea0ffd46cf" | |
| } | |
| ] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "Filter1", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "cond": { | |
| "id": 9, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 8, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Filter", | |
| "name": "cond" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Filter", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Filter", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1213.8333129882812, | |
| "top": 427.3499755859375 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "Low-coverage regions" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Filter1", | |
| "tool_state": "{\"cond\": {\"__class__\": \"ConnectedValue\"}, \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "8ac27ee3-9e9e-4d6f-b424-2c21f80c87ef", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "low_cov_regions", | |
| "output_name": "out_file1", | |
| "uuid": "20b0e19e-6916-4709-b8db-8c828ccde324" | |
| } | |
| ] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_extractFields/4.3+t.galaxy0", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "input": { | |
| "id": 10, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpSift Extract Fields", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "SnpSift Extract Fields", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 807.4500122070312, | |
| "top": 183.0 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Called variants - CHROM_POS_REF" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_extractFields/4.3+t.galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"empty_text\": \"\", \"extract\": \"CHROM POS REF\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"one_effect_per_line\": false, \"separator\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy0", | |
| "type": "tool", | |
| "uuid": "5aca2952-a87c-4c77-a259-a22daceab557", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "chrom_pos_ref_called_variants", | |
| "output_name": "output", | |
| "uuid": "555dff08-7ce6-4d48-b00f-2c4143f83489" | |
| } | |
| ] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_extractFields/4.3+t.galaxy0", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "input": { | |
| "id": 11, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpSift Extract Fields", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "SnpSift Extract Fields", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 673.9500122070312, | |
| "top": 899.0 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Filter-failed variants - CHROM_POS_REF" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_extractFields/4.3+t.galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"empty_text\": \"\", \"extract\": \"CHROM POS REF\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"one_effect_per_line\": false, \"separator\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy0", | |
| "type": "tool", | |
| "uuid": "d99d1a1a-24a7-4379-a7d1-1980303ee08a", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "chrom_pos_ref_failed_variants", | |
| "output_name": "output", | |
| "uuid": "13574d4b-8c55-4c2f-a5da-76b82ed31deb" | |
| } | |
| ] | |
| }, | |
| "15": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", | |
| "errors": null, | |
| "id": 15, | |
| "input_connections": { | |
| "input": { | |
| "id": 13, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Compute", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Compute", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1148.1333618164062, | |
| "top": 249.64999389648438 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionout_file1": { | |
| "action_arguments": { | |
| "newtype": "bed" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "out_file1" | |
| }, | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "Called variant sites" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "6595517c2dd8", | |
| "name": "column_maker", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": false, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--skip-non-computable\", \"__current_case__\": 1}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"int(c2) - (len(c3) == 1)\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"2\"}}, {\"__index__\": 1, \"cond\": \"int(c2) + ((len(c3) - 1) or 1)\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"3\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.0", | |
| "type": "tool", | |
| "uuid": "fd260e32-723d-4a22-8d64-4795557f8159", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "called_variant_sites", | |
| "output_name": "out_file1", | |
| "uuid": "0033def6-7531-40b6-8b01-d16a18726fe4" | |
| } | |
| ] | |
| }, | |
| "16": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", | |
| "errors": null, | |
| "id": 16, | |
| "input_connections": { | |
| "input": { | |
| "id": 14, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Compute", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Compute", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 901.6166381835938, | |
| "top": 919.1500244140625 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionout_file1": { | |
| "action_arguments": { | |
| "newtype": "bed" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "out_file1" | |
| }, | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "Filter-failed variant sites" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "6595517c2dd8", | |
| "name": "column_maker", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": false, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--skip-non-computable\", \"__current_case__\": 1}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"int(c2) - (len(c3) == 1)\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"2\"}}, {\"__index__\": 1, \"cond\": \"int(c2) + ((len(c3) - 1) or 1)\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"3\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.0", | |
| "type": "tool", | |
| "uuid": "116e8e99-53ca-4366-a7e1-e3a9fb0bcfc3", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "failed_variant_sites", | |
| "output_name": "out_file1", | |
| "uuid": "8ba74008-5f23-4b79-993b-ae8ddac44456" | |
| } | |
| ] | |
| }, | |
| "17": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/concat/gops_concat_1/1.0.1", | |
| "errors": null, | |
| "id": 17, | |
| "input_connections": { | |
| "input1": { | |
| "id": 12, | |
| "output_name": "out_file1" | |
| }, | |
| "input2": { | |
| "id": 16, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Concatenate", | |
| "name": "input1" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Concatenate", | |
| "name": "input2" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Concatenate", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1468.8833618164062, | |
| "top": 537.4166870117188 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Cocatenated low-coverage regions and filter-failed sites" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/concat/gops_concat_1/1.0.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "73ca13a7ec5f", | |
| "name": "concat", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"input2\": {\"__class__\": \"ConnectedValue\"}, \"sameformat\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.1", | |
| "type": "tool", | |
| "uuid": "2b7570fb-9ce5-4a9a-863c-e33efbc88912", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "low_cov_regions_plus_filter_failed", | |
| "output_name": "output", | |
| "uuid": "aff4b045-799f-4337-a8e6-af87be35bda3" | |
| } | |
| ] | |
| }, | |
| "18": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/merge/gops_merge_1/1.0.0", | |
| "errors": null, | |
| "id": 18, | |
| "input_connections": { | |
| "input1": { | |
| "id": 17, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Merge", | |
| "name": "input1" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Merge", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1703.3167114257812, | |
| "top": 533.6666870117188 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionoutput": { | |
| "action_arguments": { | |
| "newtype": "bed" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Combined low-coverage regions and filter-failed sites" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/merge/gops_merge_1/1.0.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "debffd27642d", | |
| "name": "merge", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"returntype\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "3e63167b-6560-4b6d-a409-7d3707039222", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "low_cov_regions_plus_filter_failed_combined", | |
| "output_name": "output", | |
| "uuid": "8db1e8f6-9f76-4fd0-b6c9-10eeada9f8c4" | |
| } | |
| ] | |
| }, | |
| "19": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/subtract/gops_subtract_1/1.0.0", | |
| "errors": null, | |
| "id": 19, | |
| "input_connections": { | |
| "input1": { | |
| "id": 18, | |
| "output_name": "output" | |
| }, | |
| "input2": { | |
| "id": 15, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Subtract", | |
| "name": "input1" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Subtract", | |
| "name": "input2" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Subtract", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1959.4666137695312, | |
| "top": 408.0 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Masking regions" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/subtract/gops_subtract_1/1.0.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "0427ca314f3d", | |
| "name": "subtract", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"input2\": {\"__class__\": \"ConnectedValue\"}, \"min\": \"1\", \"returntype\": \"-p\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "51b26960-4ee7-4a3d-96cb-a6b3950c173e", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "masking_regions", | |
| "output_name": "output", | |
| "uuid": "1bdf0a04-75d5-4b7b-bd52-880a869548a1" | |
| } | |
| ] | |
| }, | |
| "20": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", | |
| "errors": null, | |
| "id": 20, | |
| "input_connections": { | |
| "input": { | |
| "id": 19, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Compute", | |
| "name": "input" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Compute", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2144.8333129882812, | |
| "top": 585.6666870117188 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionout_file1": { | |
| "action_arguments": { | |
| "newtype": "interval" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "out_file1" | |
| }, | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "1-based masking regions" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "6595517c2dd8", | |
| "name": "column_maker", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"int(c2) + 1\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"2\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.0", | |
| "type": "tool", | |
| "uuid": "e06fe045-f0f0-4c32-80ad-a8e070946a2f", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "1_based_masking_regions", | |
| "output_name": "out_file1", | |
| "uuid": "dc85cc18-db50-4c90-97d7-58eb5dcad70b" | |
| } | |
| ] | |
| }, | |
| "21": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_consensus/bcftools_consensus/1.15.1+galaxy3", | |
| "errors": null, | |
| "id": 21, | |
| "input_connections": { | |
| "input_file": { | |
| "id": 10, | |
| "output_name": "output" | |
| }, | |
| "reference_source|fasta_ref": { | |
| "id": 5, | |
| "output_name": "output" | |
| }, | |
| "sec_default|mask": { | |
| "id": 20, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bcftools consensus", | |
| "name": "input_file" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools consensus", | |
| "name": "reference_source" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools consensus", | |
| "name": "sec_default" | |
| } | |
| ], | |
| "label": null, | |
| "name": "bcftools consensus", | |
| "outputs": [ | |
| { | |
| "name": "output_file", | |
| "type": "fasta" | |
| } | |
| ], | |
| "position": { | |
| "left": 2603.8333129882812, | |
| "top": 243.66668701171875 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput_file": { | |
| "action_arguments": { | |
| "newname": "Consensus sequence with masking" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_file" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_consensus/bcftools_consensus/1.15.1+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "147de996e34f", | |
| "name": "bcftools_consensus", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"absent\": \"\", \"chain\": false, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"fasta_ref\": {\"__class__\": \"ConnectedValue\"}}, \"rename\": true, \"sec_default\": {\"mask\": {\"__class__\": \"ConnectedValue\"}, \"iupac_codes\": false, \"sample\": \"\", \"select_haplotype\": null, \"mark_del\": \"\", \"mark_ins\": null, \"mark_snv\": null, \"conditional_mask\": {\"selector\": \"disabled\", \"__current_case__\": 0}}, \"sec_restrict\": {\"include\": \"\", \"exclude\": \"\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.15.1+galaxy3", | |
| "type": "tool", | |
| "uuid": "698a9a8c-f6fe-430b-a7e0-cf9e1d058d02", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "consensus", | |
| "output_name": "output_file", | |
| "uuid": "5e1e40be-fab7-4592-82b4-a02536f618ef" | |
| } | |
| ] | |
| }, | |
| "22": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "errors": null, | |
| "id": 22, | |
| "input_connections": { | |
| "input_list": { | |
| "id": 21, | |
| "output_name": "output_file" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Collapse Collection", | |
| "name": "input_list" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Collapse Collection", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2863.5000610351562, | |
| "top": 267.5 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Multisample consensus FASTA" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "90981f86000f", | |
| "name": "collapse_collections", | |
| "owner": "nml", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filename\": {\"add_name\": false, \"__current_case__\": 1}, \"input_list\": {\"__class__\": \"ConnectedValue\"}, \"one_header\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "5.1.0", | |
| "type": "tool", | |
| "uuid": "acae0f3e-448b-483e-a44a-3e09ce9b3e77", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "multisample_consensus_fasta", | |
| "output_name": "output", | |
| "uuid": "105f13c3-9c94-4924-b950-9526d680562f" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "COVID-19", | |
| "covid19.galaxyproject.org" | |
| ], | |
| "uuid": "06dc40a7-99f2-4b3c-ae21-b3dcb239306f" | |
| }, | |
| "updated": "2024-12-03T18:32:54.036695", | |
| "readme": "COVID-19: consensus construction\n--------------------------------\n\nThis workflow aims at generating reliable consensus sequences from variant\ncalls according to transparent criteria that capture at least some of the\ncomplexity of variant calling.\n\nIt takes a collection of VCFs (with DP and DP4 INFO fields) and a collection of\nthe corresponding aligned reads (for the purpose of calculating genome-wide\ncoverage) such as produced by any of the variant calling workflows in\nhttps://github.com/galaxyproject/iwc/tree/main/workflows/sars-cov-2-variant-calling\nand generates a collection of viral consensus sequences and a multisample FASTA\nof all these sequences.\n\nEach consensus sequence is guaranteed to capture all called, filter-passing (as\nper the FILTER column of the VCF input) variants found in the VCF of its sample\nthat reach a user-defined consensus allele frequency threshold.\n\nFilter-failing variants and variants below a second user-defined minimal\nallele frequency threshold will be ignored.\n\nGenomic positions of filter-passing variants with an allele frequency in\nbetween the two thresholds will be hard-masked (with N) in the consensus\nsequence of their sample.\n\nGenomic positions with a coverage (calculated from the read alignments input)\nbelow another user-defined threshold will be hard-masked, too, unless they are\nconsensus variant sites.\n", | |
| "changelog": "# Changelog\n\n## [0.4.2] 2024-03-06\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.29.2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bcftools_consensus/bcftools_consensus/1.15.1+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bcftools_consensus/bcftools_consensus/1.15.1+galaxy3`\n\n## [0.4.1] 2023-11-20\n\n- Fix author in dockstore\n\n## [0.4] 2022-10-21\n\n### Fixed\n- Restored original functionality that was dropped accidentally in release 0.2:\n\n when there are zero consensus variants to be integrated into the reference\n genome (input VCF with no variants), bcftools consensus 1.10 would silently\n skip processing of that sequence *including the incorpartion of masking\n regions* into the final consensus genome. As a result, a genome covered by\n few or no reads at all would have its consensus sequence reported as\n all-reference instead of all Ns.\n The initial release of the workflow worked around this problem by\n pre-masking the reference before passing it to bcftools consensus, but the\n corresponding step was dropped as seemingly redundant in release 0.2.\n\n With v1.14, the edge case behavior with zero variants in the input VCF has\n been fixed as a bug in bcftools consensus\n (https://github.com/samtools/bcftools/issues/1592)\n so the workflow fix in this release consists of a simple update to bcftools\n consensus 1.15.1.\n\n### Changed\n- Upgraded to new, more flexible version of column_maker tool.\n\n This change allows a simplification of the workflow, which now uses five\n steps less for producing identical results.\n\n- Updated bcftools consensus to v1.15.1.\n\n## [0.3] 2022-02-02\n\n### Fixed\n- Apply AF thresholds on unbiased AF values recalculated from DP4 and DP fields\n instead of on AF values provided by the variant caller to ensure proper\n variant gating (into consensus and ambiguous variants) for lofreq-called\n data.\n\n https://github.com/CSB5/lofreq/issues/80 means that lofreq-calculated AF\n values are lower bounds of true AFs when bases are excluded from calling\n based on base quality. The extent of AF underestimation depends on the\n fraction of bases with sub-threshold (30 for this workflow) base qualities.\n\n By recalculating AFs as (DP4[2] + DP4[3]) / DP we avoid this issue for\n variant calls generated by lofreq. For variants called with Galaxy's medaka\n consensus/variant wrappers, original AFs are computed with the exact same\n formula so the recalculation by the workflow does not affect variant gating\n in that case.\n\n### Changed\n- Increase the default for consensus variant allele frequency threshold to 0.75.\n Correct calculation of unbiased AF values increases the typical AF of\n consensus variants more than enough to justify the change.\n- The following tools are updated to their latest wrapper versions or revisions:\n\n - bcftools_consensus\n - collapse_collections\n - the gops subtract and merge tools\n - snpsift\n\n None of these updates are expected to impact the generated consensus\n sequences.\n\n## [0.2.2] 2021-12-13\n\n### Added\n- Added GitHub Actions workflow. No functional changes.\n\n## [0.2.1] 2021-07-23\n\n### Added\n\nAdded RO-Crate metadata file. No functional changes.\n\n## [0.2] - 2021-04-30\n\n### Changed\n- Lower the default for consensus variant allele frequency threshold to 0.7\n (from 0.8).\n This was empirically determined to capture a relevant number of variants at\n sites that are problematic to call.\n- Increase the default variant allele frequency threshold for ambiguous sites\n to 0.25 (from 0.2) to obtain somewhat cleaner consensus sequences.\n- Use *SnpSift extract*, instead of *VCFtoTab-delimited* followed by *Cut*, to\n generate required tabular views of variants in one step.\n- Eliminate the use of *bedtools MaskFastaBed*, which was redundant with\n specifying masking regions directly at the *bcftools consensus* step.\n- Reduce the number of processing steps further by changing result dataset\n types through post-job actions appropriately to avoid implicit conversions,\n and by avoiding a redundant *SnpSift filter* step.\n\n### Fixed\n- Deletions are now reliably incorporated into the consensus sequence.\n Before they were, in most cases, N-masked because of low coverage in the\n deleted region.\n- Generally, each consensus sequence is now guaranteed to capture all consensus\n variants of its samples as stated in the README, independent of it residing\n in low-coverage regions or not.\n\n## [0.1]\n\n- Initial version of COVID-19: consensus construction\n", | |
| "diagrams": "# Workflow diagrams\n\n## COVID-19: consensus construction\n\n```mermaid\ngraph LR\n0[\"ℹ️ Variant calls\"]@{ shape: docs }\n1[\"ℹ️ min-AF for consensus variant\"]@{ shape: lean-l }\n2[\"ℹ️ min-AF for failed variants\"]@{ shape: lean-l }\n3[\"ℹ️ aligned reads data for depth calculation\"]@{ shape: docs }\n4[\"ℹ️ Depth-threshold for masking\"]@{ shape: lean-l }\n5[\"ℹ️ Reference genome\"]@{ shape: doc }\n6[\"Compose text parameter value\"]@{ shape: process }\n1 --> 6\n7[\"Compose text parameter value\"]@{ shape: process }\n2 --> 7\n1 --> 7\n8[\"bedtools Genome Coverage\"]@{ shape: process }\n3 --> 8\n9[\"Compose text parameter value\"]@{ shape: process }\n4 --> 9\n10[\"SnpSift Filter\"]@{ shape: process }\n6 --> 10\n0 --> 10\n11[\"SnpSift Filter\"]@{ shape: process }\n7 --> 11\n0 --> 11\n12[\"Filter\"]@{ shape: process }\n9 --> 12\n8 --> 12\n13[\"SnpSift Extract Fields\"]@{ shape: process }\n10 --> 13\n14[\"SnpSift Extract Fields\"]@{ shape: process }\n11 --> 14\n15[\"Compute\"]@{ shape: process }\n13 --> 15\n16[\"Compute\"]@{ shape: process }\n14 --> 16\n17[\"Concatenate\"]@{ shape: process }\n12 --> 17\n16 --> 17\n18[\"Merge\"]@{ shape: process }\n17 --> 18\n19[\"Subtract\"]@{ shape: process }\n18 --> 19\n15 --> 19\n20[\"Compute\"]@{ shape: process }\n19 --> 20\n21[\"bcftools consensus\"]@{ shape: process }\n10 --> 21\n5 --> 21\n20 --> 21\n22[\"Collapse Collection\"]@{ shape: process }\n21 --> 22\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/sars-cov-2-consensus-from-variation/COVID-19-CONSENSUS-CONSTRUCTION", | |
| "dockstore_id": 16546, | |
| "categories": [ | |
| "COVID-19" | |
| ], | |
| "collections": [ | |
| "SARS-COV-2" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test consensus building from called variants", | |
| "job": { | |
| "Reference genome": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/4555735/files/NC_045512.2_reference.fasta?download=1" | |
| }, | |
| "aligned reads data for depth calculation": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "identifier": "SRR11578257", | |
| "class": "File", | |
| "path": "test-data/aligned_reads_for_coverage.bam" | |
| } | |
| ] | |
| }, | |
| "Variant calls": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "identifier": "SRR11578257", | |
| "class": "File", | |
| "path": "test-data/final_snpeff_annotated_variants.vcf" | |
| } | |
| ] | |
| } | |
| }, | |
| "outputs": { | |
| "multisample_consensus_fasta": { | |
| "file": "test-data/masked_consensus.fa" | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/sars-cov-2-variant-calling/sars-cov-2-consensus-from-variation" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "COVID-19-VARIATION-REPORTING", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/variation-reporting.ga", | |
| "testParameterFiles": [ | |
| "/variation-reporting-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Wolfgang Maier", | |
| "orcid": "0000-0002-9464-6640" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow takes a VCF dataset of variants produced by any of the *-variant-calling workflows in https://github.com/galaxyproject/iwc/tree/main/workflows/sars-cov-2-variant-calling and generates tabular lists of variants by Samples and by Variant, and an overview plot of variants and their allele-frequencies.", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-9464-6640", | |
| "name": "Wolfgang Maier" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "name": "COVID-19: variation analysis reporting", | |
| "release": "0.3.4", | |
| "steps": { | |
| "0": { | |
| "annotation": "Variation data in VCF format. Can be the output of any of the workflows in https://github.com/galaxyproject/iwc/tree/main/workflows/sars-cov-2-variant-calling", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Variation data in VCF format. Can be the output of any of the workflows in https://github.com/galaxyproject/iwc/tree/main/workflows/sars-cov-2-variant-calling", | |
| "name": "Variation data to report" | |
| } | |
| ], | |
| "label": "Variation data to report", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 10.28125, | |
| "top": 34.08333333333334 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"vcf\", \"vcf_bgzip\"], \"tag\": null, \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "577438f0-38b1-4fc1-9145-935566d62347", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Allele Frequency Filter. This is the minimum allele frequency required for variants to be included in the reports.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Allele Frequency Filter. This is the minimum allele frequency required for variants to be included in the reports.", | |
| "name": "AF Filter" | |
| } | |
| ], | |
| "label": "AF Filter", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 5.3125, | |
| "top": 186.91145833333331 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 0.05, \"parameter_type\": \"float\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "2e5a5b38-c204-45a2-98e2-e113bce5a14b", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "af_filter_threshold", | |
| "output_name": "output", | |
| "uuid": "e55d47c5-7ea0-45c4-8844-47bf29b88542" | |
| } | |
| ] | |
| }, | |
| "2": { | |
| "annotation": "Depth Filter. This is the minimum depth of all alignments at a variant site. ", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Depth Filter. This is the minimum depth of all alignments at a variant site. ", | |
| "name": "DP Filter" | |
| } | |
| ], | |
| "label": "DP Filter", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 0.78125, | |
| "top": 284.9270833333333 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 1, \"parameter_type\": \"integer\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "c7fc64c7-51c7-465b-9184-ca834d4cf6b2", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "dp_filter_threshold", | |
| "output_name": "output", | |
| "uuid": "220a9662-8b6f-4161-8539-ecb613b4892a" | |
| } | |
| ] | |
| }, | |
| "3": { | |
| "annotation": "Depth Filter for variant allele. This is the minimum depth of alignments supporting a variant.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Depth Filter for variant allele. This is the minimum depth of alignments supporting a variant.", | |
| "name": "DP_ALT Filter" | |
| } | |
| ], | |
| "label": "DP_ALT Filter", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 0.0, | |
| "top": 367.42708333333337 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 10, \"parameter_type\": \"integer\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "145bbc55-8893-413d-9620-f3d85e65527a", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "dp_alt_filter_threshold", | |
| "output_name": "output", | |
| "uuid": "7f7b09f6-e4e5-43af-881b-f336906bcb91" | |
| } | |
| ] | |
| }, | |
| "4": { | |
| "annotation": "A custom tabular file mapping NCBI RefSeq Protein identifiers as used by snpEff version 4.5covid19 to their commonly used names. Can be obtained from https://doi.org/10.5281/zenodo.4555734", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "A custom tabular file mapping NCBI RefSeq Protein identifiers as used by snpEff version 4.5covid19 to their commonly used names. Can be obtained from https://doi.org/10.5281/zenodo.4555734", | |
| "name": "gene products translations" | |
| } | |
| ], | |
| "label": "gene products translations", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "left": 690.015625, | |
| "top": 38.41145833333334 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"tabular\"], \"tag\": null}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "8b89e674-9012-4f66-a59a-ce05d2fe4223", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "Number of Clusters to use in Variant Frequency Plot.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Number of Clusters to use in Variant Frequency Plot.", | |
| "name": "Number of Clusters" | |
| } | |
| ], | |
| "label": "Number of Clusters", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 3413.578125, | |
| "top": 671.9114583333334 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 1, \"parameter_type\": \"integer\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "5ca7b1a7-e1ee-4b52-aab4-eaf23949e1da", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "plot_number_of_clusters", | |
| "output_name": "output", | |
| "uuid": "c02cc297-3f36-4f78-bede-3aa378436672" | |
| } | |
| ] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "SnpSift Filter", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 246.65625, | |
| "top": 32.08333333333334 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": \"DP >= 1\"}, \"filtering\": {\"mode\": \"entries\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy1", | |
| "type": "tool", | |
| "uuid": "386eb313-89c1-47df-bd3d-976780eff740", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "prefiltered_variants", | |
| "output_name": "output", | |
| "uuid": "498b63d3-2449-4633-b9a4-360553d14844" | |
| } | |
| ] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 1, | |
| "output_name": "output" | |
| }, | |
| "components_3|param_type|component_value": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "components_5|param_type|component_value": { | |
| "id": 3, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 245.0, | |
| "top": 156.36458333333331 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"( ( DP4[2] + DP4[3] ) < ( \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" * DP ) ) | ( DP < \"}}, {\"__index__\": 3, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" ) | ( ( AF * DP ) < ( \"}}, {\"__index__\": 5, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 6, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \" - 0.5 ) )\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "ec1a4872-b9bc-41f0-8675-1f26fdd19f16", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 1, | |
| "output_name": "output" | |
| }, | |
| "components_3|param_type|component_value": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "components_5|param_type|component_value": { | |
| "id": 3, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 241.71875, | |
| "top": 463.83333333333337 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"min_af_\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"|min_dp_\"}}, {\"__index__\": 3, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"|min_dp_alt_\"}}, {\"__index__\": 5, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "c9916563-c914-4f5f-90c6-d6c7619e1a98", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "filter_expression|expr": { | |
| "id": 7, | |
| "output_name": "out1" | |
| }, | |
| "filtering|add_filter": { | |
| "id": 8, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 6, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "filter_expression" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpSift Filter", | |
| "name": "filtering" | |
| } | |
| ], | |
| "label": null, | |
| "name": "SnpSift Filter", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "left": 477.421875, | |
| "top": 322.0677083333333 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Filtered variants" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": {\"__class__\": \"ConnectedValue\"}}, \"filtering\": {\"mode\": \"add_filter\", \"__current_case__\": 3, \"add_filter\": {\"__class__\": \"ConnectedValue\"}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy1", | |
| "type": "tool", | |
| "uuid": "9a6cb40d-476b-4096-adcc-cb601398d0b4", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "filtered_variants", | |
| "output_name": "output", | |
| "uuid": "d6db8dad-1774-4ec8-a858-26b17a287252" | |
| } | |
| ] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_extractFields/4.3+t.galaxy0", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "input": { | |
| "id": 9, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "SnpSift Extract Fields", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 713.4375, | |
| "top": 219.05208333333331 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Filtered extracted variants" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_extractFields/4.3+t.galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5fab4f81391d", | |
| "name": "snpsift", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"empty_text\": \".\", \"extract\": \"CHROM POS FILTER REF ALT DP AF DP4 SB EFF[*].IMPACT EFF[*].FUNCLASS EFF[*].EFFECT EFF[*].GENE EFF[*].CODON EFF[*].AA EFF[*].TRID DP4[2] DP4[3]\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"one_effect_per_line\": true, \"separator\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.3+t.galaxy0", | |
| "type": "tool", | |
| "uuid": "085e8f20-3eea-4d97-8e52-6e8a9aa3fbd7", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "filtered_extracted_variants", | |
| "output_name": "output", | |
| "uuid": "578ee06f-e803-42e2-8afe-b9e88f465cdb" | |
| } | |
| ] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/replace_column_by_key_value_file/replace_column_with_key_value_file/0.2", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "original_file": { | |
| "id": 10, | |
| "output_name": "output" | |
| }, | |
| "replace_information": { | |
| "id": 4, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Replace column", | |
| "outputs": [ | |
| { | |
| "name": "outfile_replace", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 944.3125, | |
| "top": 83.03645833333331 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionoutfile_replace": { | |
| "action_arguments": { | |
| "newtype": "tabular" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "outfile_replace" | |
| }, | |
| "RenameDatasetActionoutfile_replace": { | |
| "action_arguments": { | |
| "newname": "Extracted variants with filtered and renamed effects" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile_replace" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/replace_column_by_key_value_file/replace_column_with_key_value_file/0.2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "d533e4b75800", | |
| "name": "replace_column_by_key_value_file", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"column_replace\": \"16\", \"delimiter\": \"tab\", \"original_file\": {\"__class__\": \"ConnectedValue\"}, \"pass_comments\": \"#\", \"replace_information\": {\"__class__\": \"ConnectedValue\"}, \"skip_lines\": \"1\", \"unknowns_strategy\": \"skip\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.2", | |
| "type": "tool", | |
| "uuid": "0850f6d5-ff1f-47f9-8e49-b7eb5782828a", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "filtered_and_renamed_effects", | |
| "output_name": "outfile_replace", | |
| "uuid": "25460c36-c35c-4233-97ba-ec0a7aec39e4" | |
| } | |
| ] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "input": { | |
| "id": 11, | |
| "output_name": "outfile_replace" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compute", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1164.734375, | |
| "top": 240.34895833333331 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "Extracted variants with filtered and renamed effects and AF recalculated" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "aff5135563c6", | |
| "name": "column_maker", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"yes\", \"__current_case__\": 1, \"expressions\": [{\"__index__\": 0, \"cond\": \"c7\", \"add_column\": {\"mode\": \"I\", \"__current_case__\": 1, \"pos\": \"8\"}, \"new_column_name\": \"AFcaller\"}, {\"__index__\": 1, \"cond\": \"round((c18 + c19) / c6, 6)\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"7\"}, \"new_column_name\": \"AF\"}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1", | |
| "type": "tool", | |
| "uuid": "c457f29e-dea5-449a-84c4-4b192da88257", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "af_recalculated", | |
| "output_name": "out_file1", | |
| "uuid": "86d866eb-b5ff-409c-aaee-d23deac15a47" | |
| } | |
| ] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "in_file": { | |
| "id": 12, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Datamash", | |
| "outputs": [ | |
| { | |
| "name": "out_file", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1331.15625, | |
| "top": 20.583333333333343 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionout_file": { | |
| "action_arguments": { | |
| "newname": "Collapsed effects (Datamash on all variants)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4c07ddedc198", | |
| "name": "datamash_ops", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"grouping\": \"1,2,3,4,5,6,7,8,9,10\", \"header_in\": true, \"header_out\": true, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"collapse\", \"op_column\": \"11\"}, {\"__index__\": 1, \"op_name\": \"collapse\", \"op_column\": \"12\"}, {\"__index__\": 2, \"op_name\": \"collapse\", \"op_column\": \"13\"}, {\"__index__\": 3, \"op_name\": \"collapse\", \"op_column\": \"14\"}, {\"__index__\": 4, \"op_name\": \"collapse\", \"op_column\": \"15\"}, {\"__index__\": 5, \"op_name\": \"collapse\", \"op_column\": \"16\"}, {\"__index__\": 6, \"op_name\": \"collapse\", \"op_column\": \"17\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.8+galaxy0", | |
| "type": "tool", | |
| "uuid": "ec8aca39-fe1f-404a-9460-7a960cec37e6", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "collapsed_effects", | |
| "output_name": "out_file", | |
| "uuid": "995044cd-d883-451e-b8a0-6905967f636b" | |
| } | |
| ] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "infile": { | |
| "id": 13, | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Replace", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1681.234375, | |
| "top": 0.0 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "Extracted variants with highest impact effects" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"find_and_replace\": [{\"__index__\": 0, \"find_pattern\": \"\\\\t([^\\\\t,]+),[^\\\\t]+\\\\t([^\\\\t,]+),[^\\\\t]+\\\\t([^\\\\t,]+),[^\\\\t]+\\\\t([^\\\\t,]+),[^\\\\t]+\\\\t([^\\\\t,]+),[^\\\\t]+\\\\t([^\\\\t,]+),[^\\\\t]+\\\\t([^\\\\t,]+),[^\\\\s]+\", \"replace_pattern\": \"\\\\t$1\\\\t$2\\\\t$3\\\\t$4\\\\t$5\\\\t$6\\\\t$7\", \"is_regex\": true, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": true, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}, {\"__index__\": 1, \"find_pattern\": \"(GroupBy|collapse)\\\\(([^)]+)\\\\)\", \"replace_pattern\": \"$2\", \"is_regex\": true, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": false, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}], \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "25f665b6-2b6a-49a3-a395-29706cd772ab", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "highest_impact_effects", | |
| "output_name": "outfile", | |
| "uuid": "689eb8e9-393c-4d2f-8ab6-98bcfc07892d" | |
| } | |
| ] | |
| }, | |
| "15": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "errors": null, | |
| "id": 15, | |
| "input_connections": { | |
| "input_list": { | |
| "id": 14, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Collapse Collection", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1982.5, | |
| "top": 28.067708333333343 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "90981f86000f", | |
| "name": "collapse_collections", | |
| "owner": "nml", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filename\": {\"add_name\": true, \"__current_case__\": 0, \"place_name\": \"same_multiple\"}, \"input_list\": {\"__class__\": \"ConnectedValue\"}, \"one_header\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "5.1.0", | |
| "type": "tool", | |
| "uuid": "e5459c74-11e1-45a5-beee-88c2dde61eab", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "16": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", | |
| "errors": null, | |
| "id": 16, | |
| "input_connections": { | |
| "input": { | |
| "id": 15, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compute", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2227.890625, | |
| "top": 212.38020833333331 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "aff5135563c6", | |
| "name": "column_maker", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": false, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"yes\", \"__current_case__\": 1, \"expressions\": [{\"__index__\": 0, \"cond\": \"c5 + '>' + c6\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}, \"new_column_name\": \"change\"}, {\"__index__\": 1, \"cond\": \"c3 + ':' + c19\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}, \"new_column_name\": \"change_with_pos\"}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1", | |
| "type": "tool", | |
| "uuid": "cc8a768f-8078-4bdd-ae98-903f08619070", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "17": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1", | |
| "errors": null, | |
| "id": 17, | |
| "input_connections": { | |
| "infile": { | |
| "id": 16, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Replace", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2434.0625, | |
| "top": 80.17708333333331 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "All variants of all samples" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"find_and_replace\": [{\"__index__\": 0, \"find_pattern\": \"EFF[*].\", \"replace_pattern\": \"\", \"is_regex\": false, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": false, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}], \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "82276b6c-5c6e-49eb-8ee5-46041c273d30", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "all_variants_all_samples", | |
| "output_name": "outfile", | |
| "uuid": "708f0b5e-2bc0-4a08-96e2-d590517c7ac9" | |
| } | |
| ] | |
| }, | |
| "18": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "errors": null, | |
| "id": 18, | |
| "input_connections": { | |
| "in_file": { | |
| "id": 17, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Datamash", | |
| "outputs": [ | |
| { | |
| "name": "out_file", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2685.328125, | |
| "top": 31.598958333333343 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4c07ddedc198", | |
| "name": "datamash_ops", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"grouping\": \"20\", \"header_in\": true, \"header_out\": true, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": true, \"operations\": [{\"__index__\": 0, \"op_name\": \"countunique\", \"op_column\": \"1\"}, {\"__index__\": 1, \"op_name\": \"min\", \"op_column\": \"8\"}, {\"__index__\": 2, \"op_name\": \"max\", \"op_column\": \"8\"}, {\"__index__\": 3, \"op_name\": \"collapse\", \"op_column\": \"1\"}, {\"__index__\": 4, \"op_name\": \"collapse\", \"op_column\": \"8\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.8+galaxy0", | |
| "type": "tool", | |
| "uuid": "c40528c9-4fed-48c8-9c34-be2cf2c32745", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "19": { | |
| "annotation": "", | |
| "content_id": "Filter1", | |
| "errors": null, | |
| "id": 19, | |
| "input_connections": { | |
| "input": { | |
| "id": 17, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Filter", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2678.125, | |
| "top": 244.73958333333331 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Filter1", | |
| "tool_state": "{\"cond\": \"c4=='PASS' or c4=='.'\", \"header_lines\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "c02e3958-04f4-499e-b78e-f304e0fdaeed", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "20": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "errors": null, | |
| "id": 20, | |
| "input_connections": { | |
| "in_file": { | |
| "id": 17, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Datamash", | |
| "outputs": [ | |
| { | |
| "name": "out_file", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2969.03125, | |
| "top": 441.66145833333337 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file" | |
| }, | |
| "RenameDatasetActionout_file": { | |
| "action_arguments": { | |
| "newname": "Cross-sample variant stats (Datamash)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4c07ddedc198", | |
| "name": "datamash_ops", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"grouping\": \"3\", \"header_in\": true, \"header_out\": true, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": true, \"operations\": [{\"__index__\": 0, \"op_name\": \"countunique\", \"op_column\": \"1\"}, {\"__index__\": 1, \"op_name\": \"min\", \"op_column\": \"8\"}, {\"__index__\": 2, \"op_name\": \"max\", \"op_column\": \"8\"}, {\"__index__\": 3, \"op_name\": \"countunique\", \"op_column\": \"19\"}, {\"__index__\": 4, \"op_name\": \"countunique\", \"op_column\": \"13\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.8+galaxy0", | |
| "type": "tool", | |
| "uuid": "a9af0104-3e05-48cb-9650-36f58d174cdf", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "21": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 21, | |
| "input_connections": { | |
| "infile1": { | |
| "id": 19, | |
| "output_name": "out_file1" | |
| }, | |
| "infile2": { | |
| "id": 18, | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Join", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2926.71875, | |
| "top": 51.98958333333334 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Filtered variants of all samples with stats" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"column1\": \"20\", \"column2\": \"1\", \"empty_string_filler\": \"0\", \"header\": true, \"ignore_case\": false, \"infile1\": {\"__class__\": \"ConnectedValue\"}, \"infile2\": {\"__class__\": \"ConnectedValue\"}, \"jointype\": \" \", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "7e27aac8-1d1e-4d82-88e3-59c4cd61baeb", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "22": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "errors": null, | |
| "id": 22, | |
| "input_connections": { | |
| "in_file": { | |
| "id": 19, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Datamash", | |
| "outputs": [ | |
| { | |
| "name": "out_file", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2935.140625, | |
| "top": 312.1458333333333 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4c07ddedc198", | |
| "name": "datamash_ops", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"grouping\": \"3\", \"header_in\": true, \"header_out\": true, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": true, \"operations\": [{\"__index__\": 0, \"op_name\": \"countunique\", \"op_column\": \"1\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.8+galaxy0", | |
| "type": "tool", | |
| "uuid": "fac0bae2-3415-4aa3-a5f5-7950ea411d98", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "23": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "errors": null, | |
| "id": 23, | |
| "input_connections": { | |
| "in_file": { | |
| "id": 19, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Datamash", | |
| "outputs": [ | |
| { | |
| "name": "out_file", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2900.640625, | |
| "top": 646.4114583333334 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4c07ddedc198", | |
| "name": "datamash_ops", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"grouping\": \"20\", \"header_in\": true, \"header_out\": true, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": true, \"operations\": [{\"__index__\": 0, \"op_name\": \"countunique\", \"op_column\": \"1\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.8+galaxy0", | |
| "type": "tool", | |
| "uuid": "90b934e8-ba30-49aa-9fa4-a371fdf71285", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "24": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "errors": null, | |
| "id": 24, | |
| "input_connections": { | |
| "in_file": { | |
| "id": 21, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Datamash", | |
| "outputs": [ | |
| { | |
| "name": "out_file", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3170.828125, | |
| "top": 15.098958333333343 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4c07ddedc198", | |
| "name": "datamash_ops", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"grouping\": \"1\", \"header_in\": true, \"header_out\": true, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": true, \"operations\": [{\"__index__\": 0, \"op_name\": \"unique\", \"op_column\": \"2\"}], \"print_full_line\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.8+galaxy0", | |
| "type": "tool", | |
| "uuid": "5ba44453-dabf-420f-a49e-2918eae031d3", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "25": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 25, | |
| "input_connections": { | |
| "infile1": { | |
| "id": 17, | |
| "output_name": "outfile" | |
| }, | |
| "infile2": { | |
| "id": 22, | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Join", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3172.890625, | |
| "top": 224.66145833333331 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"column1\": \"3\", \"column2\": \"1\", \"empty_string_filler\": \"0\", \"header\": true, \"ignore_case\": false, \"infile1\": {\"__class__\": \"ConnectedValue\"}, \"infile2\": {\"__class__\": \"ConnectedValue\"}, \"jointype\": \" \", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "3927af37-c003-4fac-a8af-88ba2b656b22", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "26": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 26, | |
| "input_connections": { | |
| "infile1": { | |
| "id": 16, | |
| "output_name": "out_file1" | |
| }, | |
| "infile2": { | |
| "id": 23, | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Join", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3130.890625, | |
| "top": 592.9270833333334 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"column1\": \"20\", \"column2\": \"1\", \"empty_string_filler\": \"0\", \"header\": true, \"ignore_case\": false, \"infile1\": {\"__class__\": \"ConnectedValue\"}, \"infile2\": {\"__class__\": \"ConnectedValue\"}, \"jointype\": \" \", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "472af513-7900-41a5-b049-feb2d630ad2c", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "27": { | |
| "annotation": "", | |
| "content_id": "Cut1", | |
| "errors": null, | |
| "id": 27, | |
| "input_connections": { | |
| "input": { | |
| "id": 24, | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Cut", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 3394.890625, | |
| "top": 119.89583333333331 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Cut1", | |
| "tool_state": "{\"columnList\": \"c4,c6,c7,c13,c14,c15,c16,c17,c18,c19,c21,c22,c23,c26,c24,c25,c20\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.2", | |
| "type": "tool", | |
| "uuid": "30858ca2-a64b-4841-9bb5-5de4d38350cb", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "28": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 28, | |
| "input_connections": { | |
| "infile1": { | |
| "id": 25, | |
| "output_name": "output" | |
| }, | |
| "infile2": { | |
| "id": 20, | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Join", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3390.921875, | |
| "top": 317.8177083333333 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Filtered variants of all samples with per-position stats" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"column1\": \"1\", \"column2\": \"1\", \"empty_string_filler\": \"0\", \"header\": true, \"ignore_case\": false, \"infile1\": {\"__class__\": \"ConnectedValue\"}, \"infile2\": {\"__class__\": \"ConnectedValue\"}, \"jointype\": \" \", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "1b250a36-d3ae-415e-9764-006182096a60", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "29": { | |
| "annotation": "", | |
| "content_id": "Cut1", | |
| "errors": null, | |
| "id": 29, | |
| "input_connections": { | |
| "input": { | |
| "id": 26, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Cut", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 3356.359375, | |
| "top": 528.6770833333334 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Cut1", | |
| "tool_state": "{\"columnList\": \"c2,c3,c4,c5,c6,c7,c8,c9,c11,c12,c13,c14,c15,c16,c17,c18,c19\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.2", | |
| "type": "tool", | |
| "uuid": "65a8b0dd-4b98-4646-bee8-a89f591816fb", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "30": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1", | |
| "errors": null, | |
| "id": 30, | |
| "input_connections": { | |
| "infile": { | |
| "id": 27, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Replace", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3604.359375, | |
| "top": 19.333333333333343 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutfile": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outfile" | |
| }, | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "All variants of all samples" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"find_and_replace\": [{\"__index__\": 0, \"find_pattern\": \"unique\\\\(Sample\\\\)\\\\tcollapse\\\\(Sample\\\\)\\\\tcollapse\\\\(AF\\\\)\", \"replace_pattern\": \"SAMPLES(above-thresholds)\\\\tSAMPLES(all)\\\\tAFs(all)\", \"is_regex\": true, \"global\": true, \"caseinsensitive\": false, \"wholewords\": false, \"skip_first_line\": false, \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}}], \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "6116c1c6-7c7c-43fe-9c91-609c91c6ed85", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "31": { | |
| "annotation": "", | |
| "content_id": "Cut1", | |
| "errors": null, | |
| "id": 31, | |
| "input_connections": { | |
| "input": { | |
| "id": 28, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Cut", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 3608.171875, | |
| "top": 344.31770833333337 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Cut1", | |
| "tool_state": "{\"columnList\": \"c2,c1,c4,c5,c6,c7,c8,c9,c11,c10,c12,c13,c14,c15,c16,c17,c18,c23,c24,c25,c26,c19\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.2", | |
| "type": "tool", | |
| "uuid": "a925b191-2cbc-4f45-b4cf-bbc25ba823d8", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "32": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", | |
| "errors": null, | |
| "id": 32, | |
| "input_connections": { | |
| "split_parms|input": { | |
| "id": 29, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Split file", | |
| "name": "split_parms" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Split file", | |
| "outputs": [ | |
| { | |
| "name": "list_output_tab", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3579.625, | |
| "top": 528.8489583333334 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionlist_output_tab": { | |
| "action_arguments": { | |
| "newname": "Per-sample variants for plotting" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "list_output_tab" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2dae863c8f42", | |
| "name": "split_file_to_collection", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"split_parms\": {\"select_ftype\": \"tabular\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}, \"top\": \"1\", \"split_by\": {\"select_split_by\": \"col\", \"__current_case__\": 0, \"id_col\": \"1\", \"match_regex\": \"(.*)\", \"sub_regex\": \"\\\\1\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.5.2", | |
| "type": "tool", | |
| "uuid": "9f938b6a-e7fb-4509-9c15-271c475092aa", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "variants_for_plotting", | |
| "output_name": "list_output_tab", | |
| "uuid": "6bed4a2c-611a-4dd7-92bd-df5f07f0b581" | |
| } | |
| ] | |
| }, | |
| "33": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 33, | |
| "input_connections": { | |
| "infile": { | |
| "id": 30, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Sort", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3826.890625, | |
| "top": 120.89583333333331 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "Combined Variant Report by Variant" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"header\": \"1\", \"ignore_case\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"sortkeys\": [{\"__index__\": 0, \"column\": \"1\", \"order\": \"\", \"style\": \"g\"}], \"unique\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "0b2f751b-03c6-4302-9060-16856bb4157c", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "by_variant_report", | |
| "output_name": "outfile", | |
| "uuid": "bbb19b95-70e3-43fb-baae-525f752b86e9" | |
| } | |
| ] | |
| }, | |
| "34": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 34, | |
| "input_connections": { | |
| "infile": { | |
| "id": 31, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Sort", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3830.6875, | |
| "top": 330.55208333333337 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "Combined Variant Report by Sample" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"header\": \"1\", \"ignore_case\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"sortkeys\": [{\"__index__\": 0, \"column\": \"1\", \"order\": \"\", \"style\": \"\"}, {\"__index__\": 1, \"column\": \"2\", \"order\": \"\", \"style\": \"n\"}], \"unique\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "e55320de-be51-4fa5-908e-76c03de24a77", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "combined_variant_report", | |
| "output_name": "outfile", | |
| "uuid": "3211bebc-9cdd-417b-b96d-d10cae6fd310" | |
| } | |
| ] | |
| }, | |
| "35": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpfreqplot/snpfreqplot/1.0+galaxy3", | |
| "errors": null, | |
| "id": 35, | |
| "input_connections": { | |
| "clustering|nclust": { | |
| "id": 5, | |
| "output_name": "output" | |
| }, | |
| "sinputs": { | |
| "id": 32, | |
| "output_name": "list_output_tab" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Variant Frequency Plot", | |
| "name": "clustering" | |
| } | |
| ], | |
| "label": null, | |
| "name": "Variant Frequency Plot", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "pdf" | |
| } | |
| ], | |
| "position": { | |
| "left": 3821.671875, | |
| "top": 596.9895833333334 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpfreqplot/snpfreqplot/1.0+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3d0adeee3f2b", | |
| "name": "snpfreqplot", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced\": {\"output_type\": \"svg\", \"ratio\": \"0.67\", \"color\": \"Set3\"}, \"clustering\": {\"do\": \"TRUE\", \"__current_case__\": 0, \"nclust\": {\"__class__\": \"ConnectedValue\"}, \"method\": \"ward.D2\"}, \"sinputs\": {\"__class__\": \"ConnectedValue\"}, \"varfreq\": \"0.0\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0+galaxy3", | |
| "type": "tool", | |
| "uuid": "583b8d59-2cc0-468e-a0b7-3b1a788c7613", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "variant_frequency_plot", | |
| "output_name": "outfile", | |
| "uuid": "986f1d1a-02c0-4d91-9f6e-a09a088732ee" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "COVID-19", | |
| "covid19.galaxyproject.org" | |
| ], | |
| "uuid": "b08c744d-7c61-4b58-ac5f-4b5886c3c643" | |
| }, | |
| "updated": "2024-12-03T18:32:54.042087", | |
| "readme": "COVID-19: variation analysis reporting\n--------------------------------------\n\nThis workflow takes VCF datasets of variants produced by any of the\n\"*-variant-calling\" workflows in\nhttps://github.com/galaxyproject/iwc/tree/main/workflows/sars-cov-2-variant-calling\nand generates tabular reports of variants by samples and by variant, along with\nan overview plot of variants and their allele-frequencies across all samples.\n", | |
| "changelog": "# Changelog\n\n## [0.3.4] 2024-09-24\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/9.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/9.3+galaxy1`\n\n## [0.3.2] 2023-11-28\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1`\n\n## [0.3.1] 2023-11-20\n\n- Fix author in dockstore\n\n## [0.3] 2022-10-13\n\n### Changed\n\n- Upgraded to new, more flexible version of column_maker tool.\n\n This change allows a simplification of the workflow, which now uses two\n steps less for producing identical results.\n\n- Upgraded to latest version of tp_find_and_replace tool, which can handle\n multiple substitutions per tool run. Saves another step in the workflow.\n\n- Upgraded datamash to its latest tool wrapper version.\n\nThese changes should not have any effects on results except this one:\n\n- the AFcaller column of the \"Combined Variant Report by Sample\" could\n previously contain values in scientific notation for very low allele\n frequencies (< 0.001). In the new version all values in the column will be\n reported consistently in regular floating point format.\n\n## [0.2] 2022-02-11\n\n### Changed\n\n- Altered the exact meaning of the user-supplied AF and DP_ALT thresholds\n\n The AF threshold is now compared against (DP4[2] + DP4[3]) / DP, i.e. the\n unbiased AF based on all bases at the site instead of against the AF reported\n by the variant caller (which in the case of lofreq would consider only\n variant-supporting bases >= the caller's --min-bq in the numerator).\n\n Conversely, the DP_ALT threshold is now compared against DP * AF (as reported\n by the variant caller), i.e. in the case of lofreq as the caller will\n consider only bases with >= --min-bq base quality.\n\n- Reported AF values in the by-sample and the by-variant reports are now\n unbiased AF values calculated from (DP4[2] + DP4[3]) / DP as explained above.\n\n The by-sample report reports the original AF value provided by the variant\n caller in an additional AFcaller column.\n\n- Tile colors in the variant frequency summary plot are now based on unbiased\n AF values.\n\n- An extra step removing potential called variants with a caller-reported\n DP of 0 has been added to avoid division by zero errors in the calculation\n of unbiased AF values.\n\n### Fixed\n\n- Reverted the autoupdated wrapper version change for the snpsift tools\n\n The autoupdate script had problems sorting their non-standard version strings\n correctly and downgraded these wrappers instead of upgrading them\n\n- Made sure only a single changeset revision of the text_processing tools is\n used in the workflow.\n\n## [0.1.3] 2022-02-04\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3.0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_extractFields/4.3+t.galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_extractFields/4.3.0`\n- `toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/4.2` was updated to `toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0`\n- `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.5` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6`\n\n## [0.1.2] 2021-12-13\n\n### Added\n- Added GitHub Actions workflow. No functional changes.\n\n## [0.1.1] 2021-07-23\n\n### Added\n\nAdded RO-Crate metadata file. No functional changes.\n\n## [0.1]\n\n- Initial version of COVID-19: variation analysis reporting\n", | |
| "diagrams": "# Workflow diagrams\n\n## COVID-19: variation analysis reporting\n\n```mermaid\ngraph LR\n0[\"ℹ️ Variation data to report\"]@{ shape: docs }\n1[\"ℹ️ AF Filter\"]@{ shape: lean-l }\n2[\"ℹ️ DP Filter\"]@{ shape: lean-l }\n3[\"ℹ️ DP_ALT Filter\"]@{ shape: lean-l }\n4[\"ℹ️ gene products translations\"]@{ shape: doc }\n5[\"ℹ️ Number of Clusters\"]@{ shape: lean-l }\n6[\"SnpSift Filter\"]@{ shape: process }\n0 --> 6\n7[\"Compose text parameter value\"]@{ shape: process }\n1 --> 7\n2 --> 7\n3 --> 7\n8[\"Compose text parameter value\"]@{ shape: process }\n1 --> 8\n2 --> 8\n3 --> 8\n9[\"SnpSift Filter\"]@{ shape: process }\n7 --> 9\n8 --> 9\n6 --> 9\n10[\"SnpSift Extract Fields\"]@{ shape: process }\n9 --> 10\n11[\"Replace column\"]@{ shape: process }\n10 --> 11\n4 --> 11\n12[\"Compute\"]@{ shape: process }\n11 --> 12\n13[\"Datamash\"]@{ shape: process }\n12 --> 13\n14[\"Replace\"]@{ shape: process }\n13 --> 14\n15[\"Collapse Collection\"]@{ shape: process }\n14 --> 15\n16[\"Compute\"]@{ shape: process }\n15 --> 16\n17[\"Replace\"]@{ shape: process }\n16 --> 17\n18[\"Datamash\"]@{ shape: process }\n17 --> 18\n19[\"Filter\"]@{ shape: process }\n17 --> 19\n20[\"Datamash\"]@{ shape: process }\n17 --> 20\n21[\"Join\"]@{ shape: process }\n19 --> 21\n18 --> 21\n22[\"Datamash\"]@{ shape: process }\n19 --> 22\n23[\"Datamash\"]@{ shape: process }\n19 --> 23\n24[\"Datamash\"]@{ shape: process }\n21 --> 24\n25[\"Join\"]@{ shape: process }\n17 --> 25\n22 --> 25\n26[\"Join\"]@{ shape: process }\n16 --> 26\n23 --> 26\n27[\"Cut\"]@{ shape: process }\n24 --> 27\n28[\"Join\"]@{ shape: process }\n25 --> 28\n20 --> 28\n29[\"Cut\"]@{ shape: process }\n26 --> 29\n30[\"Replace\"]@{ shape: process }\n27 --> 30\n31[\"Cut\"]@{ shape: process }\n28 --> 31\n32[\"Split file\"]@{ shape: process }\n29 --> 32\n33[\"Sort\"]@{ shape: process }\n30 --> 33\n34[\"Sort\"]@{ shape: process }\n31 --> 34\n35[\"Variant Frequency Plot\"]@{ shape: process }\n5 --> 35\n32 --> 35\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/sars-cov-2-variation-reporting/COVID-19-VARIATION-REPORTING", | |
| "dockstore_id": 16304, | |
| "categories": [ | |
| "COVID-19" | |
| ], | |
| "collections": [ | |
| "SARS-COV-2" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test generating variant report", | |
| "job": { | |
| "gene products translations": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/4555735/files/NC_045512.2_feature_mapping.tsv?download=1" | |
| }, | |
| "Variation data to report": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "identifier": "artic", | |
| "class": "File", | |
| "path": "test-data/ont-artic.vcf" | |
| }, | |
| { | |
| "identifier": "illumina-wgs-se", | |
| "class": "File", | |
| "path": "test-data/se-illumina-wgs.vcf" | |
| }, | |
| { | |
| "identifier": "illumina-wgs-pe", | |
| "class": "File", | |
| "path": "test-data/pe-illumina-wgs.vcf" | |
| }, | |
| { | |
| "identifier": "pe-artic", | |
| "class": "File", | |
| "path": "test-data/pe-artic.vcf" | |
| } | |
| ] | |
| } | |
| }, | |
| "outputs": { | |
| "by_variant_report": { | |
| "file": "test-data/by_variant_report.tsv" | |
| }, | |
| "combined_variant_report": { | |
| "file": "test-data/combined_variant_report.tsv" | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/sars-cov-2-variant-calling/sars-cov-2-variation-reporting" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "COVID-19-ARTIC-ONT", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/ont-artic-variation.ga", | |
| "testParameterFiles": [ | |
| "/ont-artic-variation-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Wolfgang Maier", | |
| "orcid": "0000-0002-9464-6640" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow for ONT-sequenced ARTIC data is modeled after the alignment/variant-calling steps of the [ARTIC pipeline](https://artic.readthedocs.io/en/latest/). It performs, essentially, the same steps as that pipeline’s minion command, i.e. read mapping with minimap2 and variant calling with medaka. Like the Illumina ARTIC workflow it uses ivar for primer trimming. Since ONT-sequenced reads have a much higher error rate than Illumina-sequenced reads and are therefor plagued more by false-positive variant calls, this workflow does make no attempt to handle amplicons affected by potential primer-binding site mutations.", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-9464-6640", | |
| "name": "Wolfgang Maier" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "name": "COVID-19: variation analysis of ARTIC ONT data", | |
| "release": "0.3.2", | |
| "steps": { | |
| "0": { | |
| "annotation": "ONT reads from ARTIC assay with fastqsanger encoding", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "ONT reads from ARTIC assay with fastqsanger encoding", | |
| "name": "ONT-sequenced reads" | |
| } | |
| ], | |
| "label": "ONT-sequenced reads", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "bottom": 230.265625, | |
| "height": 105, | |
| "left": -1042.453125, | |
| "right": -842.453125, | |
| "top": 125.265625, | |
| "width": 200, | |
| "x": -1042.453125, | |
| "y": 125.265625 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"fastqsanger\", \"fastqsanger.gz\"], \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "27eb7472-10b2-479a-b57f-d55aee92605a", | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Discard reads that are shorter than this length", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Discard reads that are shorter than this length", | |
| "name": "Minimum read length" | |
| } | |
| ], | |
| "label": "Minimum read length", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "bottom": 362.609375, | |
| "height": 105, | |
| "left": -1042.5, | |
| "right": -842.5, | |
| "top": 257.609375, | |
| "width": 200, | |
| "x": -1042.5, | |
| "y": 257.609375 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 400, \"parameter_type\": \"integer\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "d10a48bc-95d0-4f53-b5a5-bff17e020aea", | |
| "workflow_outputs": [ | |
| { | |
| "label": null, | |
| "output_name": "output", | |
| "uuid": "446daa93-2c4a-41ce-88d8-3213cb61dcaa" | |
| } | |
| ] | |
| }, | |
| "2": { | |
| "annotation": "Discard reads that are longer than this length", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Discard reads that are longer than this length", | |
| "name": "Maximum read length" | |
| } | |
| ], | |
| "label": "Maximum read length", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "bottom": 499.546875, | |
| "height": 105, | |
| "left": -1035.46875, | |
| "right": -835.46875, | |
| "top": 394.546875, | |
| "width": 200, | |
| "x": -1035.46875, | |
| "y": 394.546875 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"default\": 700, \"parameter_type\": \"integer\", \"optional\": true}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "be62c106-273a-4102-a9a1-1376525e4f4e", | |
| "workflow_outputs": [ | |
| { | |
| "label": null, | |
| "output_name": "output", | |
| "uuid": "bb83c99a-636c-45a7-85fd-438ef84a6dfb" | |
| } | |
| ] | |
| }, | |
| "3": { | |
| "annotation": "Fasta sequence for Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Fasta sequence for Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome", | |
| "name": "NC_045512.2 FASTA sequence of SARS-CoV-2" | |
| } | |
| ], | |
| "label": "NC_045512.2 FASTA sequence of SARS-CoV-2", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "bottom": 636.578125, | |
| "height": 105, | |
| "left": -1034.6875, | |
| "right": -834.6875, | |
| "top": 531.578125, | |
| "width": 200, | |
| "x": -1034.6875, | |
| "y": 531.578125 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"fasta\", \"fasta.gz\"]}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "b67b0bfd-6771-444a-ae7d-5d02f7f9157b", | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "BED file containing (ARTIC) primer positions. For ARTIC primer schemes the file can be obtained from https://usegalaxy.eu/u/wolfgang-maier/h/covid-19-resources.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "BED file containing (ARTIC) primer positions. For ARTIC primer schemes the file can be obtained from https://usegalaxy.eu/u/wolfgang-maier/h/covid-19-resources.", | |
| "name": "Primer binding sites info in BED format" | |
| } | |
| ], | |
| "label": "Primer binding sites info in BED format", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "bottom": 785.640625, | |
| "height": 105, | |
| "left": -1031.953125, | |
| "right": -831.953125, | |
| "top": 680.640625, | |
| "width": 200, | |
| "x": -1031.953125, | |
| "y": 680.640625 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"bed\"]}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "4faea19f-da1d-4683-9317-f7861174a8b6", | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.20.1+galaxy0", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "filter_options|length_filtering_options|length_limit": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "filter_options|length_filtering_options|length_required": { | |
| "id": 1, | |
| "output_name": "output" | |
| }, | |
| "single_paired|in1": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "fastp", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "report_html", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 337, | |
| "height": 209, | |
| "left": -790.8125, | |
| "right": -590.8125, | |
| "top": 128, | |
| "width": 200, | |
| "x": -790.8125, | |
| "y": 128 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.20.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "dbf9c561ef29", | |
| "name": "fastp", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_options\": {\"quality_filtering_options\": {\"disable_quality_filtering\": \"true\", \"qualified_quality_phred\": null, \"unqualified_percent_limit\": null, \"n_base_limit\": null}, \"length_filtering_options\": {\"disable_length_filtering\": \"false\", \"length_required\": {\"__class__\": \"ConnectedValue\"}, \"length_limit\": {\"__class__\": \"ConnectedValue\"}}, \"low_complexity_filter\": {\"enable_low_complexity_filter\": \"false\", \"complexity_threshold\": null}}, \"output_options\": {\"report_html\": \"true\", \"report_json\": \"false\"}, \"overrepresented_sequence_analysis\": {\"overrepresentation_analysis\": \"false\", \"overrepresentation_sampling\": null}, \"read_mod_options\": {\"polyg_tail_trimming\": {\"trimming_select\": \"-G\", \"__current_case__\": 2}, \"polyx_tail_trimming\": {\"polyx_trimming_select\": \"\", \"__current_case__\": 1}, \"umi_processing\": {\"umi\": \"false\", \"umi_loc\": \"\", \"umi_len\": null, \"umi_prefix\": \"\"}, \"cutting_by_quality_options\": {\"cut_by_quality5\": \"false\", \"cut_by_quality3\": \"false\", \"cut_window_size\": null, \"cut_mean_quality\": null}, \"base_correction_options\": {\"correction\": \"false\"}}, \"single_paired\": {\"single_paired_selector\": \"single\", \"__current_case__\": 0, \"in1\": {\"__class__\": \"ConnectedValue\"}, \"adapter_trimming_options\": {\"disable_adapter_trimming\": \"true\", \"adapter_sequence1\": \"\"}, \"global_trimming_options\": {\"trim_front1\": null, \"trim_tail1\": null}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.20.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "69ab6918-2d3e-4512-81bf-692fb776bb74", | |
| "workflow_outputs": [ | |
| { | |
| "label": "length_filtered_reads", | |
| "output_name": "out1", | |
| "uuid": "dd4c3b98-91d8-4963-b40f-e7e5a5e99e24" | |
| }, | |
| { | |
| "label": "fastp_report", | |
| "output_name": "report_html", | |
| "uuid": "c89895ce-50a7-4c19-aa3c-badc0cb534d3" | |
| } | |
| ] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "input": { | |
| "id": 4, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Compute", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 817.796875, | |
| "height": 95, | |
| "left": -563.46875, | |
| "right": -363.46875, | |
| "top": 722.796875, | |
| "width": 200, | |
| "x": -563.46875, | |
| "y": 722.796875 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionout_file1": { | |
| "action_arguments": { | |
| "newtype": "tabular" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "out_file1" | |
| }, | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6", | |
| "tool_shed_repository": { | |
| "changeset_revision": "02026300aa45", | |
| "name": "column_maker", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"avoid_scientific_notation\": \"false\", \"cond\": \"c3-c2\", \"header_lines_conditional\": {\"header_lines_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"round\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.6", | |
| "type": "tool", | |
| "uuid": "d8c4dcca-6715-4c2d-8598-8f9621a26e6b", | |
| "workflow_outputs": [] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_column/1.1.3", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "infile": { | |
| "id": 4, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Replace Text", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 1039.5, | |
| "height": 116, | |
| "left": 77.578125, | |
| "right": 277.578125, | |
| "top": 923.5, | |
| "width": 200, | |
| "x": 77.578125, | |
| "y": 923.5 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutfile": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_column/1.1.3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "ddf54b12c295", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"column\": \"1\", \"find_pattern\": \"MN908947.3\", \"replace_pattern\": \"NC_045512.2\"}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.3", | |
| "type": "tool", | |
| "uuid": "06a64d18-798b-4b40-b744-f20b62b8e23b", | |
| "workflow_outputs": [] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.17+galaxy2", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "fastq_input|fastq_input1": { | |
| "id": 5, | |
| "output_name": "out1" | |
| }, | |
| "reference_source|ref_file": { | |
| "id": 3, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Map with minimap2", | |
| "outputs": [ | |
| { | |
| "name": "alignment_output", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 478.65625, | |
| "height": 210, | |
| "left": -545.5, | |
| "right": -345.5, | |
| "top": 268.65625, | |
| "width": 200, | |
| "x": -545.5, | |
| "y": 268.65625 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionalignment_output": { | |
| "action_arguments": { | |
| "newname": "Mapped reads (output of minimap2)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "alignment_output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.17+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "8c6cd2650d1f", | |
| "name": "minimap2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": \"true\"}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"map-ont\"}, \"indexing_options\": {\"H\": \"false\", \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"BAM\", \"Q\": \"false\", \"L\": \"false\", \"K\": null, \"cs\": null, \"c\": \"false\", \"eqx\": \"false\", \"Y\": \"false\"}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"min_occ_floor\": null, \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": \"false\", \"p\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.17+galaxy2", | |
| "type": "tool", | |
| "uuid": "b07d928c-302e-4fc7-909a-e090813c1875", | |
| "workflow_outputs": [ | |
| { | |
| "label": "minimap2_mapped_reads", | |
| "output_name": "alignment_output", | |
| "uuid": "0877f387-f32c-48ee-9824-055583bd99fd" | |
| } | |
| ] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "in_file": { | |
| "id": 6, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Datamash", | |
| "outputs": [ | |
| { | |
| "name": "out_file", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 858.71875, | |
| "height": 116, | |
| "left": -320.8125, | |
| "right": -120.8125, | |
| "top": 742.71875, | |
| "width": 200, | |
| "x": -320.8125, | |
| "y": 742.71875 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "562f3c677828", | |
| "name": "datamash_ops", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"grouping\": \"\", \"header_in\": \"false\", \"header_out\": \"false\", \"ignore_case\": \"false\", \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"need_sort\": \"false\", \"operations\": [{\"__index__\": 0, \"op_name\": \"max\", \"op_column\": \"7\"}], \"print_full_line\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.0", | |
| "type": "tool", | |
| "uuid": "e2c31a21-c133-4d7d-9e2f-608864b34af6", | |
| "workflow_outputs": [] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.9+galaxy2", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "input": { | |
| "id": 8, | |
| "output_name": "alignment_output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputsam", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 407.734375, | |
| "height": 137, | |
| "left": -311.625, | |
| "right": -111.625, | |
| "top": 270.734375, | |
| "width": 200, | |
| "x": -311.625, | |
| "y": 270.734375 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutputsam": { | |
| "action_arguments": { | |
| "newname": "Mapped reads (filtered minimap2 result)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.9+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "bf328cec6a42", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"quality\": \"1\", \"library\": \"\", \"cigarcons\": null, \"inclusive_filter\": null, \"exclusive_filter\": [\"4\", \"256\"], \"exclusive_filter_all\": null}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"fraction\", \"__current_case__\": 0, \"factor\": \"1.0\", \"seed\": null}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": \"false\", \"adv_output\": {\"readtags\": [], \"collapsecigar\": \"false\"}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.9+galaxy2", | |
| "type": "tool", | |
| "uuid": "790d9f16-849c-4e47-af55-c9393504ae5c", | |
| "workflow_outputs": [ | |
| { | |
| "label": "filtered_mapped_reads", | |
| "output_name": "outputsam", | |
| "uuid": "10318fc5-8dc2-41e0-b6f5-48b9a419d72e" | |
| } | |
| ] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "input1": { | |
| "id": 9, | |
| "output_name": "out_file" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "integer_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 883.578125, | |
| "height": 158, | |
| "left": -74.328125, | |
| "right": 125.671875, | |
| "top": 725.578125, | |
| "width": 200, | |
| "x": -74.328125, | |
| "y": 725.578125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| }, | |
| "RenameDatasetActioninteger_param": { | |
| "action_arguments": { | |
| "newname": "max primer length to be used as padding width for calling in primer binding sites" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "6b010208-e861-4d9a-b0e5-f656e792f3f7", | |
| "workflow_outputs": [] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.2+galaxy2", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "input": { | |
| "id": 10, | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Samtools stats", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 111, | |
| "height": 137, | |
| "left": -74.09375, | |
| "right": 125.90625, | |
| "top": -26, | |
| "width": 200, | |
| "x": -74.09375, | |
| "y": -26 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.2+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "145f6d74ff5e", | |
| "name": "samtools_stats", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cov_threshold\": null, \"coverage_cond\": {\"coverage_select\": \"no\", \"__current_case__\": 0}, \"filter_by_flags\": {\"filter_flags\": \"nofilter\", \"__current_case__\": 1}, \"gc_depth\": null, \"input\": {\"__class__\": \"ConnectedValue\"}, \"insert_size\": null, \"most_inserts\": null, \"read_length\": null, \"remove_dups\": \"false\", \"remove_overlaps\": \"false\", \"sparse\": \"false\", \"split_output_cond\": {\"split_output_selector\": \"no\", \"__current_case__\": 0}, \"trim_quality\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.0.2+galaxy2", | |
| "type": "tool", | |
| "uuid": "9bfcce2b-6fb4-44f9-b893-20d3f32be170", | |
| "workflow_outputs": [ | |
| { | |
| "label": "mapped_reads_stats", | |
| "output_name": "output", | |
| "uuid": "dcde6643-5ac7-4bca-92ca-169544c0a6d8" | |
| } | |
| ] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/bamleftalign/1.3.1", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "reference_source|input_bam": { | |
| "id": 10, | |
| "output_name": "outputsam" | |
| }, | |
| "reference_source|ref_file": { | |
| "id": 3, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "BamLeftAlign", | |
| "outputs": [ | |
| { | |
| "name": "output_bam", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 554.5, | |
| "height": 189, | |
| "left": -75.953125, | |
| "right": 124.046875, | |
| "top": 365.5, | |
| "width": 200, | |
| "x": -75.953125, | |
| "y": 365.5 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/bamleftalign/1.3.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "ef2c525bd8cd", | |
| "name": "freebayes", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"iterations\": \"5\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.3.1", | |
| "type": "tool", | |
| "uuid": "78489e65-6f95-47ec-aacd-9023d8c2c3bc", | |
| "workflow_outputs": [ | |
| { | |
| "label": "realigned_filtered_mapped_reads", | |
| "output_name": "output_bam", | |
| "uuid": "6deefe2d-57d7-4e61-b929-a1d6bcc877d2" | |
| } | |
| ] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.3.1+galaxy2", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "input_bam": { | |
| "id": 13, | |
| "output_name": "output_bam" | |
| }, | |
| "primer|input_bed": { | |
| "id": 4, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "ivar trim", | |
| "outputs": [ | |
| { | |
| "name": "output_bam", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 425.375, | |
| "height": 210, | |
| "left": 158.125, | |
| "right": 358.125, | |
| "top": 215.375, | |
| "width": 200, | |
| "x": 158.125, | |
| "y": 215.375 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput_bam": { | |
| "action_arguments": { | |
| "newname": "Fully processed reads for variant calling (primer-trimmed, realigned reads)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_bam" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.3.1+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "c092052ed673", | |
| "name": "ivar_trim", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"amplicons\": {\"filter_by\": \"\", \"__current_case__\": 0}, \"inc_primers\": \"false\", \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"min_len\": \"1\", \"min_qual\": \"0\", \"primer\": {\"source\": \"history\", \"__current_case__\": 0, \"input_bed\": {\"__class__\": \"ConnectedValue\"}}, \"primer_pos_wiggle\": \"0\", \"window_width\": \"4\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.3.1+galaxy2", | |
| "type": "tool", | |
| "uuid": "cee59eba-91f0-4beb-82d5-3b827e867657", | |
| "workflow_outputs": [ | |
| { | |
| "label": "primer_trimmed_realigned_filtered_mapped_reads", | |
| "output_name": "output_bam", | |
| "uuid": "790186ed-d660-4035-9ea9-5ed6b3bf58c2" | |
| } | |
| ] | |
| }, | |
| "15": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3", | |
| "errors": null, | |
| "id": 15, | |
| "input_connections": { | |
| "input1": { | |
| "id": 14, | |
| "output_name": "output_bam" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "QualiMap BamQC", | |
| "outputs": [ | |
| { | |
| "name": "raw_data", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "output_html", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 297.984375, | |
| "height": 210, | |
| "left": 386.53125, | |
| "right": 586.53125, | |
| "top": 87.984375, | |
| "width": 200, | |
| "x": 386.53125, | |
| "y": 87.984375 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "19ece8afbaab", | |
| "name": "qualimap_bamqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"duplicate_skipping\": [\"0\"], \"input1\": {\"__class__\": \"ConnectedValue\"}, \"per_base_coverage\": \"false\", \"plot_specific\": {\"n_bins\": \"400\", \"paint_chromosome_limits\": \"true\", \"genome_gc_distr\": null, \"homopolymer_size\": \"3\"}, \"stats_regions\": {\"region_select\": \"all\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.2d+galaxy3", | |
| "type": "tool", | |
| "uuid": "63d12f6d-9a45-487c-ad82-841aba341ef5", | |
| "workflow_outputs": [ | |
| { | |
| "label": "bamqc_raw_output", | |
| "output_name": "raw_data", | |
| "uuid": "0c2a68ba-319a-4aa8-bbd3-17ca49d5e9ab" | |
| }, | |
| { | |
| "label": "bamqc_html_output", | |
| "output_name": "output_html", | |
| "uuid": "e81ce71a-2ab8-4a54-bf6d-d65a1599c530" | |
| } | |
| ] | |
| }, | |
| "16": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/medaka_consensus/medaka_consensus/1.0.3+galaxy2", | |
| "errors": null, | |
| "id": 16, | |
| "input_connections": { | |
| "bam": { | |
| "id": 14, | |
| "output_name": "output_bam" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "medaka consensus tool", | |
| "outputs": [ | |
| { | |
| "name": "out_result", | |
| "type": "h5" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 664.84375, | |
| "height": 158, | |
| "left": 370.78125, | |
| "right": 570.78125, | |
| "top": 506.84375, | |
| "width": 200, | |
| "x": 370.78125, | |
| "y": 506.84375 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/medaka_consensus/medaka_consensus/1.0.3+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "db25ec99c3ea", | |
| "name": "medaka_consensus", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"RG\": \"\", \"bam\": {\"__class__\": \"ConnectedValue\"}, \"batch_size\": \"100\", \"check_output\": \"false\", \"chunk_len\": \"800\", \"chunk_ovlp\": \"400\", \"disable_cudnn\": \"false\", \"model\": \"r941_min_high_g351\", \"out\": [\"result\"], \"regions_cond\": {\"regions_sel\": \"none\", \"__current_case__\": 0}, \"save_features\": \"false\", \"tag_keep_missing\": \"false\", \"tag_name\": \"\", \"tag_value\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.3+galaxy2", | |
| "type": "tool", | |
| "uuid": "d35f7df5-5b3f-43c3-b558-dd94dade926e", | |
| "workflow_outputs": [ | |
| { | |
| "label": "medaka_consensus_data", | |
| "output_name": "out_result", | |
| "uuid": "eeadcbf5-1300-41d6-8e0f-a251dd1c0299" | |
| } | |
| ] | |
| }, | |
| "17": { | |
| "annotation": "", | |
| "content_id": "__FILTER_FAILED_DATASETS__", | |
| "errors": null, | |
| "id": 17, | |
| "input_connections": { | |
| "input": { | |
| "id": 15, | |
| "output_name": "raw_data" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Filter failed", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 255.453125, | |
| "height": 116, | |
| "left": 618.953125, | |
| "right": 818.953125, | |
| "top": 139.453125, | |
| "width": 200, | |
| "x": 618.953125, | |
| "y": 139.453125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "__FILTER_FAILED_DATASETS__", | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "717562b8-2694-44ff-94e2-47d1aed4420a", | |
| "workflow_outputs": [] | |
| }, | |
| "18": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/medaka_variant/medaka_variant/1.3.2+galaxy1", | |
| "errors": null, | |
| "id": 18, | |
| "input_connections": { | |
| "output_annotated|in_bam": { | |
| "id": 13, | |
| "output_name": "output_bam" | |
| }, | |
| "pool|input": { | |
| "id": 16, | |
| "output_name": "out_result" | |
| }, | |
| "reference_source|ref_file": { | |
| "id": 3, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "medaka variant tool", | |
| "outputs": [ | |
| { | |
| "name": "out_variants", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 564.796875, | |
| "height": 262, | |
| "left": 605.109375, | |
| "right": 805.109375, | |
| "top": 302.796875, | |
| "width": 200, | |
| "x": 605.109375, | |
| "y": 302.796875 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionout_variants": { | |
| "action_arguments": { | |
| "newname": "Variant calls" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_variants" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/medaka_variant/medaka_variant/1.3.2+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "0f5f4a208660", | |
| "name": "medaka_variant", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"ambig_ref\": \"false\", \"gvcf\": \"false\", \"output_annotated\": {\"output_annotated_select\": \"true\", \"__current_case__\": 0, \"in_bam\": {\"__class__\": \"ConnectedValue\"}, \"pad\": \"25\"}, \"output_log_bool\": \"false\", \"pool\": {\"pool_mode\": \"No\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"regions\": \"\", \"verbose\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.3.2+galaxy1", | |
| "type": "tool", | |
| "uuid": "dbc1b19c-5ada-4209-94bb-4c6eb628944a", | |
| "workflow_outputs": [ | |
| { | |
| "label": "medaka_variants_general", | |
| "output_name": "out_variants", | |
| "uuid": "23525921-bef8-4f12-8325-233c80204bac" | |
| } | |
| ] | |
| }, | |
| "19": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/medaka_variant/medaka_variant/1.3.2+galaxy1", | |
| "errors": null, | |
| "id": 19, | |
| "input_connections": { | |
| "output_annotated|in_bam": { | |
| "id": 13, | |
| "output_name": "output_bam" | |
| }, | |
| "output_annotated|pad": { | |
| "id": 11, | |
| "output_name": "integer_param" | |
| }, | |
| "pool|input": { | |
| "id": 16, | |
| "output_name": "out_result" | |
| }, | |
| "reference_source|ref_file": { | |
| "id": 3, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "medaka variant tool", | |
| "outputs": [ | |
| { | |
| "name": "out_variants", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 930.734375, | |
| "height": 314, | |
| "left": 605.21875, | |
| "right": 805.21875, | |
| "top": 616.734375, | |
| "width": 200, | |
| "x": 605.21875, | |
| "y": 616.734375 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/medaka_variant/medaka_variant/1.3.2+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "0f5f4a208660", | |
| "name": "medaka_variant", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"ambig_ref\": \"false\", \"gvcf\": \"false\", \"output_annotated\": {\"output_annotated_select\": \"true\", \"__current_case__\": 0, \"in_bam\": {\"__class__\": \"ConnectedValue\"}, \"pad\": {\"__class__\": \"ConnectedValue\"}}, \"output_log_bool\": \"false\", \"pool\": {\"pool_mode\": \"No\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"regions\": \"\", \"verbose\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.3.2+galaxy1", | |
| "type": "tool", | |
| "uuid": "8ee2fde4-9631-4e51-9c50-4419cfe39b58", | |
| "workflow_outputs": [ | |
| { | |
| "label": "medaka_variants_pbs", | |
| "output_name": "out_variants", | |
| "uuid": "06999460-a1c2-4dc9-9c55-e0650f8f052d" | |
| } | |
| ] | |
| }, | |
| "20": { | |
| "annotation": "", | |
| "content_id": "__FLATTEN__", | |
| "errors": null, | |
| "id": 20, | |
| "input_connections": { | |
| "input": { | |
| "id": 17, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Flatten Collection", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 307.421875, | |
| "height": 158, | |
| "left": 860.46875, | |
| "right": 1060.46875, | |
| "top": 149.421875, | |
| "width": 200, | |
| "x": 860.46875, | |
| "y": 149.421875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "__FLATTEN__", | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"join_identifier\": \"_\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "de07859e-5ed1-46d0-9cd0-2f3848b4ef63", | |
| "workflow_outputs": [ | |
| { | |
| "label": "bamqc_raw_output_flattened", | |
| "output_name": "output", | |
| "uuid": "68801b40-55d8-4db3-a065-578161bdaeeb" | |
| } | |
| ] | |
| }, | |
| "21": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0", | |
| "errors": null, | |
| "id": 21, | |
| "input_connections": { | |
| "inputA": { | |
| "id": 19, | |
| "output_name": "out_variants" | |
| }, | |
| "reduce_or_iterate|inputB": { | |
| "id": 7, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "bedtools Intersect intervals", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 982.46875, | |
| "height": 147, | |
| "left": 825.828125, | |
| "right": 1025.828125, | |
| "top": 835.46875, | |
| "width": 200, | |
| "x": 825.828125, | |
| "y": 835.46875 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Adjusted variant calls within primer binding sites" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "a68aa6c1204a", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"bed\": \"false\", \"count\": \"false\", \"fraction_cond\": {\"fraction_select\": \"default\", \"__current_case__\": 0}, \"header\": \"true\", \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"false\", \"once\": \"true\", \"overlap_mode\": [\"-wa\"], \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": \"false\", \"split\": \"false\", \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.30.0", | |
| "type": "tool", | |
| "uuid": "7e2468f7-9392-4f82-b6d2-11a338ed81a2", | |
| "workflow_outputs": [ | |
| { | |
| "label": "variants_pbs", | |
| "output_name": "output", | |
| "uuid": "209c5be7-ef0d-4009-8ac1-b0b3dd812207" | |
| } | |
| ] | |
| }, | |
| "22": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.8+galaxy1", | |
| "errors": null, | |
| "id": 22, | |
| "input_connections": { | |
| "results_0|software_cond|output_0|type|input": { | |
| "id": 12, | |
| "output_name": "output" | |
| }, | |
| "results_1|software_cond|input": { | |
| "id": 20, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "stats", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "plots", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 365.953125, | |
| "height": 335, | |
| "left": 1097.328125, | |
| "right": 1297.328125, | |
| "top": 30.953125, | |
| "width": 200, | |
| "x": 1097.328125, | |
| "y": 30.953125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionplots": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "plots" | |
| }, | |
| "HideDatasetActionstats": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "stats" | |
| }, | |
| "RenameDatasetActionhtml_report": { | |
| "action_arguments": { | |
| "newname": "Preprocessing and mapping reports" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "html_report" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.8+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5e33b465d8d5", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"flat\": \"false\", \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 23, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"stats\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"qualimap\", \"__current_case__\": 19, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.8+galaxy1", | |
| "type": "tool", | |
| "uuid": "815cbc27-8533-42e0-b5b8-c9312aa8cdfe", | |
| "workflow_outputs": [ | |
| { | |
| "label": "preprocessing_and_mapping_reports", | |
| "output_name": "html_report", | |
| "uuid": "6c317485-2591-4984-b163-378faa100f1e" | |
| } | |
| ] | |
| }, | |
| "23": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.10", | |
| "errors": null, | |
| "id": 23, | |
| "input_connections": { | |
| "input_file": { | |
| "id": 18, | |
| "output_name": "out_variants" | |
| }, | |
| "sec_annofile|annofile|annotations": { | |
| "id": 21, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "input_file" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "sec_annotate" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bcftools annotate", | |
| "name": "sec_restrict" | |
| } | |
| ], | |
| "label": null, | |
| "name": "bcftools annotate", | |
| "outputs": [ | |
| { | |
| "name": "output_file", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 828, | |
| "height": 230, | |
| "left": 1046.5, | |
| "right": 1246.5, | |
| "top": 598, | |
| "width": 200, | |
| "x": 1046.5, | |
| "y": 598 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_annotate/bcftools_annotate/1.10", | |
| "tool_shed_repository": { | |
| "changeset_revision": "403553ae19f6", | |
| "name": "bcftools_annotate", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input_file\": {\"__class__\": \"RuntimeValue\"}, \"output_type\": \"v\", \"sec_annofile\": {\"columns\": \"INFO\", \"annofile\": {\"anno_fmt\": \"vcf\", \"__current_case__\": 1, \"annotations\": {\"__class__\": \"RuntimeValue\"}}, \"mark_sites\": \"\", \"set_id\": \"\"}, \"sec_annotate\": {\"remove\": \"FORMAT\", \"rename_chrs\": {\"__class__\": \"RuntimeValue\"}}, \"sec_restrict\": {\"include\": \"\", \"exclude\": \"\", \"collapse\": null, \"regions\": {\"regions_src\": \"__none__\", \"__current_case__\": 0}, \"samples\": \"\", \"invert_samples\": \"false\", \"samples_file\": {\"__class__\": \"RuntimeValue\"}, \"invert_samples_file\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.10", | |
| "type": "tool", | |
| "uuid": "bf733d38-0a4a-4f40-92cf-92e22ff12f5b", | |
| "workflow_outputs": [ | |
| { | |
| "label": "variants_combined", | |
| "output_name": "output_file", | |
| "uuid": "47e2fdc8-dd5a-4f46-8084-ba37d80091db" | |
| } | |
| ] | |
| }, | |
| "24": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "errors": null, | |
| "id": 24, | |
| "input_connections": { | |
| "input": { | |
| "id": 23, | |
| "output_name": "output_file" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "intervals" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "transcripts" | |
| } | |
| ], | |
| "label": "SnpEff eff covid19 version", | |
| "name": "SnpEff eff:", | |
| "outputs": [ | |
| { | |
| "name": "snpeff_output", | |
| "type": "vcf" | |
| }, | |
| { | |
| "name": "statsFile", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 833.90625, | |
| "height": 335, | |
| "left": 1287.59375, | |
| "right": 1487.59375, | |
| "top": 498.90625, | |
| "width": 200, | |
| "x": 1287.59375, | |
| "y": 498.90625 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionsnpeff_output": { | |
| "action_arguments": { | |
| "newname": "Final (SnpEff-) annotated variants" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "snpeff_output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2a3a00c1fa0a", | |
| "name": "snpeff_sars_cov_2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"annotations\": [\"-formatEff\", \"-classic\"], \"chr\": \"\", \"csvStats\": \"false\", \"filter\": {\"specificEffects\": \"no\", \"__current_case__\": 0}, \"filterOut\": [\"-no-downstream\", \"-no-intergenic\", \"-no-upstream\"], \"generate_stats\": \"true\", \"genome_version\": \"NC_045512.2\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"inputFormat\": \"vcf\", \"intervals\": {\"__class__\": \"RuntimeValue\"}, \"noLog\": \"true\", \"offset\": \"default\", \"outputConditional\": {\"outputFormat\": \"vcf\", \"__current_case__\": 0}, \"transcripts\": {\"__class__\": \"RuntimeValue\"}, \"udLength\": \"0\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.5covid19", | |
| "type": "tool", | |
| "uuid": "9eb5a77f-3c5f-43cb-9811-5d4c6cf7931a", | |
| "workflow_outputs": [ | |
| { | |
| "label": "annotated_variants", | |
| "output_name": "snpeff_output", | |
| "uuid": "22a622ff-26df-4d6c-a08c-24fe57703982" | |
| }, | |
| { | |
| "label": "annotated_variants_stats", | |
| "output_name": "statsFile", | |
| "uuid": "47b851dc-c115-441a-9408-22f579f59a7e" | |
| } | |
| ] | |
| }, | |
| "25": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0", | |
| "errors": null, | |
| "id": 25, | |
| "input_connections": { | |
| "invcf": { | |
| "id": 24, | |
| "output_name": "snpeff_output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Lofreq filter", | |
| "outputs": [ | |
| { | |
| "name": "outvcf", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 598.1875, | |
| "height": 95, | |
| "left": 1512.21875, | |
| "right": 1712.21875, | |
| "top": 503.1875, | |
| "width": 200, | |
| "x": 1512.21875, | |
| "y": 503.1875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "7dfca164d2e3", | |
| "name": "lofreq_filter", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"af\": {\"af_min\": \"0.0\", \"af_max\": \"0.0\"}, \"coverage\": {\"cov_min\": \"0\", \"cov_max\": \"0\"}, \"filter_by_type\": {\"keep_only\": \"\", \"__current_case__\": 0, \"qual\": {\"snvqual_filter\": {\"snvqual\": \"no\", \"__current_case__\": 0}, \"indelqual_filter\": {\"indelqual\": \"no\", \"__current_case__\": 0}}}, \"flag_or_drop\": \"--print-all\", \"invcf\": {\"__class__\": \"ConnectedValue\"}, \"sb\": {\"sb_filter\": {\"strand_bias\": \"mtc\", \"__current_case__\": 2, \"sb_alpha\": \"0.001\", \"sb_mtc\": \"fdr\", \"sb_compound\": \"true\", \"sb_indels\": \"false\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy0", | |
| "type": "tool", | |
| "uuid": "f0e396ff-d72b-4d02-9c4f-885557073ddd", | |
| "workflow_outputs": [ | |
| { | |
| "label": "lofreq_filtered", | |
| "output_name": "outvcf", | |
| "uuid": "7fb4cdec-b28c-40a8-a36a-dd30ab4987d2" | |
| } | |
| ] | |
| }, | |
| "26": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.3", | |
| "errors": null, | |
| "id": 26, | |
| "input_connections": { | |
| "infile": { | |
| "id": 25, | |
| "output_name": "outvcf" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Replace", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 641.015625, | |
| "height": 137, | |
| "left": 1729.296875, | |
| "right": 1929.296875, | |
| "top": 504.015625, | |
| "width": 200, | |
| "x": 1729.296875, | |
| "y": 504.015625 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "Final (SnpEff-) annotated variants with strand-bias soft filter applied" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "ddf54b12c295", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"caseinsensitive\": \"false\", \"find_pattern\": \"#CHROM\\\\tPOS\\\\tID\\\\tREF\\\\tALT\\\\tQUAL\\\\tFILTER\\\\tINFO.*\", \"global\": \"false\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": \"true\", \"replace_pattern\": \"#CHROM\\\\tPOS\\\\tID\\\\tREF\\\\tALT\\\\tQUAL\\\\tFILTER\\\\tINFO\\\\tFORMAT\\\\tSAMPLE\", \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}, \"skip_first_line\": \"false\", \"wholewords\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.3", | |
| "type": "tool", | |
| "uuid": "0932d832-0ab4-4399-a4eb-a065e7cf1b7a", | |
| "workflow_outputs": [ | |
| { | |
| "label": "annotated_softfiltered_variants", | |
| "output_name": "outfile", | |
| "uuid": "22a290c5-0f48-4140-b759-52ee0b73d1b2" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "COVID-19", | |
| "ARTIC", | |
| "ONT", | |
| "covid19.galaxyproject.org" | |
| ], | |
| "uuid": "a1ceaf35-f3d7-452d-b5ed-53a4f429d1cf" | |
| }, | |
| "updated": "2024-12-03T18:32:54.038225", | |
| "readme": "COVID-19: variation analysis on ARTIC ONT data\n----------------------------------------------\n\nThis workflow for ONT-sequenced ARTIC data is modeled after the alignment/variant-calling steps of the [ARTIC pipeline](https://artic.readthedocs.io/en/latest/). It performs, essentially, the same steps as that pipeline’s minion command, i.e. read mapping with minimap2 and variant calling with medaka. Like the Illumina ARTIC workflow it uses ivar for primer trimming. Since ONT-sequenced reads have a much higher error rate than Illumina-sequenced reads and are therefor plagued more by false-positive variant calls, this workflow does make no attempt to handle amplicons affected by potential primer-binding site mutations.\n", | |
| "changelog": "# Changelog\n\n## [0.3.2] 2023-11-20\n\n- Fix author in dockstore\n- Use ncbi link instead of googleapis for fastq\n\n## [0.3.1] 2021-12-13\n\n### Added\n- Added GitHub Actions workflow. No functional changes.\n\n## [0.3] 2021-09-22\n\n### Changed\n\nThis version changes the way variants get called and and how key call\nstatistics are calculated:\n\n- Switch to medaka_variant version 1.3.2+galaxy1 for extracting variants from\n medaka consensus data.\n\n This new version of the tool is more robust against input data peculiarities\n at the VCF annotation stage:\n\n * it doesn't fail on empty BAM input\n * it doesn't crash on variant calls of unusually high quality that previously\n resulted in math domain errors when trying to calculate PHRED scores from\n very small error probabilities.\n\n This tool update also means that key INFO fields (DP, DP4, AF) are\n now based on calculations carried out by medaka tools annotate instead of by\n custom code using samtools mpileup. This has the following consequences:\n\n * the tool can now emit variant calls at complex sites with > 1 lengths of\n both the REF and the ALT allele, which were previously dropped\n * the workflow became more complex; to account for shortcomings of medaka\n tools annotate, the variant call statistics of regular variants and of\n primer binding site variants have to be determined in separate runs of the\n tool\n * All key INFO fields (DP, DP4, AF) will change slightly in this version of\n the workflow\n\nThis version also adds some of the changes around trimming of primer sequences,\nwhich have been introduced into version 0.3 of the PE Illumina worflow for\namplicon data before:\n\n- Update ivar trim to version 1.3.1\n- Run ivar trim as the last mapped reads processing step before variant\n calling, i.e., after left-alignment of indels\n\nand:\n\n- Rename the output of the ivar trim step to \"Fully processed reads for\n variant calling (primer-trimmed, realigned reads)\" like the corresponding\n output of the PE Illumina workflow\n- Fix a typo in the allowed input formats for the collection of sequenced\n reads, which caused fastqsanger.gz data to undergo an implicit and\n unnecessary decompression step.\n\n### Added\n\n- Add a step to filter out failed datasets before flattening the Qualimap BamQC\n data for use by MultiQC.\n\n Qualimap BamQC fails on empty BAM input and trying to flatten the resulting\n collection containing failed datasets would cause the invocation of the\n workflow to fail.\n\n## [0.2.1] 2021-07-23\n\n### Added\n\nAdded RO-Crate metadata file. No functional changes.\n\n## [0.2]\n\n- Apply the strand-bias filter only after variant annotation with snpEff. By\n producing fully annotated VCFs with and without filtering, downstream\n workflows can easily be switched between filtered/unfiltered input data\n\n## [0.1]\n\n- Initial version of COVID-19: variation analysis on ARTIC ONT data workflow\n", | |
| "diagrams": "# Workflow diagrams\n\n## COVID-19: variation analysis of ARTIC ONT data\n\n```mermaid\ngraph LR\n0[\"ℹ️ ONT-sequenced reads\"]@{ shape: docs }\n1[\"ℹ️ Minimum read length\"]@{ shape: lean-l }\n2[\"ℹ️ Maximum read length\"]@{ shape: lean-l }\n3[\"ℹ️ NC_045512.2 FASTA sequence of SARS-CoV-2\"]@{ shape: doc }\n4[\"ℹ️ Primer binding sites info in BED format\"]@{ shape: doc }\n5[\"fastp\"]@{ shape: process }\n2 --> 5\n1 --> 5\n0 --> 5\n6[\"Compute\"]@{ shape: process }\n4 --> 6\n7[\"Replace Text\"]@{ shape: process }\n4 --> 7\n8[\"Map with minimap2\"]@{ shape: process }\n5 --> 8\n3 --> 8\n9[\"Datamash\"]@{ shape: process }\n6 --> 9\n10[\"Samtools view\"]@{ shape: process }\n8 --> 10\n11[\"Parse parameter value\"]@{ shape: process }\n9 --> 11\n12[\"Samtools stats\"]@{ shape: process }\n10 --> 12\n13[\"BamLeftAlign\"]@{ shape: process }\n10 --> 13\n3 --> 13\n14[\"ivar trim\"]@{ shape: process }\n13 --> 14\n4 --> 14\n15[\"QualiMap BamQC\"]@{ shape: process }\n14 --> 15\n16[\"medaka consensus tool\"]@{ shape: process }\n14 --> 16\n17[\"Filter failed\"]@{ shape: process }\n15 --> 17\n18[\"medaka variant tool\"]@{ shape: process }\n13 --> 18\n16 --> 18\n3 --> 18\n19[\"medaka variant tool\"]@{ shape: process }\n13 --> 19\n11 --> 19\n16 --> 19\n3 --> 19\n20[\"Flatten Collection\"]@{ shape: process }\n17 --> 20\n21[\"bedtools Intersect intervals\"]@{ shape: process }\n19 --> 21\n7 --> 21\n22[\"MultiQC\"]@{ shape: process }\n12 --> 22\n20 --> 22\n23[\"bcftools annotate\"]@{ shape: process }\n18 --> 23\n21 --> 23\n24[\"SnpEff eff covid19 version\"]@{ shape: process }\n23 --> 24\n25[\"Lofreq filter\"]@{ shape: process }\n24 --> 25\n26[\"Replace\"]@{ shape: process }\n25 --> 26\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/sars-cov-2-ont-artic-variant-calling/COVID-19-ARTIC-ONT", | |
| "dockstore_id": 16246, | |
| "categories": [ | |
| "COVID-19" | |
| ], | |
| "collections": [ | |
| "SARS-COV-2" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test workflow execution using ONT ARTIC accession", | |
| "job": { | |
| "NC_045512.2 FASTA sequence of SARS-CoV-2": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/4555735/files/NC_045512.2_reference.fasta?download=1" | |
| }, | |
| "Primer binding sites info in BED format": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/4555735/files/ARTIC_nCoV-2019_v3.bed?download=1" | |
| }, | |
| "ONT-sequenced reads": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "identifier": "SRR12447380", | |
| "class": "File", | |
| "filetype": "fastqsanger.gz", | |
| "location": "https://www.be-md.ncbi.nlm.nih.gov/Traces/sra-reads-be/fastq?acc=SRR12447380" | |
| } | |
| ] | |
| } | |
| }, | |
| "outputs": { | |
| "annotated_softfiltered_variants": { | |
| "attributes": {}, | |
| "element_tests": { | |
| "SRR12447380": { | |
| "path": "test-data/final_snpeff_annotated_variants.vcf", | |
| "compare": "diff", | |
| "lines_diff": 6 | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/sars-cov-2-variant-calling/sars-cov-2-ont-artic-variant-calling" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "COVID-19-PE-WGS-ILLUMINA", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/pe-wgs-variation.ga", | |
| "testParameterFiles": [ | |
| "/pe-wgs-variation-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Wolfgang Maier", | |
| "orcid": "0000-0002-9464-6640" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflows performs paired end read mapping with bwa-mem followed by sensitive variant calling across a wide range of AFs with lofreq", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-9464-6640", | |
| "name": "Wolfgang Maier" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "name": "COVID-19: variation analysis on WGS PE data", | |
| "release": "0.2.4", | |
| "steps": { | |
| "0": { | |
| "annotation": "Illumina reads with fastqsanger encoding", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Illumina reads with fastqsanger encoding", | |
| "name": "Paired Collection" | |
| } | |
| ], | |
| "label": "Paired Collection", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "bottom": 531.03125, | |
| "height": 81, | |
| "left": -513, | |
| "right": -313, | |
| "top": 450.03125, | |
| "width": 200, | |
| "x": -513, | |
| "y": 450.03125 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"fastqsanger\", \"fastqsanger.gz\"], \"collection_type\": \"list:paired\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "b21522ed-fd9a-44b6-8ed3-a8640727961d", | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Fasta sequence for Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Fasta sequence for Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome", | |
| "name": "NC_045512.2 FASTA sequence of SARS-CoV-2" | |
| } | |
| ], | |
| "label": "NC_045512.2 FASTA sequence of SARS-CoV-2", | |
| "name": "Input dataset", | |
| "outputs": [], | |
| "position": { | |
| "bottom": 729.796875, | |
| "height": 101, | |
| "left": -460.59375, | |
| "right": -260.59375, | |
| "top": 628.796875, | |
| "width": 200, | |
| "x": -460.59375, | |
| "y": 628.796875 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"fasta\", \"fasta.gz\"]}", | |
| "tool_version": null, | |
| "type": "data_input", | |
| "uuid": "179e3f76-b1f0-4096-864b-a0f143428cfb", | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.2+galaxy0", | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": { | |
| "single_paired|paired_input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "fastp", | |
| "outputs": [ | |
| { | |
| "name": "output_paired_coll", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "report_html", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "report_json", | |
| "type": "json" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 436.953125, | |
| "height": 192, | |
| "left": -246.53125, | |
| "right": -46.53125, | |
| "top": 244.953125, | |
| "width": 200, | |
| "x": -246.53125, | |
| "y": 244.953125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionreport_json": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "report_json" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.2+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "65b93b623c77", | |
| "name": "fastp", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filter_options\": {\"quality_filtering_options\": {\"disable_quality_filtering\": \"false\", \"qualified_quality_phred\": null, \"unqualified_percent_limit\": null, \"n_base_limit\": null}, \"length_filtering_options\": {\"disable_length_filtering\": \"false\", \"length_required\": null, \"length_limit\": null}, \"low_complexity_filter\": {\"enable_low_complexity_filter\": \"false\", \"complexity_threshold\": null}}, \"output_options\": {\"report_html\": \"true\", \"report_json\": \"true\"}, \"overrepresented_sequence_analysis\": {\"overrepresentation_analysis\": \"false\", \"overrepresentation_sampling\": null}, \"read_mod_options\": {\"polyg_tail_trimming\": {\"trimming_select\": \"\", \"__current_case__\": 1, \"poly_g_min_len\": null}, \"polyx_tail_trimming\": {\"polyx_trimming_select\": \"\", \"__current_case__\": 1}, \"umi_processing\": {\"umi\": \"false\", \"umi_loc\": \"\", \"umi_len\": null, \"umi_prefix\": \"\"}, \"cutting_by_quality_options\": {\"cut_by_quality5\": \"false\", \"cut_by_quality3\": \"false\", \"cut_window_size\": null, \"cut_mean_quality\": null}, \"base_correction_options\": {\"correction\": \"false\"}}, \"single_paired\": {\"single_paired_selector\": \"paired_collection\", \"__current_case__\": 2, \"paired_input\": {\"__class__\": \"ConnectedValue\"}, \"adapter_trimming_options\": {\"disable_adapter_trimming\": \"false\", \"adapter_sequence1\": \"\", \"adapter_sequence2\": \"\"}, \"global_trimming_options\": {\"trim_front1\": null, \"trim_tail1\": null, \"trim_front2\": null, \"trim_tail2\": null}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.23.2+galaxy0", | |
| "type": "tool", | |
| "uuid": "e3e15355-92b3-4336-a048-facf7b80a456", | |
| "workflow_outputs": [ | |
| { | |
| "label": "fastp_pe", | |
| "output_name": "output_paired_coll", | |
| "uuid": "e12cf072-ff7d-44dc-86a4-d5db9c7b7bc2" | |
| }, | |
| { | |
| "label": "fastp_html_report", | |
| "output_name": "report_html", | |
| "uuid": "e5330623-a13b-4e91-a7ed-81318648cc75" | |
| } | |
| ] | |
| }, | |
| "3": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": { | |
| "fastq_input|fastq_input1": { | |
| "id": 2, | |
| "output_name": "output_paired_coll" | |
| }, | |
| "reference_source|ref_file": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Map with BWA-MEM", | |
| "outputs": [ | |
| { | |
| "name": "bam_output", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 698.46875, | |
| "height": 222, | |
| "left": 19, | |
| "right": 219, | |
| "top": 476.46875, | |
| "width": 200, | |
| "x": 19, | |
| "y": 476.46875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64f11cf59c6e", | |
| "name": "bwa", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": \"\"}, \"output_sort\": \"coordinate\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.7.17.2", | |
| "type": "tool", | |
| "uuid": "ff1eb4ed-6403-4017-8538-c16200b33cdb", | |
| "workflow_outputs": [ | |
| { | |
| "label": "Map with BWA-MEM on input dataset(s) (mapped reads in BAM format)", | |
| "output_name": "bam_output", | |
| "uuid": "37ee7bd6-fddf-46cf-8ce4-079e5920cba2" | |
| } | |
| ] | |
| }, | |
| "4": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.13+galaxy2", | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": { | |
| "input": { | |
| "id": 3, | |
| "output_name": "bam_output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputsam", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 469.234375, | |
| "height": 112, | |
| "left": 252.46875, | |
| "right": 452.46875, | |
| "top": 357.234375, | |
| "width": 200, | |
| "x": 252.46875, | |
| "y": 357.234375 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutputsam": { | |
| "action_arguments": { | |
| "newname": "Mapped read pairs (filtered bwa-mem result)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.13+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "0dbf49c414ae", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"quality\": \"20\", \"library\": \"\", \"cigarcons\": null, \"inclusive_filter\": [\"1\", \"2\"], \"exclusive_filter\": null, \"exclusive_filter_all\": null, \"tag\": null, \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"fraction\", \"__current_case__\": 0, \"factor\": \"1.0\", \"seed\": null}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": \"false\", \"adv_output\": {\"readtags\": [], \"collapsecigar\": \"false\"}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.13+galaxy2", | |
| "type": "tool", | |
| "uuid": "e5907460-126f-40a0-9cfd-be33fb79c990", | |
| "workflow_outputs": [ | |
| { | |
| "label": "filtered_mapped_reads", | |
| "output_name": "outputsam", | |
| "uuid": "711e76f8-acf5-49f2-a74d-f3eb87a87ec5" | |
| } | |
| ] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.3", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "input": { | |
| "id": 4, | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Samtools stats", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 399.015625, | |
| "height": 112, | |
| "left": 527.671875, | |
| "right": 727.671875, | |
| "top": 287.015625, | |
| "width": 200, | |
| "x": 527.671875, | |
| "y": 287.015625 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "1cc79f49b8d5", | |
| "name": "samtools_stats", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cov_threshold\": null, \"coverage_cond\": {\"coverage_select\": \"no\", \"__current_case__\": 0}, \"filter_by_flags\": {\"filter_flags\": \"nofilter\", \"__current_case__\": 1}, \"gc_depth\": null, \"input\": {\"__class__\": \"ConnectedValue\"}, \"insert_size\": null, \"most_inserts\": null, \"read_group\": null, \"read_length\": null, \"remove_dups\": \"false\", \"remove_overlaps\": \"false\", \"sparse\": \"false\", \"split_output_cond\": {\"split_output_selector\": \"no\", \"__current_case__\": 0}, \"trim_quality\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.0.3", | |
| "type": "tool", | |
| "uuid": "290db975-2f61-42a9-8ab9-53f9c9bf638a", | |
| "workflow_outputs": [ | |
| { | |
| "label": "mapped_reads_stats", | |
| "output_name": "output", | |
| "uuid": "ba8ba259-2114-47d7-8555-16b74d482626" | |
| } | |
| ] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "inputFile": { | |
| "id": 4, | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "MarkDuplicates", | |
| "outputs": [ | |
| { | |
| "name": "metrics_file", | |
| "type": "txt" | |
| }, | |
| { | |
| "name": "outFile", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 653.421875, | |
| "height": 182, | |
| "left": 472.046875, | |
| "right": 672.046875, | |
| "top": 471.421875, | |
| "width": 200, | |
| "x": 472.046875, | |
| "y": 471.421875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "881d7645d1bf", | |
| "name": "picard", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"assume_sorted\": \"true\", \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": \"true\", \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.18.2.3", | |
| "type": "tool", | |
| "uuid": "dfeec15a-ab76-44e8-8e41-ce4f53289f01", | |
| "workflow_outputs": [ | |
| { | |
| "label": "markduplicates_stats", | |
| "output_name": "metrics_file", | |
| "uuid": "90c70f5f-8fee-4648-884d-ebdbf05779cb" | |
| }, | |
| { | |
| "label": "markduplicates_reads", | |
| "output_name": "outFile", | |
| "uuid": "eb88f5cb-a4d8-41bd-a9ca-617d2edaf041" | |
| } | |
| ] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "reads": { | |
| "id": 6, | |
| "output_name": "outFile" | |
| }, | |
| "reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Realign reads", | |
| "outputs": [ | |
| { | |
| "name": "realigned", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 843.140625, | |
| "height": 162, | |
| "left": 609.671875, | |
| "right": 809.671875, | |
| "top": 681.140625, | |
| "width": 200, | |
| "x": 609.671875, | |
| "y": 681.140625 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_viterbi/lofreq_viterbi/2.1.5+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "aa35ee7f3ab2", | |
| "name": "lofreq_viterbi", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv_options\": {\"keepflags\": \"false\", \"bq2_handling\": {\"replace_bq2\": \"keep\", \"__current_case__\": 0, \"defqual\": \"2\"}}, \"reads\": {\"__class__\": \"ConnectedValue\"}, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy0", | |
| "type": "tool", | |
| "uuid": "4b611028-980b-436f-8fda-e604d4b1fd71", | |
| "workflow_outputs": [ | |
| { | |
| "label": "realigned_deduplicated_filtered_mapped_reads", | |
| "output_name": "realigned", | |
| "uuid": "ad859e0d-38ec-4e17-aefe-42ca2cbbfc20" | |
| } | |
| ] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy0", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 2, | |
| "output_name": "report_json" | |
| }, | |
| "results_1|software_cond|output_0|type|input": { | |
| "id": 5, | |
| "output_name": "output" | |
| }, | |
| "results_2|software_cond|output_0|input": { | |
| "id": 6, | |
| "output_name": "metrics_file" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "stats", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 431.46875, | |
| "height": 282, | |
| "left": 965.171875, | |
| "right": 1165.171875, | |
| "top": 149.46875, | |
| "width": 200, | |
| "x": 965.171875, | |
| "y": 149.46875 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionstats": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "stats" | |
| }, | |
| "RenameDatasetActionhtml_report": { | |
| "action_arguments": { | |
| "newname": "Preprocessing and mapping reports" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "html_report" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "9a913cdee30e", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": \"false\", \"flat\": \"false\", \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastp\", \"__current_case__\": 7, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 24, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"stats\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 17, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.11+galaxy0", | |
| "type": "tool", | |
| "uuid": "f87cae1e-1c65-4e6b-b5ab-6e077ae3cfb2", | |
| "workflow_outputs": [ | |
| { | |
| "label": "preprocessing_and_mapping_reports", | |
| "output_name": "html_report", | |
| "uuid": "4ffd2a85-5ed3-4365-a425-301ff8cb4413" | |
| } | |
| ] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy0", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "reads": { | |
| "id": 7, | |
| "output_name": "realigned" | |
| }, | |
| "strategy|reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Insert indel qualities", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 1045.1875, | |
| "height": 182, | |
| "left": 725.734375, | |
| "right": 925.734375, | |
| "top": 863.1875, | |
| "width": 200, | |
| "x": 725.734375, | |
| "y": 863.1875 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Fully processed reads for variant calling (deduplicated, realigned reads with added indelquals)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_indelqual/lofreq_indelqual/2.1.5+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "426d707dfc47", | |
| "name": "lofreq_indelqual", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"reads\": {\"__class__\": \"ConnectedValue\"}, \"strategy\": {\"selector\": \"dindel\", \"__current_case__\": 1, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy0", | |
| "type": "tool", | |
| "uuid": "59600224-396f-49d2-add0-30f66519e98f", | |
| "workflow_outputs": [ | |
| { | |
| "label": "realigned_deduplicated_filtered_mapped_reads_with_indel_quals", | |
| "output_name": "output", | |
| "uuid": "46d8cf28-7c9c-4109-a0c3-14f90db52e47" | |
| } | |
| ] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy1", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "reads": { | |
| "id": 9, | |
| "output_name": "output" | |
| }, | |
| "reference_source|ref": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Call variants", | |
| "outputs": [ | |
| { | |
| "name": "variants", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 1180.671875, | |
| "height": 122, | |
| "left": 854.796875, | |
| "right": 1054.796875, | |
| "top": 1058.671875, | |
| "width": 200, | |
| "x": 854.796875, | |
| "y": 1058.671875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e1461b5c52a0", | |
| "name": "lofreq_call", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"call_control\": {\"set_call_options\": \"yes\", \"__current_case__\": 1, \"coverage\": {\"min_cov\": \"5\", \"max_depth\": \"1000000\"}, \"pe\": {\"use_orphan\": \"false\"}, \"bc_quals\": {\"min_bq\": \"30\", \"min_alt_bq\": \"30\", \"alt_bq\": {\"modify\": \"\", \"__current_case__\": 0}}, \"align_quals\": {\"alnqual\": {\"use_alnqual\": \"\", \"__current_case__\": 0, \"alnqual_choice\": {\"alnquals_to_use\": \"\", \"__current_case__\": 1, \"extended_baq\": \"true\"}}}, \"map_quals\": {\"min_mq\": \"20\", \"use_mq\": {\"no_mq\": \"\", \"__current_case__\": 0, \"max_mq\": \"255\"}}, \"source_qual\": {\"use_src_qual\": {\"src_qual\": \"\", \"__current_case__\": 0}}, \"joint_qual\": {\"min_jq\": \"0\", \"min_alt_jq\": \"0\", \"def_alt_jq\": \"0\"}}, \"filter_control\": {\"filter_type\": \"set_custom\", \"__current_case__\": 3, \"sig\": \"0.0005\", \"bonf\": \"0\", \"others\": \"false\"}, \"reads\": {\"__class__\": \"ConnectedValue\"}, \"reference_source\": {\"ref_selector\": \"history\", \"__current_case__\": 1, \"ref\": {\"__class__\": \"ConnectedValue\"}}, \"regions\": {\"restrict_to_region\": \"genome\", \"__current_case__\": 0}, \"variant_types\": \"--call-indels\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy1", | |
| "type": "tool", | |
| "uuid": "04fddca2-1b1e-4483-a269-24302ef7359c", | |
| "workflow_outputs": [ | |
| { | |
| "label": "called_variants", | |
| "output_name": "variants", | |
| "uuid": "e1da347a-271a-4e22-bfc3-9dd9ac7bf929" | |
| } | |
| ] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "invcf": { | |
| "id": 10, | |
| "output_name": "variants" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Lofreq filter", | |
| "outputs": [ | |
| { | |
| "name": "outvcf", | |
| "type": "vcf" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 995.296875, | |
| "height": 112, | |
| "left": 1052.3125, | |
| "right": 1252.3125, | |
| "top": 883.296875, | |
| "width": 200, | |
| "x": 1052.3125, | |
| "y": 883.296875 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/lofreq_filter/lofreq_filter/2.1.5+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "7dfca164d2e3", | |
| "name": "lofreq_filter", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"af\": {\"af_min\": \"0.0\", \"af_max\": \"0.0\"}, \"coverage\": {\"cov_min\": \"0\", \"cov_max\": \"0\"}, \"filter_by_type\": {\"keep_only\": \"\", \"__current_case__\": 0, \"qual\": {\"snvqual_filter\": {\"snvqual\": \"no\", \"__current_case__\": 0}, \"indelqual_filter\": {\"indelqual\": \"no\", \"__current_case__\": 0}}}, \"flag_or_drop\": \"--print-all\", \"invcf\": {\"__class__\": \"ConnectedValue\"}, \"sb\": {\"sb_filter\": {\"strand_bias\": \"mtc\", \"__current_case__\": 2, \"sb_alpha\": \"0.001\", \"sb_mtc\": \"fdr\", \"sb_compound\": \"true\", \"sb_indels\": \"false\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1.5+galaxy0", | |
| "type": "tool", | |
| "uuid": "1b2ce667-2a63-4376-b711-b103ea37ba8b", | |
| "workflow_outputs": [ | |
| { | |
| "label": "soft_filtered_variants", | |
| "output_name": "outvcf", | |
| "uuid": "7a8648d0-c844-43a5-85f8-27220011725a" | |
| } | |
| ] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "input": { | |
| "id": 11, | |
| "output_name": "outvcf" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "intervals" | |
| }, | |
| { | |
| "description": "runtime parameter for tool SnpEff eff:", | |
| "name": "transcripts" | |
| } | |
| ], | |
| "label": "SnpEff eff covid19 version", | |
| "name": "SnpEff eff:", | |
| "outputs": [ | |
| { | |
| "name": "snpeff_output", | |
| "type": "vcf" | |
| }, | |
| { | |
| "name": "statsFile", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "bottom": 751.359375, | |
| "height": 302, | |
| "left": 1235.359375, | |
| "right": 1435.359375, | |
| "top": 449.359375, | |
| "width": 200, | |
| "x": 1235.359375, | |
| "y": 449.359375 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionsnpeff_output": { | |
| "action_arguments": { | |
| "newname": "Final (SnpEff-)annotated variants" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "snpeff_output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpeff_sars_cov_2/snpeff_sars_cov_2/4.5covid19", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2a3a00c1fa0a", | |
| "name": "snpeff_sars_cov_2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"annotations\": [\"-formatEff\", \"-classic\"], \"chr\": \"\", \"csvStats\": \"false\", \"filter\": {\"specificEffects\": \"no\", \"__current_case__\": 0}, \"filterOut\": [\"-no-downstream\", \"-no-intergenic\", \"-no-upstream\", \"-no-utr\"], \"generate_stats\": \"true\", \"genome_version\": \"NC_045512.2\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"inputFormat\": \"vcf\", \"intervals\": {\"__class__\": \"RuntimeValue\"}, \"noLog\": \"true\", \"offset\": \"default\", \"outputConditional\": {\"outputFormat\": \"vcf\", \"__current_case__\": 0}, \"transcripts\": {\"__class__\": \"RuntimeValue\"}, \"udLength\": \"0\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.5covid19", | |
| "type": "tool", | |
| "uuid": "6808f1c5-55da-4e39-a453-e215650d22e7", | |
| "workflow_outputs": [ | |
| { | |
| "label": "annotated_variants", | |
| "output_name": "snpeff_output", | |
| "uuid": "218ed74c-5d87-472a-88f4-6b06559e7885" | |
| }, | |
| { | |
| "label": "annotated_variants_stats", | |
| "output_name": "statsFile", | |
| "uuid": "1986e97d-92a8-4812-99e7-42818115e675" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "COVID-19", | |
| "covid19.galaxyproject.org", | |
| "iwc", | |
| "emergen_validated" | |
| ], | |
| "uuid": "6695eb16-30a5-42ea-8591-56f2630cf8bf", | |
| "version": 4 | |
| }, | |
| "updated": "2024-12-03T18:32:54.040796", | |
| "readme": "COVID-19: variation analysis on WGS PE data\n-------------------------------------------\n\nThis workflows performs paired end read mapping with bwa-mem followed by\nsensitive variant calling across a wide range of AFs with lofreq and variant\nannotation with snpEff 4.5covid19.\n", | |
| "changelog": "# Changelog\n\n## [0.2.4] 2023-11-20\n\n- Fix author in dockstore\n- Use zenodo link instead of googleapis for fastq\n\n## [0.2.3] 2022-02-04\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.20.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.2+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.1` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.9+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.13`\n- `toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.2+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.3`\n- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.2` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3`\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.9+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/lofreq_call/lofreq_call/2.1.5+galaxy1`\n\n## [0.2.2] 2021-12-13\n\n### Added\n- Added GitHub Actions workflow. No functional changes.\n\n## [0.2.1] 2021-07-23\n\n### Added\n\nAdded RO-Crate metadata file. No functional changes.\n\n## [0.2] 2021-06-17\n\n### Changed\n\n- Upgrade multiqc to 1.9+galaxy1\n\n## [0.1]\n\n- Initial version of COVID-19: variation analysis on WGS PE data workflow\n", | |
| "diagrams": "# Workflow diagrams\n\n## COVID-19: variation analysis on WGS PE data\n\n```mermaid\ngraph LR\n0[\"ℹ️ Paired Collection\"]@{ shape: docs }\n1[\"ℹ️ NC_045512.2 FASTA sequence of SARS-CoV-2\"]@{ shape: doc }\n2[\"fastp\"]@{ shape: process }\n0 --> 2\n3[\"Map with BWA-MEM\"]@{ shape: process }\n2 --> 3\n1 --> 3\n4[\"Samtools view\"]@{ shape: process }\n3 --> 4\n5[\"Samtools stats\"]@{ shape: process }\n4 --> 5\n6[\"MarkDuplicates\"]@{ shape: process }\n4 --> 6\n7[\"Realign reads\"]@{ shape: process }\n6 --> 7\n1 --> 7\n8[\"MultiQC\"]@{ shape: process }\n2 --> 8\n5 --> 8\n6 --> 8\n9[\"Insert indel qualities\"]@{ shape: process }\n7 --> 9\n1 --> 9\n10[\"Call variants\"]@{ shape: process }\n9 --> 10\n1 --> 10\n11[\"Lofreq filter\"]@{ shape: process }\n10 --> 11\n12[\"SnpEff eff covid19 version\"]@{ shape: process }\n11 --> 12\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/sars-cov-2-pe-illumina-wgs-variant-calling/COVID-19-PE-WGS-ILLUMINA", | |
| "dockstore_id": 16243, | |
| "categories": [ | |
| "COVID-19" | |
| ], | |
| "collections": [ | |
| "SARS-COV-2" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test workflow execution using paired end illumina accession", | |
| "job": { | |
| "NC_045512.2 FASTA sequence of SARS-CoV-2": { | |
| "class": "File", | |
| "location": "https://zenodo.org/record/4555735/files/NC_045512.2_reference.fasta?download=1" | |
| }, | |
| "Paired Collection": { | |
| "class": "Collection", | |
| "collection_type": "list:paired", | |
| "elements": [ | |
| { | |
| "class": "Collection", | |
| "type": "paired", | |
| "identifier": "SRR11578257", | |
| "elements": [ | |
| { | |
| "identifier": "forward", | |
| "class": "File", | |
| "location": "https://zenodo.org/records/10174466/files/SRR11578257_R1.fastq.gz?download=1" | |
| }, | |
| { | |
| "identifier": "reverse", | |
| "class": "File", | |
| "location": "https://zenodo.org/records/10174466/files/SRR11578257_R2.fastq.gz?download=1" | |
| } | |
| ] | |
| } | |
| ] | |
| } | |
| }, | |
| "outputs": { | |
| "annotated_variants": { | |
| "attributes": {}, | |
| "element_tests": { | |
| "SRR11578257": { | |
| "path": "test-data/final_snpeff_annotated_variants.vcf", | |
| "compare": "diff", | |
| "lines_diff": 6 | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-wgs-variant-calling" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "main", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/chipseq-sr.ga", | |
| "testParameterFiles": [ | |
| "/chipseq-sr-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Lucille Delisle", | |
| "orcid": "0000-0002-1964-4960" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow takes as input a collection of fastqs (single reads). Remove adapters with cutadapt, map with bowtie2. Keep MAPQ30. MACS2 for bam with fixed extension or model.", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-1964-4960", | |
| "name": "Lucille Delisle" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "release": "0.12", | |
| "name": "ChIPseq_SR", | |
| "steps": { | |
| "0": { | |
| "annotation": "Should be a collection with ChIPseq fastqs", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Should be a collection with ChIPseq fastqs", | |
| "name": "SR fastq input" | |
| } | |
| ], | |
| "label": "SR fastq input", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 0 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": \"\", \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "e09c0852-1db3-4a68-b88c-1b94c205cb6c", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ", | |
| "name": "adapter_forward" | |
| } | |
| ], | |
| "label": "adapter_forward", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 39.0333251953125, | |
| "top": 77.44999694824219 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "30c1d867-5e73-4348-8969-848f58d94015", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "reference_genome", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "reference_genome", | |
| "name": "reference_genome" | |
| } | |
| ], | |
| "label": "reference_genome", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 62.7833251953125, | |
| "top": 169.9666748046875 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "0119d669-7ce9-46fd-ba6f-3efd92dfb7f2", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "name": "effective_genome_size" | |
| } | |
| ], | |
| "label": "effective_genome_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 106.23333740234375, | |
| "top": 262.3999938964844 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "5bb3b3df-60ab-4ec7-88e4-476be547ffbf", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "Whether you want to have a profile normalized as Signal to Million Reads", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Whether you want to have a profile normalized as Signal to Million Reads", | |
| "name": "normalize_profile" | |
| } | |
| ], | |
| "label": "normalize_profile", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 163.95545543674132, | |
| "top": 359.9555974960296 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "b89b796d-df4f-416f-8bc4-4f1951efa449", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "library|input_1": { | |
| "id": 0, | |
| "output_name": "output" | |
| }, | |
| "library|r1|adapters_0|adapter_source|adapter": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Cutadapt", | |
| "name": "library" | |
| } | |
| ], | |
| "label": "Cutadapt (remove adapter + bad quality bases)", | |
| "name": "Cutadapt", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "fastqsanger" | |
| }, | |
| { | |
| "name": "report", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 423.31666564941406, | |
| "top": 80.16667175292969 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| }, | |
| "HideDatasetActionreport": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "report" | |
| }, | |
| "RenameDatasetActionreport": { | |
| "action_arguments": { | |
| "newname": "cutadapt report" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "report" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5eb7e84243f2", | |
| "name": "cutadapt", | |
| "owner": "lparsons", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": []}}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"30\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": \"\", \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.9+galaxy1", | |
| "type": "tool", | |
| "uuid": "c7846b4c-54fb-458e-982e-c0d8358a9f5d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "library|input_1": { | |
| "id": 5, | |
| "output_name": "out1" | |
| }, | |
| "reference_genome|index": { | |
| "id": 2, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Bowtie2", | |
| "name": "library" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Bowtie2", | |
| "name": "reference_genome" | |
| } | |
| ], | |
| "label": "Bowtie2 map on reference", | |
| "name": "Bowtie2", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bam" | |
| }, | |
| { | |
| "name": "mapping_stats", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 718.6333312988281, | |
| "top": 459.8500061035156 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionmapping_stats": { | |
| "action_arguments": { | |
| "newname": "mapping stats" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "mapping_stats" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "bowtie2 output (BAM)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "d5ceb9f3c25b", | |
| "name": "bowtie2", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"no_presets\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.5.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "6fd8444b-f305-4daa-a33a-5cb44e063f39", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "mapping stats", | |
| "output_name": "mapping_stats", | |
| "uuid": "75a21a1c-1a84-4e7e-8b40-2bd11310f590" | |
| } | |
| ] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "input1": { | |
| "id": 6, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Filter SAM or BAM, output SAM or BAM", | |
| "name": "bed_file" | |
| } | |
| ], | |
| "label": "filter MAPQ30", | |
| "name": "Filter SAM or BAM, output SAM or BAM", | |
| "outputs": [ | |
| { | |
| "name": "output1", | |
| "type": "sam" | |
| } | |
| ], | |
| "position": { | |
| "left": 1114.0499877929688, | |
| "top": 604.2999877929688 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput1": { | |
| "action_arguments": { | |
| "newname": "filtered BAM" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "649a225999a5", | |
| "name": "samtool_filter2", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"flag\": {\"filter\": \"no\", \"__current_case__\": 0}, \"header\": \"-h\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"library\": \"\", \"mapq\": \"30\", \"outputtype\": \"bam\", \"possibly_select_inverse\": false, \"read_group\": \"\", \"regions\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.8+galaxy1", | |
| "type": "tool", | |
| "uuid": "bb6e3ac5-cdb0-493c-b534-264ba530a711", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "filtered BAM", | |
| "output_name": "output1", | |
| "uuid": "053ba410-9509-42fd-9b88-0cb749e1738d" | |
| } | |
| ] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "advanced_options|spmr": { | |
| "id": 4, | |
| "output_name": "output" | |
| }, | |
| "effective_genome_size_options|gsize": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "treatment|input_treatment_file": { | |
| "id": 7, | |
| "output_name": "output1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "advanced_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "effective_genome_size_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "treatment" | |
| } | |
| ], | |
| "label": "Call Peaks with MACS2", | |
| "name": "MACS2 callpeak", | |
| "outputs": [ | |
| { | |
| "name": "output_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_narrowpeaks", | |
| "type": "bed" | |
| }, | |
| { | |
| "name": "output_summits", | |
| "type": "bed" | |
| }, | |
| { | |
| "name": "output_treat_pileup", | |
| "type": "bedgraph" | |
| }, | |
| { | |
| "name": "output_control_lambda", | |
| "type": "bedgraph" | |
| }, | |
| { | |
| "name": "output_extra_files", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 1555.199951171875, | |
| "top": 337.98333740234375 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_control_lambda": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_control_lambda" | |
| }, | |
| "HideDatasetActionoutput_extra_files": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_extra_files" | |
| }, | |
| "HideDatasetActionoutput_treat_pileup": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| }, | |
| "RenameDatasetActionoutput_control_lambda": { | |
| "action_arguments": { | |
| "newname": "MACS2 control coverage" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_control_lambda" | |
| }, | |
| "RenameDatasetActionoutput_narrowpeaks": { | |
| "action_arguments": { | |
| "newname": "MACS2 narrowPeak" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "RenameDatasetActionoutput_summits": { | |
| "action_arguments": { | |
| "newname": "MACS2 summits" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_summits" | |
| }, | |
| "RenameDatasetActionoutput_tabular": { | |
| "action_arguments": { | |
| "newname": "MACS2 peaks xls" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_treat_pileup": { | |
| "action_arguments": { | |
| "newname": "MACS2 treatment coverage" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86e2413cf3f8", | |
| "name": "macs2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": {\"__class__\": \"ConnectedValue\"}, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAM\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"0\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.9.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "06ca906e-c512-4376-9ffc-8eb2b5774af1", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MACS2 peaks", | |
| "output_name": "output_tabular", | |
| "uuid": "1be026e2-7e00-4d96-869c-9763f87477d8" | |
| }, | |
| { | |
| "label": "MACS2 narrowPeak", | |
| "output_name": "output_narrowpeaks", | |
| "uuid": "5e4fb64b-40f1-4b07-b0c0-6a9fc6eb08b2" | |
| }, | |
| { | |
| "label": "MACS2 summits", | |
| "output_name": "output_summits", | |
| "uuid": "146bf7b5-1ecb-4099-a52f-e48bc9f45d27" | |
| } | |
| ] | |
| }, | |
| "9": { | |
| "annotation": "summary of MACS2", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "infile": { | |
| "id": 8, | |
| "output_name": "output_tabular" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "summary of MACS2", | |
| "name": "Search in textfiles", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1965.11669921875, | |
| "top": 208.98333740234375 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionoutput": { | |
| "action_arguments": { | |
| "newtype": "txt" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "MACS2 report" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-P\", \"url_paste\": \"^#\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "95832fa1-e96e-4867-8162-d1e39cb1dc46", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MACS2 report", | |
| "output_name": "output", | |
| "uuid": "acb6f9ef-7210-4477-a8aa-ed1898e32e96" | |
| } | |
| ] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "wig_to_bigWig", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "input1": { | |
| "id": 8, | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Bigwig from MACS2", | |
| "name": "Wig/BedGraph-to-bigWig", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 2026.9666748046875, | |
| "top": 487.2833251953125 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "coverage from MACS2 (bigwig)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "wig_to_bigWig", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "0fe57c5d-00a0-4cb6-9bac-97e6d03c6b76", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "coverage from MACS2", | |
| "output_name": "out_file1", | |
| "uuid": "1ab01ce0-8f89-4695-9e99-4cf969ec7d1e" | |
| } | |
| ] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 5, | |
| "output_name": "report" | |
| }, | |
| "results_1|software_cond|input": { | |
| "id": 6, | |
| "output_name": "mapping_stats" | |
| }, | |
| "results_2|software_cond|input": { | |
| "id": 8, | |
| "output_name": "output_tabular" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "MultiQC", | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "plots", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "stats", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2074.183349609375, | |
| "top": 866.2833251953125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionplots": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "plots" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "f7e2f1eb3a16", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.24.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "fb066848-43df-412a-9767-9613bac7d961", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MultiQC webpage", | |
| "output_name": "html_report", | |
| "uuid": "2167289f-6c78-479a-8d3b-95caf11d0c4e" | |
| }, | |
| { | |
| "label": "MultiQC on input dataset(s): Stats", | |
| "output_name": "stats", | |
| "uuid": "d4c3e0a7-d5b7-4307-8669-0254a3723ce0" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "ChIP" | |
| ], | |
| "uuid": "fe6bda9f-1fc2-4a86-bf8d-e779c79466fc", | |
| "version": 1 | |
| }, | |
| "updated": "2024-12-03T18:32:53.980037", | |
| "readme": "# ChIP-seq single-read Workflow\n\n## Inputs dataset\n\n- The workflow needs a single input which is a list of fastqsanger files.\n\n## Inputs values\n\n- adapters sequence_forward: this depends on the library preparation. If you don't know, use FastQC to determine if it is Truseq or Nextera.\n- reference_genome: this field will be adapted to the genomes available for bowtie2.\n- effective_genome_size: this is used by MACS2 and may be entered manually (indications are provided for heavily used genomes).\n- normalize_profile: Whether you want to have a profile normalized as Signal to Million Reads.\n\n## Processing\n\n- The workflow will remove illumina adapters and low quality bases and filter out any read smaller than 15bp.\n- The filtered reads are mapped with bowtie2 with default parameters.\n- The BAM is filtered to keep only MAPQ30.\n- The peaks are called with MACS2 with a fixed extension of 200bp which at the same time generates a coverage file (normalized or not).\n- The coverage is converted to bigwig.\n- A MultiQC is run to have an overview of the QC.\n\n### Warning\n\n- The filtered bam still has PCR duplicates which are removed by MACS2.\n", | |
| "changelog": "# Changelog\n\n## [0.12] 2024-09-23\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0`\n\n## [0.11] 2024-07-15\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy0`\n\n## [0.10] 2024-05-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1`\n\n## [0.9] 2024-04-22\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0`\n\n## [0.8] 2024-04-08\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1`\n\n## [0.7] 2024-03-25\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0`\n\n## [0.6] 2024-02-05\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy0`\n\n## [0.5] 2023-10-17\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0`\n\n## [0.4] 2023-06-17\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0`\n\n### Manual update\n- New parameter to get normalized profile\n\n## [0.3] 2022-12-17\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1`\n\n## [0.2] 2022-11-28\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.4.5+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0`\n\n## [0.1] 2022-10-18\nFirst release.\n", | |
| "diagrams": "# Workflow diagrams\n\n## ChIPseq_SR\n\n```mermaid\ngraph LR\n0[\"ℹ️ SR fastq input\"]@{ shape: docs }\n1[\"ℹ️ adapter_forward\"]@{ shape: lean-l }\n2[\"ℹ️ reference_genome\"]@{ shape: lean-l }\n3[\"ℹ️ effective_genome_size\"]@{ shape: lean-l }\n4[\"ℹ️ normalize_profile\"]@{ shape: lean-l }\n5[\"Cutadapt (remove adapter + bad quality bases)\"]@{ shape: process }\n0 --> 5\n1 --> 5\n6[\"Bowtie2 map on reference\"]@{ shape: process }\n5 --> 6\n2 --> 6\n7[\"filter MAPQ30\"]@{ shape: process }\n6 --> 7\n8[\"Call Peaks with MACS2\"]@{ shape: process }\n4 --> 8\n3 --> 8\n7 --> 8\n9[\"summary of MACS2\"]@{ shape: process }\n8 --> 9\n10[\"Bigwig from MACS2\"]@{ shape: process }\n8 --> 10\n11[\"MultiQC\"]@{ shape: process }\n5 --> 11\n6 --> 11\n8 --> 11\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/chipseq-sr/main", | |
| "dockstore_id": 19837, | |
| "categories": [], | |
| "collections": [ | |
| "Epigenetics" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test outline for ChIPseq_SR", | |
| "job": { | |
| "SR fastq input": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "identifier": "wt_H3K4me3", | |
| "class": "File", | |
| "location": "https://zenodo.org/record/1324070/files/wt_H3K4me3_read1.fastq.gz", | |
| "filetype": "fastqsanger" | |
| } | |
| ] | |
| }, | |
| "adapter_forward": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", | |
| "reference_genome": "mm10", | |
| "effective_genome_size": 1870000000, | |
| "normalize_profile": true | |
| }, | |
| "outputs": { | |
| "MultiQC webpage": { | |
| "asserts": [ | |
| { | |
| "that": "has_text", | |
| "text": "wt_H3K4me3" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "<a href=\"#cutadapt_filtered_reads\" class=\"nav-l2\">Filtered Reads</a>" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "<a href=\"#bowtie2\" class=\"nav-l1\">Bowtie 2 / HiSAT2</a>" | |
| } | |
| ] | |
| }, | |
| "MultiQC on input dataset(s): Stats": { | |
| "asserts": { | |
| "has_line": { | |
| "line": "Sample\tMACS2_mqc_generalstats_macs2_d\tMACS2_mqc_generalstats_macs2_treatment_redundant_rate\tMACS2_mqc_generalstats_macs2_peak_count\tBowtie 2 / HiSAT2_mqc_generalstats_bowtie_2_hisat2_overall_alignment_rate\tCutadapt_mqc_generalstats_cutadapt_percent_trimmed" | |
| }, | |
| "has_text_matching": { | |
| "expression": "wt_H3K4me3\t200.0\t0.0\t4\t98.[0-9]*\t4.6[0-9]*" | |
| } | |
| } | |
| }, | |
| "filtered BAM": { | |
| "element_tests": { | |
| "wt_H3K4me3": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 2547967, | |
| "delta": 200000 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 summits": { | |
| "element_tests": { | |
| "wt_H3K4me3": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 4 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 peaks": { | |
| "element_tests": { | |
| "wt_H3K4me3": { | |
| "asserts": [ | |
| { | |
| "that": "has_text", | |
| "text": "# effective genome size = 1.87e+09" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "# d = 200" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "# tags after filtering in treatment: 44038" | |
| } | |
| ] | |
| } | |
| } | |
| }, | |
| "MACS2 narrowPeak": { | |
| "element_tests": { | |
| "wt_H3K4me3": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 4 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 report": { | |
| "element_tests": { | |
| "wt_H3K4me3": { | |
| "asserts": [ | |
| { | |
| "that": "has_text", | |
| "text": "# effective genome size = 1.87e+09" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "# d = 200" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "# tags after filtering in treatment: 44038" | |
| } | |
| ] | |
| } | |
| } | |
| }, | |
| "coverage from MACS2": { | |
| "element_tests": { | |
| "wt_H3K4me3": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 559925, | |
| "delta": 10000 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "mapping stats": { | |
| "element_tests": { | |
| "wt_H3K4me3": { | |
| "asserts": [ | |
| { | |
| "that": "has_text", | |
| "text": "49251 reads; of these:" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "43525 (88.37%) aligned exactly 1 time" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "98.37% overall alignment rate" | |
| } | |
| ] | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/epigenetics/chipseq-sr" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "main", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/cutandrun.ga", | |
| "testParameterFiles": [ | |
| "/cutandrun-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Lucille Delisle", | |
| "orcid": "0000-0002-1964-4960" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow take as input a collection of paired fastq. Remove adapters with cutadapt, map pairs with bowtie2 allowing dovetail. Keep MAPQ30 and concordant pairs. BAM to BED. MACS2 with \"ATAC\" parameters.", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-1964-4960", | |
| "name": "Lucille Delisle" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "release": "0.13", | |
| "name": "CUTandRUN", | |
| "steps": { | |
| "0": { | |
| "annotation": "Should be a paired collection with CUT and RUN fastqs", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Should be a paired collection with CUT and RUN fastqs", | |
| "name": "PE fastq input" | |
| } | |
| ], | |
| "label": "PE fastq input", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 268 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": \"\", \"collection_type\": \"list:paired\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "9fbb875d-05b1-4557-bd2e-710f80dd1a21", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC ", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC ", | |
| "name": "adapter_forward" | |
| } | |
| ], | |
| "label": "adapter_forward", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 22, | |
| "top": 375 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "1eac70a4-a4b7-42c7-82cd-913f23b4f941", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA", | |
| "name": "adapter_reverse" | |
| } | |
| ], | |
| "label": "adapter_reverse", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 62, | |
| "top": 483 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "68b198e5-7de8-445f-807f-7f432090e2c7", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "reference_genome", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "reference_genome", | |
| "name": "reference_genome" | |
| } | |
| ], | |
| "label": "reference_genome", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 128, | |
| "top": 589 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "7f16a988-8ead-4a4a-9be1-8f5fbb744dec", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "name": "effective_genome_size" | |
| } | |
| ], | |
| "label": "effective_genome_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 176, | |
| "top": 689 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "aae90433-355d-4f27-bdfb-77f8bc4fcff5", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "Whether you want to have a profile normalized as Signal to Million Reads", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Whether you want to have a profile normalized as Signal to Million Reads", | |
| "name": "normalize_profile" | |
| } | |
| ], | |
| "label": "normalize_profile", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 228, | |
| "top": 780.4016399999857 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"boolean\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "a2c8d3e2-7542-4feb-8523-6100983ddb3b", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "library|input_1": { | |
| "id": 0, | |
| "output_name": "output" | |
| }, | |
| "library|r1|adapters_0|adapter_source|adapter": { | |
| "id": 1, | |
| "output_name": "output" | |
| }, | |
| "library|r2|adapters2_0|adapter_source|adapter": { | |
| "id": 2, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Cutadapt", | |
| "name": "library" | |
| } | |
| ], | |
| "label": "Cutadapt (remove adapter + bad quality bases)", | |
| "name": "Cutadapt", | |
| "outputs": [ | |
| { | |
| "name": "out_pairs", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "report", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 288, | |
| "top": 180 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_pairs": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_pairs" | |
| }, | |
| "HideDatasetActionreport": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "report" | |
| }, | |
| "RenameDatasetActionreport": { | |
| "action_arguments": { | |
| "newname": "cutadapt report" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "report" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5eb7e84243f2", | |
| "name": "cutadapt", | |
| "owner": "lparsons", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC \", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA\", \"adapter\": {\"__class__\": \"ConnectedValue\"}}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"30\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": \"\", \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.9+galaxy1", | |
| "type": "tool", | |
| "uuid": "774b0604-628f-46a1-9088-a59d082e5317", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "library|input_1": { | |
| "id": 6, | |
| "output_name": "out_pairs" | |
| }, | |
| "reference_genome|index": { | |
| "id": 3, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Bowtie2", | |
| "name": "library" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Bowtie2", | |
| "name": "reference_genome" | |
| } | |
| ], | |
| "label": "Bowtie2 map on reference", | |
| "name": "Bowtie2", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bam" | |
| }, | |
| { | |
| "name": "mapping_stats", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 559, | |
| "top": 102 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionmapping_stats": { | |
| "action_arguments": { | |
| "newname": "mapping stats" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "mapping_stats" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "bowtie2 output (BAM)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "d5ceb9f3c25b", | |
| "name": "bowtie2", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"yes\", \"__current_case__\": 0, \"I\": \"0\", \"X\": \"1000\", \"fr_rf_ff\": \"--fr\", \"no_mixed\": false, \"no_discordant\": false, \"dovetail\": true, \"no_contain\": false, \"no_overlap\": false}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.5.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "407d46cc-d908-44eb-a4dd-125537498b17", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "Mapping stats", | |
| "output_name": "mapping_stats", | |
| "uuid": "87e15eab-1e45-4838-88b7-d2d8594f0de1" | |
| } | |
| ] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "input1": { | |
| "id": 7, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Filter SAM or BAM, output SAM or BAM", | |
| "name": "bed_file" | |
| } | |
| ], | |
| "label": "filter MAPQ30 concordant pairs", | |
| "name": "Filter SAM or BAM, output SAM or BAM", | |
| "outputs": [ | |
| { | |
| "name": "output1", | |
| "type": "sam" | |
| } | |
| ], | |
| "position": { | |
| "left": 834, | |
| "top": 23 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output1" | |
| }, | |
| "RenameDatasetActionoutput1": { | |
| "action_arguments": { | |
| "newname": "filtered BAM" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "649a225999a5", | |
| "name": "samtool_filter2", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"flag\": {\"filter\": \"yes\", \"__current_case__\": 1, \"reqBits\": [\"0x0002\"], \"skipBits\": null}, \"header\": \"-h\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"library\": \"\", \"mapq\": \"30\", \"outputtype\": \"bam\", \"possibly_select_inverse\": false, \"read_group\": \"\", \"regions\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.8+galaxy1", | |
| "type": "tool", | |
| "uuid": "b04312a6-1680-4d8e-9c70-f30f2d2be3cc", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "inputFile": { | |
| "id": 8, | |
| "output_name": "output1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "remove PCR duplicates", | |
| "name": "MarkDuplicates", | |
| "outputs": [ | |
| { | |
| "name": "metrics_file", | |
| "type": "txt" | |
| }, | |
| { | |
| "name": "outFile", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 1112, | |
| "top": 64 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionmetrics_file": { | |
| "action_arguments": { | |
| "newname": "MarkDuplicates metrics" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "metrics_file" | |
| }, | |
| "RenameDatasetActionoutFile": { | |
| "action_arguments": { | |
| "newname": "BAM filtered rmDup" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outFile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3f254c5ced1d", | |
| "name": "picard", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"assume_sorted\": true, \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": true, \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.1.1.0", | |
| "type": "tool", | |
| "uuid": "7f78ad5a-5250-4ced-aa7f-cf0802051c82", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "BAM filtered rmDup", | |
| "output_name": "outFile", | |
| "uuid": "4cb5b980-39bd-40ab-ad0a-8c90beffd11c" | |
| }, | |
| { | |
| "label": "MarkDuplicates metrics", | |
| "output_name": "metrics_file", | |
| "uuid": "3cec58d5-3851-4ccb-bab5-ae3f550df1e5" | |
| } | |
| ] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "input": { | |
| "id": 9, | |
| "output_name": "outFile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert BAM to BED to improve peak calling", | |
| "name": "bedtools BAM to BED", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 1387, | |
| "top": 37 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "BED filtered rmDup" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "f447290b-bd3d-403d-bc67-0765124b7a97", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "advanced_options|spmr": { | |
| "id": 5, | |
| "output_name": "output" | |
| }, | |
| "effective_genome_size_options|gsize": { | |
| "id": 4, | |
| "output_name": "output" | |
| }, | |
| "treatment|input_treatment_file": { | |
| "id": 10, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "advanced_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "effective_genome_size_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "treatment" | |
| } | |
| ], | |
| "label": "Call Peaks with MACS2", | |
| "name": "MACS2 callpeak", | |
| "outputs": [ | |
| { | |
| "name": "output_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_narrowpeaks", | |
| "type": "bed" | |
| }, | |
| { | |
| "name": "output_summits", | |
| "type": "bed" | |
| }, | |
| { | |
| "name": "output_treat_pileup", | |
| "type": "bedgraph" | |
| }, | |
| { | |
| "name": "output_control_lambda", | |
| "type": "bedgraph" | |
| }, | |
| { | |
| "name": "output_extra_files", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 1656, | |
| "top": 3 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_control_lambda": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_control_lambda" | |
| }, | |
| "HideDatasetActionoutput_extra_files": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_extra_files" | |
| }, | |
| "HideDatasetActionoutput_treat_pileup": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| }, | |
| "RenameDatasetActionoutput_control_lambda": { | |
| "action_arguments": { | |
| "newname": "MACS2 control coverage" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_control_lambda" | |
| }, | |
| "RenameDatasetActionoutput_narrowpeaks": { | |
| "action_arguments": { | |
| "newname": "MACS2 narrowPeak" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "RenameDatasetActionoutput_summits": { | |
| "action_arguments": { | |
| "newname": "MACS2 summits" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_summits" | |
| }, | |
| "RenameDatasetActionoutput_tabular": { | |
| "action_arguments": { | |
| "newname": "MACS2 peaks xls" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_treat_pileup": { | |
| "action_arguments": { | |
| "newname": "MACS2 treatment coverage" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86e2413cf3f8", | |
| "name": "macs2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": {\"__class__\": \"ConnectedValue\"}, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.9.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "1a6316d7-3ee1-482a-9264-77bc98090d73", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MACS2 summits", | |
| "output_name": "output_summits", | |
| "uuid": "7bed750a-c0a6-4fda-8f10-4605db362045" | |
| }, | |
| { | |
| "label": "MACS2 narrowPeak", | |
| "output_name": "output_narrowpeaks", | |
| "uuid": "be4e6c87-fb7b-40ed-ac6b-971aeda3631f" | |
| }, | |
| { | |
| "label": "MACS2 peaks xls", | |
| "output_name": "output_tabular", | |
| "uuid": "45eb5a1f-6036-40bf-8c10-5672cb1258ab" | |
| } | |
| ] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "infile": { | |
| "id": 11, | |
| "output_name": "output_tabular" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "summary of MACS2", | |
| "name": "Search in textfiles", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1946, | |
| "top": 0 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionoutput": { | |
| "action_arguments": { | |
| "newtype": "txt" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "MACS2 report" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-P\", \"url_paste\": \"^#\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "c3ff2b9d-d53a-40d9-8f4c-a7a2461dd7f5", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MACS2 report", | |
| "output_name": "output", | |
| "uuid": "8bf8fad7-3493-4424-a5bf-278457288166" | |
| } | |
| ] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "wig_to_bigWig", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "input1": { | |
| "id": 11, | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Bigwig from MACS2", | |
| "name": "Wig/BedGraph-to-bigWig", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 1945, | |
| "top": 139 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "Coverage from MACS2 (bigwig)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "wig_to_bigWig", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "4bac5ae5-8119-4ced-92cc-b2281d6199ba", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "Coverage from MACS2 (bigwig)", | |
| "output_name": "out_file1", | |
| "uuid": "4a8e2e9d-4896-4ffd-99b2-a3492e71053c" | |
| } | |
| ] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 6, | |
| "output_name": "report" | |
| }, | |
| "results_1|software_cond|input": { | |
| "id": 7, | |
| "output_name": "mapping_stats" | |
| }, | |
| "results_2|software_cond|output_0|input": { | |
| "id": 9, | |
| "output_name": "metrics_file" | |
| }, | |
| "results_3|software_cond|input": { | |
| "id": 11, | |
| "output_name": "output_tabular" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "MultiQC", | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "plots", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "stats", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 1936, | |
| "top": 415 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionplots": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "plots" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "f7e2f1eb3a16", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 17, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.24.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "0edf5e04-cc38-414c-9b57-117e919c435b", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MultiQC on input dataset(s): Stats", | |
| "output_name": "stats", | |
| "uuid": "59dfba75-8658-4213-8fd9-b3ce5a916f14" | |
| }, | |
| { | |
| "label": "MultiQC webpage", | |
| "output_name": "html_report", | |
| "uuid": "6d87436a-550e-4d76-a5da-d4463dfd4473" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "CUTnRUN" | |
| ], | |
| "uuid": "98e9e34b-b203-43db-9a23-5fa72963fa6d", | |
| "version": 1 | |
| }, | |
| "updated": "2024-12-03T18:32:53.983460", | |
| "readme": "# CUT&RUN (and CUT&TAG) Workflow\n\n## Inputs dataset\n\n- The workflow needs a single input which is a list of dataset pairs of fastqsanger.\n\n## Inputs values\n\n- adapter sequences: this depends on the library preparation. Usually CUT&RUN is Truseq and CUT&TAG is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera\n- reference_genome: this field will be adapted to the genomes available for bowtie2\n- effective_genome_size: this is used by macs2 and may be entered manually (indications are provided for heavily used genomes)\n- normalize_profile: Whether you want to have a profile normalized as Signal to Million Reads.\n\n## Processing\n\n- The workflow will remove illumina adapters and low quality bases and filter out any read smaller than 15bp\n- The filtered reads are mapped with bowtie2 allowing dovetail and fragment length up to 1kb\n- The BAM is filtered to keep only MAPQ30 and concordant pairs\n- The PCR duplicates are removed with Picard (only from version 0.6)\n- The BAM is converted to BED to enable macs2 to take both pairs into account\n- The peaks are called with macs2 which at the same time generates a coverage file (normalized or not).\n- The coverage file is converted to bigwig\n- A multiQC is run to have an overview of the QC\n", | |
| "changelog": "# Changelog\n\n## [0.13] 2024-09-23\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0`\n\n## [0.12] 2024-07-15\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy0`\n\n## [0.11] 2024-05-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0`\n\n## [0.10] 2024-04-22\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0`\n\n## [0.9] 2024-04-08\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1`\n\n## [0.8] 2024-03-25\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0`\n\n## [0.7] 2024-02-05\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy0`\n\n## [0.6.1] 2023-11-20\n\n- Fix author in dockstore\n\n## [0.6] 2023-10-19\n\nFix the remove duplicate step!\nIn all previous versions, due to an error, PCR duplicates were not removed.\n\n## [0.5] 2023-10-17\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0`\n\n## [0.4] 2023-03-17\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4`\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0`\n\n### Manual update\n- New parameter to get normalized profile\n\n## [0.3] 2022-12-17\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1`\n\n## [0.2] 2022-11-28\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.4.5+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0`\n\n## [0.1] 2022-10-06\nFirst release.\n", | |
| "diagrams": "# Workflow diagrams\n\n## CUTandRUN\n\n```mermaid\ngraph LR\n0[\"ℹ️ PE fastq input\"]@{ shape: docs }\n1[\"ℹ️ adapter_forward\"]@{ shape: lean-l }\n2[\"ℹ️ adapter_reverse\"]@{ shape: lean-l }\n3[\"ℹ️ reference_genome\"]@{ shape: lean-l }\n4[\"ℹ️ effective_genome_size\"]@{ shape: lean-l }\n5[\"ℹ️ normalize_profile\"]@{ shape: lean-l }\n6[\"Cutadapt (remove adapter + bad quality bases)\"]@{ shape: process }\n0 --> 6\n1 --> 6\n2 --> 6\n7[\"Bowtie2 map on reference\"]@{ shape: process }\n6 --> 7\n3 --> 7\n8[\"filter MAPQ30 concordant pairs\"]@{ shape: process }\n7 --> 8\n9[\"remove PCR duplicates\"]@{ shape: process }\n8 --> 9\n10[\"convert BAM to BED to improve peak calling\"]@{ shape: process }\n9 --> 10\n11[\"Call Peaks with MACS2\"]@{ shape: process }\n5 --> 11\n4 --> 11\n10 --> 11\n12[\"summary of MACS2\"]@{ shape: process }\n11 --> 12\n13[\"Bigwig from MACS2\"]@{ shape: process }\n11 --> 13\n14[\"MultiQC\"]@{ shape: process }\n6 --> 14\n7 --> 14\n9 --> 14\n11 --> 14\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/cutandrun/main", | |
| "dockstore_id": 19825, | |
| "categories": [], | |
| "collections": [ | |
| "Epigenetics" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test outline for CUT&RUN (hg38 bigwig conversion fails for memory issues)", | |
| "job": { | |
| "PE fastq input": { | |
| "class": "Collection", | |
| "collection_type": "list:paired", | |
| "elements": [ | |
| { | |
| "class": "Collection", | |
| "type": "paired", | |
| "identifier": "Rep1", | |
| "elements": [ | |
| { | |
| "identifier": "forward", | |
| "class": "File", | |
| "location": "https://zenodo.org/record/6823059/files/Rep1_R1.fastq", | |
| "filetype": "fastqsanger" | |
| }, | |
| { | |
| "identifier": "reverse", | |
| "class": "File", | |
| "location": "https://zenodo.org/record/6823059/files/Rep1_R2.fastq", | |
| "filetype": "fastqsanger" | |
| } | |
| ] | |
| } | |
| ] | |
| }, | |
| "adapter_forward": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", | |
| "adapter_reverse": "GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", | |
| "reference_genome": "hg38canon", | |
| "effective_genome_size": 2700000000, | |
| "normalize_profile": false | |
| }, | |
| "outputs": { | |
| "Mapping stats": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "289103 reads; of these:" | |
| }, | |
| "has_text_matching": { | |
| "expression": "99.39% overall alignment rate" | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "BAM filtered rmDup": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 8661584, | |
| "delta": 800000 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MarkDuplicates metrics": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "0.33" | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 summits": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 5870 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 narrowPeak": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 5870 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 peaks xls": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "# tag size is determined as 40 bps" | |
| }, | |
| "has_text_matching": { | |
| "expression": "# total tags in treatment: 238930" | |
| } | |
| } | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| { | |
| "doc": "Test outline for CUT&RUN (dm6)", | |
| "job": { | |
| "PE fastq input": { | |
| "class": "Collection", | |
| "collection_type": "list:paired", | |
| "elements": [ | |
| { | |
| "class": "Collection", | |
| "type": "paired", | |
| "identifier": "Rep1", | |
| "elements": [ | |
| { | |
| "identifier": "forward", | |
| "class": "File", | |
| "path": "test-data/SRR15904259_subset_forward.fastqsanger.gz", | |
| "filetype": "fastqsanger" | |
| }, | |
| { | |
| "identifier": "reverse", | |
| "class": "File", | |
| "path": "test-data/SRR15904259_subset_reverse.fastqsanger.gz", | |
| "filetype": "fastqsanger" | |
| } | |
| ] | |
| } | |
| ] | |
| }, | |
| "adapter_forward": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", | |
| "adapter_reverse": "GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", | |
| "reference_genome": "dm6", | |
| "effective_genome_size": 120000000, | |
| "normalize_profile": true | |
| }, | |
| "outputs": { | |
| "Mapping stats": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "343237 reads; of these:" | |
| }, | |
| "has_text_matching": { | |
| "expression": "98.17% overall alignment rate" | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "BAM filtered rmDup": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 18246620, | |
| "delta": 1000000 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MarkDuplicates metrics": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "0.001269" | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 summits": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 3231 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 narrowPeak": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 3231 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 peaks xls": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "# tag size is determined as 36 bps" | |
| }, | |
| "has_text_matching": { | |
| "expression": "# total tags in treatment: 489716" | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "Coverage from MACS2 (bigwig)": { | |
| "element_tests": { | |
| "Rep1": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 5087932, | |
| "delta": 400000 | |
| } | |
| } | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/epigenetics/cutandrun" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "main", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/atacseq.ga", | |
| "testParameterFiles": [ | |
| "/atacseq-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Lucille Delisle", | |
| "orcid": "0000-0002-1964-4960" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow takes as input a collection of paired fastq. It will remove bad quality and adapters with cutadapt. Map with Bowtie2 end-to-end. Will remove reads on MT and unconcordant pairs and pairs with mapping quality below 30 and PCR duplicates. Will compute the pile-up on 5' +- 100bp. Will call peaks and count the number of reads falling in the 1kb region centered on the summit. Will compute 2 normalization for coverage: normalized by million reads and normalized by million reads in peaks. Will plot the number of reads for each fragment length.", | |
| "comments": [], | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-1964-4960", | |
| "name": "Lucille Delisle" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "release": "1.0", | |
| "name": "ATACseq", | |
| "steps": { | |
| "0": { | |
| "annotation": "Should be a paired collection with ATAC-seq fastqs", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Should be a paired collection with ATAC-seq fastqs", | |
| "name": "PE fastq input" | |
| } | |
| ], | |
| "label": "PE fastq input", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 579.4833374023438 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": \"\", \"collection_type\": \"list:paired\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "3b1d869d-e8a9-49d9-894c-8aa500cd445d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "reference_genome", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "reference_genome", | |
| "name": "reference_genome" | |
| } | |
| ], | |
| "label": "reference_genome", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 30.550048828125, | |
| "top": 684.38330078125 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "c085055c-9d18-49d7-9f87-fae61683d775", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "Used by macs2:\\nH. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Used by macs2:\\nH. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "name": "effective_genome_size" | |
| } | |
| ], | |
| "label": "effective_genome_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 98, | |
| "top": 787.9833374023438 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "43f5c231-ed56-4cda-bd50-0495dfd77d70", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "Bin size for normalized bigwig (usually 50bp is sufficient)", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Bin size for normalized bigwig (usually 50bp is sufficient)", | |
| "name": "bin_size" | |
| } | |
| ], | |
| "label": "bin_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 155.54247082439377, | |
| "top": 898.8496207394044 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "942c77e6-f462-49ac-87ed-6e4e14589b0b", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1", | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": { | |
| "library|input_1": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Cutadapt", | |
| "name": "library" | |
| } | |
| ], | |
| "label": "Cutadapt (remove adapter + bad quality bases)", | |
| "name": "Cutadapt", | |
| "outputs": [ | |
| { | |
| "name": "out_pairs", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "report", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 278.16668701171875, | |
| "top": 492.36669921875 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_pairs": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_pairs" | |
| }, | |
| "HideDatasetActionreport": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "report" | |
| }, | |
| "RenameDatasetActionreport": { | |
| "action_arguments": { | |
| "newname": "cutadapt report" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "report" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "5eb7e84243f2", | |
| "name": "cutadapt", | |
| "owner": "lparsons", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"15\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R1\", \"adapter\": \"CTGTCTCTTATACACATCTCCGAGCCCACGAGAC\"}, \"single_noindels\": false}], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"Nextera R2\", \"adapter\": \"CTGTCTCTTATACACATCTGACGCTGCCGACGA\"}, \"single_noindels\": false}], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"30\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": \"\", \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "4.9+galaxy1", | |
| "type": "tool", | |
| "uuid": "33fa2759-9f3f-431b-b35c-b5c777d5d5b7", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "library|input_1": { | |
| "id": 4, | |
| "output_name": "out_pairs" | |
| }, | |
| "reference_genome|index": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Bowtie2", | |
| "name": "library" | |
| }, | |
| { | |
| "description": "runtime parameter for tool Bowtie2", | |
| "name": "reference_genome" | |
| } | |
| ], | |
| "label": "Bowtie2 map on reference", | |
| "name": "Bowtie2", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bam" | |
| }, | |
| { | |
| "name": "mapping_stats", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 555.13330078125, | |
| "top": 395.6499938964844 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionmapping_stats": { | |
| "action_arguments": { | |
| "newname": "mapping stats" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "mapping_stats" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "bowtie2 output (BAM)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "d5ceb9f3c25b", | |
| "name": "bowtie2", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"simple\", \"__current_case__\": 0, \"presets\": \"--very-sensitive\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"RuntimeValue\"}, \"unaligned_file\": false, \"aligned_file\": false, \"paired_options\": {\"paired_options_selector\": \"yes\", \"__current_case__\": 0, \"I\": \"0\", \"X\": \"1000\", \"fr_rf_ff\": \"--fr\", \"no_mixed\": false, \"no_discordant\": false, \"dovetail\": true, \"no_contain\": false, \"no_overlap\": false}}, \"reference_genome\": {\"source\": \"indexed\", \"__current_case__\": 0, \"index\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.5.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "c32a3847-f673-487f-af98-8d50999f2d21", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "mapping stats", | |
| "output_name": "mapping_stats", | |
| "uuid": "0a898754-6a14-4282-9269-02f5d516e49f" | |
| } | |
| ] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy2", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "input_bam": { | |
| "id": 5, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "filter MAPQ30 concordant pairs and not mitochondrial pairs", | |
| "name": "Filter BAM", | |
| "outputs": [ | |
| { | |
| "name": "out_file2", | |
| "type": "txt" | |
| }, | |
| { | |
| "name": "out_file1", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 826.183349609375, | |
| "top": 318.58331298828125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| }, | |
| "HideDatasetActionout_file2": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file2" | |
| }, | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "filtered BAM" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "993b19f20c76", | |
| "name": "bamtools_filter", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"conditions\": [{\"__index__\": 0, \"filters\": [{\"__index__\": 0, \"bam_property\": {\"bam_property_selector\": \"mapQuality\", \"__current_case__\": 14, \"bam_property_value\": \">=30\"}}, {\"__index__\": 1, \"bam_property\": {\"bam_property_selector\": \"isProperPair\", \"__current_case__\": 11, \"bam_property_value\": true}}, {\"__index__\": 2, \"bam_property\": {\"bam_property_selector\": \"reference\", \"__current_case__\": 20, \"bam_property_value\": \"!chrM\"}}, {\"__index__\": 3, \"bam_property\": {\"bam_property_selector\": \"mateReference\", \"__current_case__\": 16, \"bam_property_value\": \"!MT\"}}]}], \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"rule_configuration\": {\"rules_selector\": \"true\", \"__current_case__\": 1, \"rules\": null}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.5.2+galaxy2", | |
| "type": "tool", | |
| "uuid": "eba4c413-30c9-4bab-a088-dc12d5956c91", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_idxstats/samtools_idxstats/2.0.5", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "input": { | |
| "id": 5, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Get number of reads per chromosome", | |
| "name": "Samtools idxstats", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 945.2166748046875, | |
| "top": 539.63330078125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_idxstats/samtools_idxstats/2.0.5", | |
| "tool_shed_repository": { | |
| "changeset_revision": "fa5d3e61e429", | |
| "name": "samtools_idxstats", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.0.5", | |
| "type": "tool", | |
| "uuid": "024f7338-2712-4fb1-a913-dfd5bc2d4f1e", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "inputFile": { | |
| "id": 6, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "remove PCR duplicates", | |
| "name": "MarkDuplicates", | |
| "outputs": [ | |
| { | |
| "name": "metrics_file", | |
| "type": "txt" | |
| }, | |
| { | |
| "name": "outFile", | |
| "type": "bam" | |
| } | |
| ], | |
| "position": { | |
| "left": 1163.1000061035156, | |
| "top": 211.4666748046875 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionmetrics_file": { | |
| "action_arguments": { | |
| "newname": "MarkDuplicates metrics" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "metrics_file" | |
| }, | |
| "RenameDatasetActionoutFile": { | |
| "action_arguments": { | |
| "newname": "BAM filtered rmDup" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outFile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3f254c5ced1d", | |
| "name": "picard", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"assume_sorted\": true, \"barcode_tag\": \"\", \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": true, \"validation_stringency\": \"LENIENT\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.1.1.0", | |
| "type": "tool", | |
| "uuid": "d0a9998c-18a9-4579-8d33-f0897e1ceaeb", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MarkDuplicates metrics", | |
| "output_name": "metrics_file", | |
| "uuid": "144745aa-8898-45e6-a328-53e2518202b9" | |
| }, | |
| { | |
| "label": "BAM filtered rmDup", | |
| "output_name": "outFile", | |
| "uuid": "5f4d5cc5-c2f2-40f3-b941-df5dd7347d25" | |
| } | |
| ] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "infile": { | |
| "id": 7, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "reads in chrM/MT for multiQC", | |
| "name": "Text reformatting", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1190.1499938964844, | |
| "top": 618.5833129882812 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutfile": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"code\": \" ($1==\\\"chrM\\\" || $1 == \\\"MT\\\"){print $1, $3}($1!=\\\"chrM\\\" && $1!=\\\"MT\\\"){SUM+=$3}END{print \\\"others\\\", SUM} \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "9ae38aa6-511d-4ab4-b055-7a1dae65649f", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "input": { | |
| "id": 8, | |
| "output_name": "outFile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert BAM to BED to improve peak calling", | |
| "name": "bedtools BAM to BED", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 1458.7166595458984, | |
| "top": 193.58331298828125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "BED filtered rmDup" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "12ca18f2-222b-4e9c-8ae0-b5772cd51bd7", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pe_histogram/pe_histogram/1.0.1", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "input_bam": { | |
| "id": 8, | |
| "output_name": "outFile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Compute fragment length histogram", | |
| "name": "Paired-end histogram", | |
| "outputs": [ | |
| { | |
| "name": "output1", | |
| "type": "png" | |
| }, | |
| { | |
| "name": "output2", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 1478.1666717529297, | |
| "top": 559.88330078125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput2": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output2" | |
| }, | |
| "RenameDatasetActionoutput1": { | |
| "action_arguments": { | |
| "newname": "histogram of fragment length" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pe_histogram/pe_histogram/1.0.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "bd1416eea1f0", | |
| "name": "pe_histogram", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"lower_limit\": null, \"upper_limit\": \"500\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.1", | |
| "type": "tool", | |
| "uuid": "cc486ad2-0f48-4636-98b5-ea5fad9b75b3", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "histogram of fragment length", | |
| "output_name": "output1", | |
| "uuid": "06437eef-c6fa-49f1-81fb-c48a21b87f57" | |
| } | |
| ] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "input": { | |
| "id": 8, | |
| "output_name": "outFile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "number of reads", | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputcnt", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 1960.1157004761121, | |
| "top": 545.8157628477595 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutputcnt": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outputcnt" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "32dc5f781059", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"all_reads\", \"__current_case__\": 0, \"output_options\": {\"reads_report_type\": \"count\", \"__current_case__\": 1}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.20+galaxy3", | |
| "type": "tool", | |
| "uuid": "2999f836-c74f-47ed-b1ad-81f43349fe11", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "effective_genome_size_options|gsize": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "treatment|input_treatment_file": { | |
| "id": 10, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "effective_genome_size_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "treatment" | |
| } | |
| ], | |
| "label": "Call Peak with MACS2", | |
| "name": "MACS2 callpeak", | |
| "outputs": [ | |
| { | |
| "name": "output_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_narrowpeaks", | |
| "type": "bed" | |
| }, | |
| { | |
| "name": "output_summits", | |
| "type": "bed" | |
| }, | |
| { | |
| "name": "output_treat_pileup", | |
| "type": "bedgraph" | |
| }, | |
| { | |
| "name": "output_control_lambda", | |
| "type": "bedgraph" | |
| }, | |
| { | |
| "name": "output_extra_files", | |
| "type": "html" | |
| } | |
| ], | |
| "position": { | |
| "left": 1741.2333374023438, | |
| "top": 0 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_control_lambda": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_control_lambda" | |
| }, | |
| "HideDatasetActionoutput_extra_files": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_extra_files" | |
| }, | |
| "HideDatasetActionoutput_summits": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_summits" | |
| }, | |
| "HideDatasetActionoutput_tabular": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "HideDatasetActionoutput_treat_pileup": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| }, | |
| "RenameDatasetActionoutput_control_lambda": { | |
| "action_arguments": { | |
| "newname": "MACS2 control coverage" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_control_lambda" | |
| }, | |
| "RenameDatasetActionoutput_narrowpeaks": { | |
| "action_arguments": { | |
| "newname": "MACS2 narrowPeak" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "RenameDatasetActionoutput_summits": { | |
| "action_arguments": { | |
| "newname": "MACS2 summits" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_summits" | |
| }, | |
| "RenameDatasetActionoutput_tabular": { | |
| "action_arguments": { | |
| "newname": "MACS2 peaks xls" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_treat_pileup": { | |
| "action_arguments": { | |
| "newname": "MACS2 treatment coverage" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86e2413cf3f8", | |
| "name": "macs2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": false, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"peaks_tabular\", \"summits\", \"bdg\", \"html\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.9.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "57386f5d-96bb-4684-97dc-3b2228189c01", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MACS2 narrowPeak", | |
| "output_name": "output_narrowpeaks", | |
| "uuid": "02d92607-381e-41b0-b0ed-b0f89bc02967" | |
| } | |
| ] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "infile": { | |
| "id": 11, | |
| "output_name": "output2" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "remove comments lines", | |
| "name": "Search in textfiles", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1780, | |
| "top": 701.4833374023438 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"-v\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-P\", \"url_paste\": \"^#\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "c06960f8-9d4e-483e-8f07-12976f8b802a", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "15": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", | |
| "errors": null, | |
| "id": 15, | |
| "input_connections": { | |
| "input": { | |
| "id": 12, | |
| "output_name": "outputcnt" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "compute 1/million reads", | |
| "name": "Compute", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1681.741700059967, | |
| "top": 1407.1751610966817 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "aff5135563c6", | |
| "name": "column_maker", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"avoid_scientific_notation\": true, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"1000000/c1\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"1\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1", | |
| "type": "tool", | |
| "uuid": "ec62cddf-fb04-4185-b9f4-709de2ce0202", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "16": { | |
| "annotation": "", | |
| "content_id": "wig_to_bigWig", | |
| "errors": null, | |
| "id": 16, | |
| "input_connections": { | |
| "input1": { | |
| "id": 13, | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Bigwig from MACS2 (no norm)", | |
| "name": "Wig/BedGraph-to-bigWig", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 1444.2833251953125, | |
| "top": 1510.0499877929688 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionout_file1": { | |
| "action_arguments": { | |
| "newname": "Coverage from MACS2 (bigwig)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "wig_to_bigWig", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "4eea632c-ec31-43e7-88d2-79895b764a06", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "Coverage from MACS2 (bigwig)", | |
| "output_name": "out_file1", | |
| "uuid": "5ffc5c02-8669-49b2-82a1-682ec3122d39" | |
| } | |
| ] | |
| }, | |
| "17": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.31.1+galaxy0", | |
| "errors": null, | |
| "id": 17, | |
| "input_connections": { | |
| "genome_file_opts|genome": { | |
| "id": 1, | |
| "output_name": "output" | |
| }, | |
| "inputA": { | |
| "id": 13, | |
| "output_name": "output_summits" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bedtools SlopBed", | |
| "name": "genome_file_opts" | |
| } | |
| ], | |
| "label": "get summits +/-500kb", | |
| "name": "bedtools SlopBed", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 2186.5, | |
| "top": 206.29998779296875 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "1kb around each summit" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.31.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addition\": {\"addition_select\": \"b\", \"__current_case__\": 0, \"b\": \"500\"}, \"genome_file_opts\": {\"genome_file_opts_selector\": \"loc\", \"__current_case__\": 0, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"header\": false, \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"pct\": false, \"strand\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "d1c672ca-ee55-4e48-9d97-75552050534a", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "18": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 18, | |
| "input_connections": { | |
| "infile": { | |
| "id": 13, | |
| "output_name": "output_tabular" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "summary of MACS2", | |
| "name": "Search in textfiles", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2198.433349609375, | |
| "top": 79.64999389648438 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionoutput": { | |
| "action_arguments": { | |
| "newtype": "txt" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "MACS2 report" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-P\", \"url_paste\": \"^#\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "a12ee458-2fe0-4d1e-8df9-c8fc76d7b277", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MACS2 report", | |
| "output_name": "output", | |
| "uuid": "2c50d266-785f-4a9d-ba31-f9fe66b703c7" | |
| } | |
| ] | |
| }, | |
| "19": { | |
| "annotation": "", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 19, | |
| "input_connections": { | |
| "input1": { | |
| "id": 15, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Convert 1/million reads to parameter", | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "text_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 1927.9064759856594, | |
| "top": 1388.3825581400483 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActiontext_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "text_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "7afe5b18-2555-4f24-a1e2-348341631008", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "20": { | |
| "annotation": "", | |
| "content_id": "__APPLY_RULES__", | |
| "errors": null, | |
| "id": 20, | |
| "input_connections": { | |
| "input": { | |
| "id": 16, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Isolate each bigwig do normalize not average", | |
| "name": "Apply rules", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2134.4445922218906, | |
| "top": 1595.328936224611 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "__APPLY_RULES__", | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"rules\": {\"mapping\": [{\"collapsible_value\": {\"__class__\": \"RuntimeValue\"}, \"columns\": [0, 1], \"connectable\": true, \"editing\": false, \"is_workflow\": false, \"type\": \"list_identifiers\"}], \"rules\": [{\"collapsible_value\": {\"__class__\": \"RuntimeValue\"}, \"connectable\": true, \"error\": null, \"is_workflow\": false, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}, {\"collapsible_value\": {\"__class__\": \"RuntimeValue\"}, \"connectable\": true, \"error\": null, \"is_workflow\": false, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.0", | |
| "type": "tool", | |
| "uuid": "05ca058f-88e4-4e7c-9e93-66e25043883d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "21": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1", | |
| "errors": null, | |
| "id": 21, | |
| "input_connections": { | |
| "input": { | |
| "id": 17, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Merge summits +/-500kb", | |
| "name": "bedtools MergeBED", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 2501.5999755859375, | |
| "top": 273.75 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "Summits +-500bp (merged)" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"c_and_o_argument_repeat\": [], \"distance\": \"0\", \"header\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1", | |
| "type": "tool", | |
| "uuid": "a74b6905-51b8-4c39-bc8c-3267b1f0a7a5", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "1kb around summits", | |
| "output_name": "output", | |
| "uuid": "94021253-18e5-4969-9dec-ec901bcc9a3b" | |
| } | |
| ] | |
| }, | |
| "22": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "errors": null, | |
| "id": 22, | |
| "input_connections": { | |
| "advancedOpt|binSize": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "advancedOpt|scaleFactors": { | |
| "id": 19, | |
| "output_name": "text_param" | |
| }, | |
| "bigwigs": { | |
| "id": 20, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| } | |
| ], | |
| "label": "normalize by million reads", | |
| "name": "bigwigAverage", | |
| "outputs": [ | |
| { | |
| "name": "outFileName", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 2394.696221186954, | |
| "top": 1367.5056983565069 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutFileName": { | |
| "action_arguments": { | |
| "newname": "bigwig normalized per million reads" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outFileName" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4a53856a5b85", | |
| "name": "deeptools_bigwig_average", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"skipNAs\": false, \"scaleFactors\": {\"__class__\": \"ConnectedValue\"}, \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"bigwigs\": {\"__class__\": \"ConnectedValue\"}, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.5.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "fa2633cf-af38-43eb-8c9f-b8b656d6a631", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "bigwig_norm", | |
| "output_name": "outFileName", | |
| "uuid": "42fb26ba-7428-43cf-8668-e865b67c12bc" | |
| } | |
| ] | |
| }, | |
| "23": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.31.1+galaxy0", | |
| "errors": null, | |
| "id": 23, | |
| "input_connections": { | |
| "inputA": { | |
| "id": 21, | |
| "output_name": "output" | |
| }, | |
| "reduce_or_iterate|inputB": { | |
| "id": 8, | |
| "output_name": "outFile" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bedtools Compute both the depth and breadth of coverage", | |
| "name": "reduce_or_iterate" | |
| } | |
| ], | |
| "label": "Compute coverage on summits +/-500kb", | |
| "name": "bedtools Compute both the depth and breadth of coverage", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 2734.11669921875, | |
| "top": 534.88330078125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| }, | |
| "RenameDatasetActionoutput": { | |
| "action_arguments": { | |
| "newname": "coverage on MACS2 peaks" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.31.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"a_or_b\": false, \"d\": false, \"hist\": false, \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"mean\": false, \"overlap_a\": null, \"overlap_b\": null, \"reciprocal_overlap\": false, \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": false, \"split\": false, \"strandedness\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "f3681ac7-e1ba-4442-971f-8353389c5265", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "24": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 24, | |
| "input_connections": { | |
| "infile": { | |
| "id": 23, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "number of reads in peaks", | |
| "name": "Text reformatting", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3097.2166748046875, | |
| "top": 460.11669921875 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionoutfile": { | |
| "action_arguments": { | |
| "newtype": "tabular" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "outfile" | |
| }, | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "Nb of reads in summits +-500bp" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"code\": \"{S=S+$4}END{print S}\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "f65b3936-595c-4ddb-88bc-2cc41e514e38", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "Nb of reads in summits +-500bp", | |
| "output_name": "outfile", | |
| "uuid": "ba96198b-0b36-4b3c-a7bf-664d765eff3a" | |
| } | |
| ] | |
| }, | |
| "25": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", | |
| "errors": null, | |
| "id": 25, | |
| "input_connections": { | |
| "input": { | |
| "id": 24, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "compute 1/million reads in peaks", | |
| "name": "Compute", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1660.7476485833522, | |
| "top": 1675.7739064754614 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "aff5135563c6", | |
| "name": "column_maker", | |
| "owner": "devteam", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"avoid_scientific_notation\": true, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"1000000/c1\", \"add_column\": {\"mode\": \"R\", \"__current_case__\": 2, \"pos\": \"1\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.1", | |
| "type": "tool", | |
| "uuid": "5f55e258-a4fe-4b51-ab9b-2a6f0f22d910", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "26": { | |
| "annotation": "", | |
| "content_id": "cat1", | |
| "errors": null, | |
| "id": 26, | |
| "input_connections": { | |
| "input1": { | |
| "id": 24, | |
| "output_name": "outfile" | |
| }, | |
| "queries_0|input2": { | |
| "id": 12, | |
| "output_name": "outputcnt" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Combine number of reads in peaks with total number of reads", | |
| "name": "Concatenate datasets", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 3026.25, | |
| "top": 727.7666625976562 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "cat1", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"input2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "ae286273-3247-4a8f-b296-33a679fbaf7d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "27": { | |
| "annotation": "", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 27, | |
| "input_connections": { | |
| "input1": { | |
| "id": 25, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "Convert 1/million reads in peaks to parameter", | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "text_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 1922.9030306495047, | |
| "top": 1685.3491762772487 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActiontext_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "text_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "f0eb1323-041b-4e29-9f07-de15427c267d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "28": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", | |
| "errors": null, | |
| "id": 28, | |
| "input_connections": { | |
| "infile": { | |
| "id": 26, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "reads in peaks multiQC", | |
| "name": "Text reformatting", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2870.2166748046875, | |
| "top": 944.800048828125 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutfile": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"code\": \" NR==1{print \\\"in peaks\\\",$1;inp=$1}NR==2{print \\\"outside peaks\\\",$1 - inp}\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "7fe2bb35-31b5-4da0-83cf-38bb4af2848e", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "29": { | |
| "annotation": "Isolate each bigwig do normalize not average", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "errors": null, | |
| "id": 29, | |
| "input_connections": { | |
| "advancedOpt|binSize": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "advancedOpt|scaleFactors": { | |
| "id": 27, | |
| "output_name": "text_param" | |
| }, | |
| "bigwigs": { | |
| "id": 20, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| } | |
| ], | |
| "label": "normalize by million reads in peaks", | |
| "name": "bigwigAverage", | |
| "outputs": [ | |
| { | |
| "name": "outFileName", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 2402.456534423419, | |
| "top": 1734.6798994525739 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutFileName": { | |
| "action_arguments": { | |
| "newname": "bigwig normalized per million reads in peaks" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outFileName" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4a53856a5b85", | |
| "name": "deeptools_bigwig_average", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"skipNAs\": false, \"scaleFactors\": {\"__class__\": \"ConnectedValue\"}, \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"bigwigs\": {\"__class__\": \"ConnectedValue\"}, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.5.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "8eab7f49-605b-462a-9806-da0c795117f3", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "bigwig_norm2", | |
| "output_name": "outFileName", | |
| "uuid": "60031333-7419-4121-a0c7-e235b70a5cfc" | |
| } | |
| ] | |
| }, | |
| "30": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "errors": null, | |
| "id": 30, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 4, | |
| "output_name": "report" | |
| }, | |
| "results_1|software_cond|input": { | |
| "id": 5, | |
| "output_name": "mapping_stats" | |
| }, | |
| "results_2|software_cond|input": { | |
| "id": 9, | |
| "output_name": "outfile" | |
| }, | |
| "results_3|software_cond|output_0|input": { | |
| "id": 8, | |
| "output_name": "metrics_file" | |
| }, | |
| "results_4|software_cond|input": { | |
| "id": 14, | |
| "output_name": "output" | |
| }, | |
| "results_5|software_cond|input": { | |
| "id": 13, | |
| "output_name": "output_tabular" | |
| }, | |
| "results_6|software_cond|input": { | |
| "id": 28, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "plots", | |
| "type": "input" | |
| }, | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "stats", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2612.75, | |
| "top": 1012.6666259765625 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionplots": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "plots" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "f7e2f1eb3a16", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"bowtie2\", \"__current_case__\": 3, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"custom_content\", \"__current_case__\": 32, \"plot_type\": \"bargraph\", \"section_name\": \"chrM\", \"title\": \"reads mapping on chrM\", \"description\": \"\", \"xlab\": \"\", \"ylab\": \"\", \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 17, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"custom_content\", \"__current_case__\": 32, \"plot_type\": \"linegraph\", \"section_name\": \"Fragment size\", \"title\": \"Fragment size distribution\", \"description\": \"\", \"xlab\": \"\", \"ylab\": \"\", \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"custom_content\", \"__current_case__\": 32, \"plot_type\": \"bargraph\", \"section_name\": \"Reads in peaks\", \"title\": \"Number of reads in peaks\", \"description\": \"Number of reads falling 500bp from a summit\", \"xlab\": \"\", \"ylab\": \"\", \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.24.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "112d720f-c747-4c92-985f-ebdb52086cc9", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "MultiQC webpage", | |
| "output_name": "html_report", | |
| "uuid": "c22aafb2-d9f2-43c3-a6c4-cfe4a3166c07" | |
| }, | |
| { | |
| "label": "MultiQC on input dataset(s): Stats", | |
| "output_name": "stats", | |
| "uuid": "6071150d-48db-4cf8-bfed-2cbdb2635856" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "ATACseq" | |
| ], | |
| "uuid": "747f2432-7493-44b8-a5ee-82d104407cad", | |
| "version": 1 | |
| }, | |
| "updated": "2024-12-13T16:10:39.397310", | |
| "readme": "# ATACseq Workflow\n\nThis workflow is highly concordant with the corresponding training material.\nYou can have more information about ATAC-seq analysis in the [slides](https://training.galaxyproject.org/training-material/topics/epigenetics/tutorials/atac-seq/slides.html) and the [tutorial](https://training.galaxyproject.org/training-material/topics/epigenetics/tutorials/atac-seq/tutorial.html).\n\n## Inputs dataset\n\n- The workflow needs a single input which is a list of dataset pairs of fastqsanger.\n\n## Inputs values\n\n- reference_genome: this field will be adapted to the genomes available for bowtie2 and the genomes available for bedtools slopbed (dbkeys table)\n- effective_genome_size: this is used by macs2 and may be entered manually (indications are provided for heavily used genomes)\n- bin_size: this is used when normalization of coverage is performed. Large values will allow to have smaller output files but with less resolution while small values will increase computation time and size of output files to produce more resolutive bigwigs.\n\n## Processing\n\n- The workflow will remove nextera adapters and low quality bases and filter out any read smaller than 15bp.\n- The filtered reads are mapped with bowtie2 allowing dovetail and fragment length up to 1kb.\n- The BAM is filtered to keep only MAPQ30, concordant pairs and pairs outside of the mitochondria.\n- The PCR duplicates are removed with Picard (only from version 0.8).\n- The BAM is converted to BED to enable macs2 to take both pairs into account.\n- The peaks are called with macs2 which at the same time generates a coverage file.\n- The coverage file is converted to bigwig\n- The amount of reads 500bp from summits and the total number of reads are computed.\n- Two normalizations are computed:\n - By million reads\n - By million reads in peaks (500bp from summits)\n- Other QC are performed:\n - A histogram with fragment length is computed.\n - The evaluation of percentage of reads to chrM or MT is computed.\n- A multiQC is run to have an overview of the QC.\n\n### Warning\n\n- The `reference_genome` parameter value is used to select references in bowtie2 and bedtools slopbed. Only references that are present in bowtie2 **and** bedtools slopbed are selectable. If your favorite reference genome is not available ask your administrator to make sure that each bowtie2 reference has a corresponding len file for use in bedtools slopbed.\n", | |
| "changelog": "# Changelog\n\n## [1.0] 2024-11-28\n\n### Manual update\n\nUse the options like written in the README: in all previous versions, bowtie2 was running with `--very-sensitive` option but without allowing dovetail and without fragment length up to 1kb. Bowtie2 has been adjusted and is now running with these options: allow dovetail and fragment length up to 1kb.\n\n## [0.17] 2024-09-23\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3`\n- `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0`\n\n### Manual update\n- Add a step to remove comments lines from histogram to be compatible with new multiQC version\n\n## [0.16] 2024-07-15\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy0`\n\n## [0.15] 2024-05-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_slopbed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.31.1+galaxy0`\n\n## [0.14] 2024-04-22\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0`\n\n## [0.13] 2024-04-08\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1`\n\n## [0.12] 2024-03-25\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0`\n\n## [0.11] 2024-03-18\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy2`\n\n## [0.10] 2024-03-14\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.3+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/devteam/samtools_idxstats/samtools_idxstats/2.0.4` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/samtools_idxstats/samtools_idxstats/2.0.5`\n- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy0`\n\n## [0.9] 2023-10-23\n\nFix the normalization factor. It was coverage per reads and per reads in peaks instead of per million reads and per million reads in peaks.\n\n## [0.8] 2023-10-19\n\nFix the remove duplicate step!\nIn all previous versions, due to an error, PCR duplicates were not removed.\n\n## [0.7] 2023-10-17\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0`\n\n## [0.6] 2023-09-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0`\n\n## [0.5.1] 2023-09-22\n\nFix bug in normalize profiles when used with multiple samples (in 0.5.0 it is averaging samples instead of normalizing each sample).\n\n## [0.5] 2023-03-17\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_coveragebed/2.30.0+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0`\n\n### Manual update\n- add normalization steps for coverage\n\n## [0.4] 2023-01-16\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy1`\n\n## [0.3] 2022-12-17\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1`\n\n## [0.2] 2022-11-28\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.4.5+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0`\n\n## [0.1] 2022-10-12\nFirst release.\n", | |
| "diagrams": "# Workflow diagrams\n\n## ATACseq\n\n```mermaid\ngraph LR\n0[\"ℹ️ PE fastq input\"]@{ shape: docs }\n1[\"ℹ️ reference_genome\"]@{ shape: lean-l }\n2[\"ℹ️ effective_genome_size\"]@{ shape: lean-l }\n3[\"ℹ️ bin_size\"]@{ shape: lean-l }\n4[\"Cutadapt (remove adapter + bad quality bases)\"]@{ shape: process }\n0 --> 4\n5[\"Bowtie2 map on reference\"]@{ shape: process }\n4 --> 5\n1 --> 5\n6[\"filter MAPQ30 concordant pairs and not mitochondrial pairs\"]@{ shape: process }\n5 --> 6\n7[\"Get number of reads per chromosome\"]@{ shape: process }\n5 --> 7\n8[\"remove PCR duplicates\"]@{ shape: process }\n6 --> 8\n9[\"reads in chrM/MT for multiQC\"]@{ shape: process }\n7 --> 9\n10[\"convert BAM to BED to improve peak calling\"]@{ shape: process }\n8 --> 10\n11[\"Compute fragment length histogram\"]@{ shape: process }\n8 --> 11\n12[\"number of reads\"]@{ shape: process }\n8 --> 12\n13[\"Call Peak with MACS2\"]@{ shape: process }\n2 --> 13\n10 --> 13\n14[\"remove comments lines\"]@{ shape: process }\n11 --> 14\n15[\"compute 1/million reads\"]@{ shape: process }\n12 --> 15\n16[\"Bigwig from MACS2 (no norm)\"]@{ shape: process }\n13 --> 16\n17[\"get summits +/-500kb\"]@{ shape: process }\n1 --> 17\n13 --> 17\n18[\"summary of MACS2\"]@{ shape: process }\n13 --> 18\n19[\"Convert 1/million reads to parameter\"]@{ shape: process }\n15 --> 19\n20[\"Isolate each bigwig do normalize not average\"]@{ shape: process }\n16 --> 20\n21[\"Merge summits +/-500kb\"]@{ shape: process }\n17 --> 21\n22[\"normalize by million reads\"]@{ shape: process }\n3 --> 22\n19 --> 22\n20 --> 22\n23[\"Compute coverage on summits +/-500kb\"]@{ shape: process }\n21 --> 23\n8 --> 23\n24[\"number of reads in peaks\"]@{ shape: process }\n23 --> 24\n25[\"compute 1/million reads in peaks\"]@{ shape: process }\n24 --> 25\n26[\"Combine number of reads in peaks with total number of reads\"]@{ shape: process }\n24 --> 26\n12 --> 26\n27[\"Convert 1/million reads in peaks to parameter\"]@{ shape: process }\n25 --> 27\n28[\"reads in peaks multiQC\"]@{ shape: process }\n26 --> 28\n29[\"normalize by million reads in peaks\"]@{ shape: process }\n3 --> 29\n27 --> 29\n20 --> 29\n30[\"MultiQC\"]@{ shape: process }\n4 --> 30\n5 --> 30\n9 --> 30\n8 --> 30\n14 --> 30\n13 --> 30\n28 --> 30\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/atacseq/main", | |
| "dockstore_id": 19836, | |
| "categories": [], | |
| "collections": [ | |
| "Epigenetics" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test outline for ATACseq", | |
| "job": { | |
| "PE fastq input": { | |
| "class": "Collection", | |
| "collection_type": "list:paired", | |
| "elements": [ | |
| { | |
| "class": "Collection", | |
| "type": "paired", | |
| "identifier": "SRR891268_chr22_enriched", | |
| "elements": [ | |
| { | |
| "identifier": "forward", | |
| "class": "File", | |
| "location": "https://zenodo.org/record/3862793/files/SRR891268_chr22_enriched_R1.fastq.gz", | |
| "filetype": "fastqsanger" | |
| }, | |
| { | |
| "identifier": "reverse", | |
| "class": "File", | |
| "location": "https://zenodo.org/record/3862793/files/SRR891268_chr22_enriched_R2.fastq.gz", | |
| "filetype": "fastqsanger" | |
| } | |
| ] | |
| } | |
| ] | |
| }, | |
| "reference_genome": "hg19", | |
| "effective_genome_size": 2700000000, | |
| "bin_size": 1000 | |
| }, | |
| "outputs": { | |
| "mapping stats": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": [ | |
| { | |
| "that": "has_text", | |
| "text": "7282 (2.59%) aligned concordantly 0 times" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "121059 (43.09%) aligned concordantly exactly 1 time" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "152623 (54.32%) aligned concordantly >1 times" | |
| } | |
| ] | |
| } | |
| } | |
| }, | |
| "MarkDuplicates metrics": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "0.02" | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "BAM filtered rmDup": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 15810403, | |
| "delta": 1000000 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "histogram of fragment length": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 47718, | |
| "delta": 4000 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 narrowPeak": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 236 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MACS2 report": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": [ | |
| { | |
| "that": "has_text", | |
| "text": "# tag size is determined as 47 bps" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "# total tags in treatment: 262080" | |
| } | |
| ] | |
| } | |
| } | |
| }, | |
| "Coverage from MACS2 (bigwig)": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 2892925, | |
| "delta": 200000 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "1kb around summits": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 217 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "Nb of reads in summits +-500bp": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": { | |
| "has_line": { | |
| "line": "9548" | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "bigwig_norm": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 1253177, | |
| "delta": 100000 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "bigwig_norm2": { | |
| "element_tests": { | |
| "SRR891268_chr22_enriched": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 1248419, | |
| "delta": 100000 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "MultiQC on input dataset(s): Stats": { | |
| "asserts": { | |
| "has_line": { | |
| "line": "Sample\tMACS2_mqc_generalstats_macs2_d\tMACS2_mqc_generalstats_macs2_peak_count\tPicard: Mark Duplicates_mqc_generalstats_picard_mark_duplicates_PERCENT_DUPLICATION\tBowtie 2 / HiSAT2_mqc_generalstats_bowtie_2_hisat2_overall_alignment_rate\tCutadapt_mqc_generalstats_cutadapt_percent_trimmed" | |
| }, | |
| "has_text_matching": { | |
| "expression": "SRR891268_chr22_enriched\t200.0\t236\t2.7[0-9]*\t98.[0-9]*\t4.7[0-9]*" | |
| } | |
| } | |
| }, | |
| "MultiQC webpage": { | |
| "asserts": [ | |
| { | |
| "that": "has_text", | |
| "text": "<a href=\"#cutadapt_filtered_reads\" class=\"nav-l2\">Filtered Reads</a>" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "<td>% Aligned</td>" | |
| }, | |
| { | |
| "that": "has_text", | |
| "text": "<td>% BP Trimmed</td>" | |
| } | |
| ] | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/epigenetics/atacseq" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "main", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/average-bigwig-between-replicates.ga", | |
| "testParameterFiles": [ | |
| "/average-bigwig-between-replicates-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Lucille Delisle", | |
| "orcid": "0000-0002-1964-4960" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "We assume the identifiers of the input list are like:\nsample_name_replicateID.\nThe identifiers of the output list will be:\nsample_name", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-1964-4960", | |
| "name": "Lucille Delisle" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "release": "0.2", | |
| "name": "Average Bigwig between replicates", | |
| "steps": { | |
| "0": { | |
| "annotation": "We assume the identifiers are like:\nsample_name_replicateID", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "We assume the identifiers are like:\nsample_name_replicateID", | |
| "name": "Bigwig to average" | |
| } | |
| ], | |
| "label": "Bigwig to average", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 0.0 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": \"\", \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "45d1d287-ea71-4817-afd2-8ad89aedac46", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Bin size for normalized bigwig (usually 5bp is sufficient for RNA-seq and 50bp for ChIP/CUTandRUN/ATAC)", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Bin size for normalized bigwig (usually 5bp is sufficient for RNA-seq and 50bp for ChIP/CUTandRUN/ATAC)", | |
| "name": "bin_size" | |
| } | |
| ], | |
| "label": "bin_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 16, | |
| "top": 125.0 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "ae41572a-bafb-40d4-8042-87f07552980f", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "", | |
| "content_id": "__APPLY_RULES__", | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Apply rules", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 254, | |
| "top": 11.5 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "__APPLY_RULES__", | |
| "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"rules\": {\"mapping\": [{\"collapsible_value\": {\"__class__\": \"RuntimeValue\"}, \"columns\": [1, 2], \"connectable\": true, \"editing\": false, \"is_workflow\": false, \"type\": \"list_identifiers\"}], \"rules\": [{\"collapsible_value\": {\"__class__\": \"RuntimeValue\"}, \"connectable\": true, \"error\": null, \"is_workflow\": false, \"type\": \"add_column_metadata\", \"value\": \"identifier0\", \"warn\": null}, {\"collapsible_value\": {\"__class__\": \"RuntimeValue\"}, \"connectable\": true, \"error\": null, \"expression\": \"^(.*)_([^_]*)$\", \"is_workflow\": false, \"replacement\": \"\\\\1\", \"target_column\": 0, \"type\": \"add_column_regex\", \"warn\": null}, {\"collapsible_value\": {\"__class__\": \"RuntimeValue\"}, \"connectable\": true, \"error\": null, \"expression\": \"^(.*)_([^_]*)$\", \"is_workflow\": false, \"replacement\": \"\\\\2\", \"target_column\": 0, \"type\": \"add_column_regex\", \"warn\": null}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.0", | |
| "type": "tool", | |
| "uuid": "5532681e-f2b3-415c-87e2-71d5eb982d62", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": { | |
| "advancedOpt|binSize": { | |
| "id": 1, | |
| "output_name": "output" | |
| }, | |
| "bigwigs": { | |
| "id": 2, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| } | |
| ], | |
| "label": "average bigwigs from different replicates", | |
| "name": "bigwigAverage", | |
| "outputs": [ | |
| { | |
| "name": "outFileName", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 474, | |
| "top": 11.5 | |
| }, | |
| "post_job_actions": {}, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4a53856a5b85", | |
| "name": "deeptools_bigwig_average", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"skipNAs\": false, \"scaleFactors\": \"1\", \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"bigwigs\": {\"__class__\": \"ConnectedValue\"}, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.5.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "f63daf4e-ce9f-4301-be74-e4c263b6e88b", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "average_bigwigs", | |
| "output_name": "outFileName", | |
| "uuid": "19023604-eee1-4099-b1c2-abe3de93b3f3" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [], | |
| "uuid": "c6ed4b0e-d719-4997-9860-ba99488ec332", | |
| "version": 6 | |
| }, | |
| "updated": "2024-10-29T17:39:51.172333", | |
| "readme": "# Average Bigwig between replicates\n\nThis workflow is very useful when you processed multiple samples in collections and you want to generate an average coverage per condition.\n\n## Inputs dataset\n\n- The workflow needs a single input which is a list of bigwigs (normalized). The identifiers of your bigwigs must be like:\n - whatever_sample1_identificationOfReplicate1\n - whatever_sample1_identificationOfReplicate2\n - ...\n - whatever_sample2_identificationOfReplicate1\n - whatever_sample2_identificationOfReplicate2\n - ...\n\n## Inputs values\n\n- bin_size: this is used when average of coverage is performed. Large values will allow to have smaller output files but with less resolution while small values will increase computation time and size of output files to produce more resolutive bigwigs. I suggest 5bp for RNA-seq and 50bp for other applications.\n\n## Processing\n\n- The workflow will split identifiers between everything which is before the last underscore which will be the *sample* and everything which is after the last underscore which will be the *replicate identifier*. And restructure the collection as list:list:\n - whatever_sample1:\n - identificationOfReplicate1\n - identificationOfReplicate2\n - ...\n - whatever_sample2:\n - identificationOfReplicate1\n - identificationOfReplicate2\n - ---\n - ...\n- Then it will average bigwigs into each inner list\n\n## Outputs\n\n- The output is a collection of bigwig datasets like:\n - whatever_sample1\n - whatever_sample2\n - ...\n", | |
| "changelog": "# Changelog\n\n## [0.2] 2023-09-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0`\n\n## [0.1] 2023-09-22\nFirst release.\n", | |
| "diagrams": "# Workflow diagrams\n\n## Average Bigwig between replicates\n\n```mermaid\ngraph LR\n0[\"ℹ️ Bigwig to average\"]@{ shape: docs }\n1[\"ℹ️ bin_size\"]@{ shape: lean-l }\n2[\"Apply rules\"]@{ shape: process }\n0 --> 2\n3[\"average bigwigs from different replicates\"]@{ shape: process }\n1 --> 3\n2 --> 3\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/average-bigwig-between-replicates/main", | |
| "dockstore_id": 23760, | |
| "categories": [], | |
| "collections": [ | |
| "Epigenetics", | |
| "Transcriptomics" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test outline for average-bigwig-between-replicates.ga", | |
| "job": { | |
| "Bigwig to average": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "identifier": "ATAC_HH19_PT_rep1", | |
| "class": "File", | |
| "location": "https://www.ncbi.nlm.nih.gov/geo/download/?acc=GSM6152756&format=file&file=GSM6152756%5FATAC%5FHH19%5FPT%5Frep1%2Ebigwig", | |
| "filetype": "bigwig" | |
| }, | |
| { | |
| "identifier": "ATAC_HH19_PT_rep2", | |
| "class": "File", | |
| "location": "https://www.ncbi.nlm.nih.gov/geo/download/?acc=GSM6152757&format=file&file=GSM6152757%5FATAC%5FHH19%5FPT%5Frep2%2Ebigwig", | |
| "filetype": "bigwig" | |
| }, | |
| { | |
| "identifier": "ATAC_HH35_DS_rep1", | |
| "class": "File", | |
| "location": "https://www.ncbi.nlm.nih.gov/geo/download/?acc=GSM6152758&format=file&file=GSM6152758%5FATAC%5FHH35%5FDS%5Frep1%2Ebigwig", | |
| "filetype": "bigwig" | |
| }, | |
| { | |
| "identifier": "ATAC_HH35_DS_rep2", | |
| "class": "File", | |
| "location": "https://www.ncbi.nlm.nih.gov/geo/download/?acc=GSM6152759&format=file&file=GSM6152759%5FATAC%5FHH35%5FDS%5Frep2%2Ebigwig", | |
| "filetype": "bigwig" | |
| } | |
| ] | |
| }, | |
| "bin_size": 50 | |
| }, | |
| "outputs": { | |
| "average_bigwigs": { | |
| "attributes": { | |
| "collection_type": "list" | |
| }, | |
| "element_tests": { | |
| "ATAC_HH19_PT": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 140203524, | |
| "delta": 10000000 | |
| } | |
| } | |
| }, | |
| "ATAC_HH35_DS": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 124599299, | |
| "delta": 10000000 | |
| } | |
| } | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/epigenetics/average-bigwig-between-replicates" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "consensus-peaks-chip-sr", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/consensus-peaks-chip-sr.ga", | |
| "testParameterFiles": [ | |
| "/consensus-peaks-chip-sr-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Lucille Delisle", | |
| "orcid": "0000-0002-1964-4960" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow takes as input SR BAM from ChIP-seq. It calls peaks on each replicate and intersect them. In parallel, each BAM is subsetted to smallest number of reads. Peaks are called using all subsets combined. Only peaks called using a combination of all subsets which have summits intersecting the intersection of at least x replicates will be kept.", | |
| "comments": [ | |
| { | |
| "child_steps": [ | |
| 5, | |
| 8, | |
| 12 | |
| ], | |
| "color": "blue", | |
| "data": { | |
| "title": "Get a BED with intersection of at least x rep" | |
| }, | |
| "id": 0, | |
| "position": [ | |
| 767.4, | |
| 0.0 | |
| ], | |
| "size": [ | |
| 525.4, | |
| 382.7 | |
| ], | |
| "type": "frame" | |
| }, | |
| { | |
| "child_steps": [ | |
| 4, | |
| 7, | |
| 11, | |
| 10, | |
| 15, | |
| 14, | |
| 16, | |
| 17, | |
| 18, | |
| 19 | |
| ], | |
| "color": "none", | |
| "data": { | |
| "title": "Downsample input BAM to get the same number of reads" | |
| }, | |
| "id": 2, | |
| "position": [ | |
| 310.4, | |
| 898.0 | |
| ], | |
| "size": [ | |
| 2000, | |
| 403 | |
| ], | |
| "type": "frame" | |
| }, | |
| { | |
| "child_steps": [ | |
| 9, | |
| 13 | |
| ], | |
| "color": "green", | |
| "data": { | |
| "title": "Get the average coverage" | |
| }, | |
| "id": 1, | |
| "position": [ | |
| 721.4, | |
| 539.8 | |
| ], | |
| "size": [ | |
| 548.7, | |
| 332 | |
| ], | |
| "type": "frame" | |
| } | |
| ], | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-1964-4960", | |
| "name": "Lucille Delisle" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "release": "1.2", | |
| "name": "Get Confident Peaks From ChIP_SR replicates", | |
| "steps": { | |
| "0": { | |
| "annotation": "A collection with n replicates. BAM should not have duplicates", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "A collection with n replicates. BAM should not have duplicates", | |
| "name": "n rmDup BAMSR" | |
| } | |
| ], | |
| "label": "n rmDup BAMSR", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 168.94998779296876 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"bam\"], \"tag\": \"\", \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "fc7f3d9f-c1a6-4e00-a65a-ff31ab9e6bca", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Minimum number of replicates into which the summit should be present.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Minimum number of replicates into which the summit should be present.", | |
| "name": "Minimum number of overlap" | |
| } | |
| ], | |
| "label": "Minimum number of overlap", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 25, | |
| "top": 247.4 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "025fcb5d-6842-4ed0-9bac-b393942b9d29", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "name": "effective_genome_size" | |
| } | |
| ], | |
| "label": "effective_genome_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 39, | |
| "top": 341.94791480468575 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "dac93661-a2aa-4163-a3ec-f64c4075c881", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "Bin size for average of normalized coverage", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Bin size for average of normalized coverage", | |
| "name": "bin_size" | |
| } | |
| ], | |
| "label": "bin_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 57, | |
| "top": 438.98123999999825 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "ef17ea2d-7f73-44a8-aecf-15279c559fd1", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "count number of reads", | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputcnt", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 330.46457068361184, | |
| "top": 1016.5181008539595 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutputcnt": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outputcnt" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "32dc5f781059", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"all_reads\", \"__current_case__\": 0, \"output_options\": {\"reads_report_type\": \"count\", \"__current_case__\": 1}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.20+galaxy3", | |
| "type": "tool", | |
| "uuid": "a864ff43-af08-436a-aa78-54491ff0cce6", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "generate filter rule", | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 795.7157982750858, | |
| "top": 206.5517325344974 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c4 >= \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "e6855df9-0e94-4310-835c-15514bd37974", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "effective_genome_size_options|gsize": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "treatment|input_treatment_file": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "effective_genome_size_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "treatment" | |
| } | |
| ], | |
| "label": "call peaks individually", | |
| "name": "MACS2 callpeak", | |
| "outputs": [ | |
| { | |
| "name": "output_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_narrowpeaks", | |
| "type": "bed" | |
| }, | |
| { | |
| "name": "output_treat_pileup", | |
| "type": "bedgraph" | |
| }, | |
| { | |
| "name": "output_control_lambda", | |
| "type": "bedgraph" | |
| } | |
| ], | |
| "position": { | |
| "left": 454.449951171875, | |
| "top": 153.21457740234203 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_control_lambda": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_control_lambda" | |
| }, | |
| "HideDatasetActionoutput_tabular": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "HideDatasetActionoutput_treat_pileup": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| }, | |
| "RenameDatasetActionoutput_narrowpeaks": { | |
| "action_arguments": { | |
| "newname": "individual macs2 narrowPeaks" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "RenameDatasetActionoutput_tabular": { | |
| "action_arguments": { | |
| "newname": "individual macs2 tabular" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_treat_pileup": { | |
| "action_arguments": { | |
| "newname": "individual macs2 coverage normalized" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86e2413cf3f8", | |
| "name": "macs2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": true, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAM\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"0\"}, \"outputs\": [\"bdg\", \"peaks_tabular\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.9.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "8f2a3aa4-704e-4d90-a672-94b97996dd56", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "individual_macs2_narrowPeaks", | |
| "output_name": "output_narrowpeaks", | |
| "uuid": "4552df5d-4397-4118-af11-f97eb8c748a5" | |
| } | |
| ] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "input_list": { | |
| "id": 4, | |
| "output_name": "outputcnt" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "put all nb of reads into single dataset", | |
| "name": "Collapse Collection", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 585.9498956836106, | |
| "top": 1016.0836991103162 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "90981f86000f", | |
| "name": "collapse_collections", | |
| "owner": "nml", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filename\": {\"add_name\": false, \"__current_case__\": 1}, \"input_list\": {\"__class__\": \"ConnectedValue\"}, \"one_header\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "5.1.0", | |
| "type": "tool", | |
| "uuid": "bd8b6b03-19ef-4921-96c3-abe5e6992941", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "tag|inputs": { | |
| "id": 6, | |
| "output_name": "output_narrowpeaks" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bedtools Multiple Intersect", | |
| "name": "tag" | |
| } | |
| ], | |
| "label": "compute multi intersect", | |
| "name": "bedtools Multiple Intersect", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 790, | |
| "top": 49.4 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"cluster\": false, \"empty\": {\"empty_selector\": \"\", \"__current_case__\": 1}, \"filler\": \"0\", \"header\": false, \"tag\": {\"tag_select\": \"tag\", \"__current_case__\": 0, \"inputs\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1", | |
| "type": "tool", | |
| "uuid": "9edd1aab-eb4c-4fd4-b9f6-a6dbcae46dd2", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "wig_to_bigWig", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "input1": { | |
| "id": 6, | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "individual normalized bigwig", | |
| "name": "Wig/BedGraph-to-bigWig", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 777.2817744590351, | |
| "top": 635.7085502853505 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "wig_to_bigWig", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "d0d6f92d-3d7e-44c3-b2f6-c10e429d2369", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/table_compute/table_compute/1.2.4+galaxy0", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "singtabop|input": { | |
| "id": 7, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Table Compute", | |
| "name": "singtabop" | |
| } | |
| ], | |
| "label": "get min value", | |
| "name": "Table Compute", | |
| "outputs": [ | |
| { | |
| "name": "table", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 839.4690473102415, | |
| "top": 1013.9803858976712 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActiontable": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "table" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/table_compute/table_compute/1.2.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3bf5661c0280", | |
| "name": "table_compute", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"out_opts\": null, \"precision\": \"6\", \"singtabop\": {\"use_type\": \"single\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}, \"col_row_names\": null, \"adv\": {\"header\": null, \"nrows\": null, \"skipfooter\": null, \"skip_blank_lines\": true}, \"user\": {\"mode\": \"matrixapply\", \"__current_case__\": 3, \"matrixapply_func\": {\"vector_op\": \"min\", \"__current_case__\": 1}, \"dimension\": \"0\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.2.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "0d63ffd8-0646-4dbf-9ede-14bffcd5de2d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "wc_gnu", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "input1": { | |
| "id": 7, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "get nb of replicates", | |
| "name": "Line/Word/Character count", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 852.2032935094636, | |
| "top": 1131.5836587544356 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "wc_gnu", | |
| "tool_state": "{\"include_header\": false, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "1e4420d0-edfb-4411-b7e0-602b510ff898", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "Filter1", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "cond": { | |
| "id": 5, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 8, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "filter multi intersect", | |
| "name": "Filter", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1058, | |
| "top": 57.4 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Filter1", | |
| "tool_state": "{\"cond\": {\"__class__\": \"ConnectedValue\"}, \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "4acd5289-87cc-4cfb-9863-35248989ab27", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "advancedOpt|binSize": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "bigwigs": { | |
| "id": 9, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| } | |
| ], | |
| "label": "average coverage from replicates", | |
| "name": "bigwigAverage", | |
| "outputs": [ | |
| { | |
| "name": "outFileName", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 1035.1219194343084, | |
| "top": 575.1464921044934 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutFileName": { | |
| "action_arguments": { | |
| "newname": "Average Normalized Coverage of all replicates" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outFileName" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4a53856a5b85", | |
| "name": "deeptools_bigwig_average", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"skipNAs\": false, \"scaleFactors\": \"1\", \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"bigwigs\": {\"__class__\": \"ConnectedValue\"}, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.5.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "36059130-5f2a-4fe0-8b36-58073595fdd5", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "average_bigwig", | |
| "output_name": "outFileName", | |
| "uuid": "35dfdb8a-121d-41d1-9ad1-1e0d95a8ab8c" | |
| } | |
| ] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "input1": { | |
| "id": 10, | |
| "output_name": "table" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert min value to text", | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "text_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 1084.3691526034222, | |
| "top": 938.054981863764 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| }, | |
| "HideDatasetActiontext_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "text_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "cdbee56b-9fff-4205-9cb6-741be770985d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "15": { | |
| "annotation": "get nb of rep as param", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 15, | |
| "input_connections": { | |
| "input1": { | |
| "id": 11, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "integer_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 1092.4166992159298, | |
| "top": 1123.4218289425305 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "2ea49dca-270b-454a-9d86-6947799ab996", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "16": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/9.3+galaxy1", | |
| "errors": null, | |
| "id": 16, | |
| "input_connections": { | |
| "token_set_0|line": { | |
| "id": 14, | |
| "output_name": "text_param" | |
| }, | |
| "token_set_0|repeat_select|times": { | |
| "id": 15, | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "create a dataset with the min value as many times as there are replicates", | |
| "name": "Create text file", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 1355.26353673623, | |
| "top": 996.1249965061141 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutfile": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"token_set\": [{\"__index__\": 0, \"line\": {\"__class__\": \"ConnectedValue\"}, \"repeat_select\": {\"repeat_select_opts\": \"user\", \"__current_case__\": 0, \"times\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "29ef7038-e10a-47cd-835f-945dccaf9c1c", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "17": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", | |
| "errors": null, | |
| "id": 17, | |
| "input_connections": { | |
| "split_parms|input": { | |
| "id": 16, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Split file", | |
| "name": "split_parms" | |
| } | |
| ], | |
| "label": "split min value", | |
| "name": "Split file", | |
| "outputs": [ | |
| { | |
| "name": "list_output_txt", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1583.8149291973814, | |
| "top": 1143.0376400865628 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionlist_output_txt": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "list_output_txt" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2dae863c8f42", | |
| "name": "split_file_to_collection", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"split_parms\": {\"select_ftype\": \"txt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}, \"select_mode\": {\"mode\": \"chunk\", \"__current_case__\": 0, \"chunksize\": \"1\"}, \"newfilenames\": \"split_file\", \"select_allocate\": {\"allocate\": \"byrow\", \"__current_case__\": 2}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.5.2", | |
| "type": "tool", | |
| "uuid": "7db836a5-793a-403e-8db1-b97f619f4c69", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "18": { | |
| "annotation": "", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 18, | |
| "input_connections": { | |
| "input1": { | |
| "id": 17, | |
| "output_name": "list_output_txt" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert min nb of reads to parameter", | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "integer_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 1830.6125542203363, | |
| "top": 1109.3615627344768 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "71b1c454-41db-4a8b-8595-8d3fa86a86a0", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "19": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "errors": null, | |
| "id": 19, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| }, | |
| "mode|subsample_config|subsampling_mode|target": { | |
| "id": 18, | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "downsample BAM", | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputsam", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2090.7845788070495, | |
| "top": 1085.996383548678 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutputsam": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "32dc5f781059", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"cond_expr\": {\"select_expr\": \"no\", \"__current_case__\": 0}, \"quality\": null, \"library\": null, \"cigarcons\": null, \"inclusive_filter\": null, \"exclusive_filter\": null, \"exclusive_filter_all\": null, \"tag\": null, \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"target\", \"__current_case__\": 1, \"target\": {\"__class__\": \"ConnectedValue\"}, \"seed\": \"1\"}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": false, \"adv_output\": {\"readtags\": [], \"collapsecigar\": false}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.20+galaxy3", | |
| "type": "tool", | |
| "uuid": "ae46e826-d985-4437-abae-152b6877eea7", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "20": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "errors": null, | |
| "id": 20, | |
| "input_connections": { | |
| "effective_genome_size_options|gsize": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "treatment|input_treatment_file": { | |
| "id": 19, | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "effective_genome_size_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "treatment" | |
| } | |
| ], | |
| "label": "call peaks on merge", | |
| "name": "MACS2 callpeak", | |
| "outputs": [ | |
| { | |
| "name": "output_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_narrowpeaks", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 1546.199951171875, | |
| "top": 579.4979025976545 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_tabular": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_narrowpeaks": { | |
| "action_arguments": { | |
| "newname": "merged macs2 narrowPeaks" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "RenameDatasetActionoutput_tabular": { | |
| "action_arguments": { | |
| "newname": "merged macs2 tabular" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_treat_pileup": { | |
| "action_arguments": { | |
| "newname": "merged macs2 coverage normalized" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86e2413cf3f8", | |
| "name": "macs2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": true, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAM\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"0\"}, \"outputs\": [\"peaks_tabular\"], \"treatment\": {\"t_multi_select\": \"Yes\", \"__current_case__\": 1, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.9.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "e183ec20-d4ab-427a-9a0c-3e9bbced8793", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "merged_macs2_narrowPeaks", | |
| "output_name": "output_narrowpeaks", | |
| "uuid": "6d97d620-9486-4d85-9a80-e3595c0bb968" | |
| } | |
| ] | |
| }, | |
| "21": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0", | |
| "errors": null, | |
| "id": 21, | |
| "input_connections": { | |
| "inputA": { | |
| "id": 20, | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "reduce_or_iterate|inputB": { | |
| "id": 12, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bedtools Intersect intervals", | |
| "name": "reduce_or_iterate" | |
| } | |
| ], | |
| "label": "get merged peaks overlapping at least x replicates", | |
| "name": "bedtools Intersect intervals", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1643.5166015625, | |
| "top": 314.897927011717 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"bed\": false, \"count\": false, \"fraction_cond\": {\"fraction_select\": \"default\", \"__current_case__\": 0}, \"genome_file_opts\": {\"genome_file_opts_selector\": \"loc\", \"__current_case__\": 0, \"genome\": null}, \"header\": false, \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"invert\": false, \"once\": false, \"overlap_mode\": [\"-wa\", \"-wb\"], \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": false, \"split\": false, \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "d6183a41-f78c-49fc-b826-f8aa95ff84cb", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "22": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "errors": null, | |
| "id": 22, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 6, | |
| "output_name": "output_tabular" | |
| }, | |
| "results_1|software_cond|input": { | |
| "id": 20, | |
| "output_name": "output_tabular" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "multiQC", | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "stats", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2315.5733416696335, | |
| "top": 16.13231218303406 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionstats": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "stats" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "f7e2f1eb3a16", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.24.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "f7d74248-16e3-4020-8156-caae0e7682ef", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "multiqc_output", | |
| "output_name": "html_report", | |
| "uuid": "a342a984-235e-4d40-9e09-d835aab35282" | |
| } | |
| ] | |
| }, | |
| "23": { | |
| "annotation": "", | |
| "content_id": "Filter1", | |
| "errors": null, | |
| "id": 23, | |
| "input_connections": { | |
| "input": { | |
| "id": 21, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "only keep peaks with summits overlapping intersection of at least x replicates", | |
| "name": "Filter", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1874.401877544738, | |
| "top": 319.9312522070295 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Filter1", | |
| "tool_state": "{\"cond\": \"(c2+c10)>=c12 and (c2+c10)<c13\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "dd65edce-c587-4e3f-9c08-408fe81c557e", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "24": { | |
| "annotation": "", | |
| "content_id": "Cut1", | |
| "errors": null, | |
| "id": 24, | |
| "input_connections": { | |
| "input": { | |
| "id": 23, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "keep only columns of narrowPeak", | |
| "name": "Cut", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2104.095825078475, | |
| "top": 414.0305050651918 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Cut1", | |
| "tool_state": "{\"columnList\": \"c1-c10\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.2", | |
| "type": "tool", | |
| "uuid": "6a58206f-a7b2-4f25-b837-b17185c86c52", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "25": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1", | |
| "errors": null, | |
| "id": 25, | |
| "input_connections": { | |
| "infile": { | |
| "id": 24, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "discard duplicated lines", | |
| "name": "Unique", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2336.462697917632, | |
| "top": 435.17882451605976 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionoutfile": { | |
| "action_arguments": { | |
| "newtype": "bed" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "outfile" | |
| }, | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "narrowPeak shared by at least x replicates" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"ignore_case\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"is_numeric\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "62a36e17-5aea-419d-835d-0fa33dd05e97", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "shared_narrowPeak", | |
| "output_name": "outfile", | |
| "uuid": "47b85acb-10eb-454c-aa95-1253f223641d" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "ATAC-seq" | |
| ], | |
| "uuid": "f71eee25-8402-41da-8284-5298656ab379", | |
| "version": 2 | |
| }, | |
| "updated": "2024-12-03T18:32:53.981551", | |
| "readme": "# Consensus peaks Workflow\n\nThe goal of this workflow is to get a list of confident peaks with summits from n replicates.\n\n## Inputs dataset\n\n- The workflow needs a single input which is a list of datasets with n BAM where PCR duplicates have been removed (the workflow also works for nested list if you have multiple conditions each with multiple replicates).\n\n## Inputs values\n\n- Minimum number of overlap: Minimum number of replicates into which the final summit should be present.\n- effective_genome_size: this is used by MACS2 and may be entered manually (indications are provided for heavily used genomes).\n- bin_size: this is the bin sized used to compute the average of normalized profiles. Large values will allow to have a smaller output file but with less resolution while small values will increase computation time and size of the output file to produce a more resolutive bigwig.\n\n## Strategy summary\n\nHere is a generated example to highlight the strategy:\n\n\n## Processing\n\n- The workflow will:\n - first part:\n - call peaks and compute normalized coverage on each BAM individually\n - average normalized profiles\n - compute the intersection between all peaks and filter when at least x replicate overlaps\n - second part:\n - subset all BAM to get the same number of reads\n - call peaks on all subsetted BAM combined\n - finally, keep only peaks from the second part that have summits overlapping the filtered intersection of the first part.\n", | |
| "changelog": "# Changelog\n\n## [1.2] 2024-09-24\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3`\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0`\n\n## [1.1] 2024-05-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0`\n\n## [1.0] 2024-05-01\n\n### Changed\nThe workflow changed as it accepts now more than 2 replicates and has a new parameter to define what is the minimum number of replicates where the summit should be found.\nThe workflow for ATAC and CUT&RUN changed the input datatype as now a BAM is required instead of a BED.\n\n## [0.7] 2024-04-15\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n\n## [0.6] 2024-04-08\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n\n## [0.5] 2024-03-05\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/1.1.0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0`\n\n## [0.4] 2023-11-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2`\n\n## [0.3] 2023-11-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2`\n\n## [0.2] 2023-11-10\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0`\n\n## [0.1] 2023-08-31\nFirst release.\n", | |
| "diagrams": "# Workflow diagrams\n\n## Get Confident Peaks From ChIP_SR replicates\n\n```mermaid\ngraph LR\n0[\"ℹ️ n rmDup BAMSR\"]@{ shape: docs }\n1[\"ℹ️ Minimum number of overlap\"]@{ shape: lean-l }\n2[\"ℹ️ effective_genome_size\"]@{ shape: lean-l }\n3[\"ℹ️ bin_size\"]@{ shape: lean-l }\n4[\"count number of reads\"]@{ shape: process }\n0 --> 4\n5[\"generate filter rule\"]@{ shape: process }\n1 --> 5\n6[\"call peaks individually\"]@{ shape: process }\n2 --> 6\n0 --> 6\n7[\"put all nb of reads into single dataset\"]@{ shape: process }\n4 --> 7\n8[\"compute multi intersect\"]@{ shape: process }\n6 --> 8\n9[\"individual normalized bigwig\"]@{ shape: process }\n6 --> 9\n10[\"get min value\"]@{ shape: process }\n7 --> 10\n11[\"get nb of replicates\"]@{ shape: process }\n7 --> 11\n12[\"filter multi intersect\"]@{ shape: process }\n5 --> 12\n8 --> 12\n13[\"average coverage from replicates\"]@{ shape: process }\n3 --> 13\n9 --> 13\n14[\"convert min value to text\"]@{ shape: process }\n10 --> 14\n15[\"Parse parameter value\"]@{ shape: process }\n11 --> 15\n16[\"create a dataset with the min value as many times as there are replicates\"]@{ shape: process }\n14 --> 16\n15 --> 16\n17[\"split min value\"]@{ shape: process }\n16 --> 17\n18[\"convert min nb of reads to parameter\"]@{ shape: process }\n17 --> 18\n19[\"downsample BAM\"]@{ shape: process }\n0 --> 19\n18 --> 19\n20[\"call peaks on merge\"]@{ shape: process }\n2 --> 20\n19 --> 20\n21[\"get merged peaks overlapping at least x replicates\"]@{ shape: process }\n20 --> 21\n12 --> 21\n22[\"multiQC\"]@{ shape: process }\n6 --> 22\n20 --> 22\n23[\"only keep peaks with summits overlapping intersection of at least x replicates\"]@{ shape: process }\n21 --> 23\n24[\"keep only columns of narrowPeak\"]@{ shape: process }\n23 --> 24\n25[\"discard duplicated lines\"]@{ shape: process }\n24 --> 25\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/consensus-peaks/consensus-peaks-chip-sr", | |
| "dockstore_id": 23496, | |
| "categories": [], | |
| "collections": [ | |
| "Epigenetics" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test for consensus-peaks-chip-sr.ga", | |
| "job": { | |
| "n rmDup BAMSR": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "class": "File", | |
| "identifier": "rep1", | |
| "path": "test-data/ChIP_SR_rep1.bam", | |
| "dbkey": "mm10" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "rep2", | |
| "path": "test-data/ChIP_SR_rep2.bam", | |
| "dbkey": "mm10" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "rep3", | |
| "path": "test-data/ChIP_SR_rep3.bam", | |
| "dbkey": "mm10" | |
| } | |
| ] | |
| }, | |
| "Minimum number of overlap": 2, | |
| "effective_genome_size": 1870000000, | |
| "bin_size": 50 | |
| }, | |
| "outputs": { | |
| "individual_macs2_narrowPeaks": { | |
| "element_tests": { | |
| "rep1": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 3 | |
| } | |
| } | |
| }, | |
| "rep2": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 3 | |
| } | |
| } | |
| }, | |
| "rep3": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 3 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "average_bigwig": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 1290, | |
| "delta": 100 | |
| } | |
| } | |
| }, | |
| "merged_macs2_narrowPeaks": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 4 | |
| } | |
| } | |
| }, | |
| "multiqc_output": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "<span class=\"mqc_table_tooltip\" title=\"MACS2: Fragment Length\">Fragment Length</span>" | |
| } | |
| } | |
| }, | |
| "shared_narrowPeak": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 2 | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| }, | |
| { | |
| "name": "consensus-peaks-chip-pe", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/consensus-peaks-chip-pe.ga", | |
| "testParameterFiles": [ | |
| "/consensus-peaks-chip-pe-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Lucille Delisle", | |
| "orcid": "0000-0002-1964-4960" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow takes as input PE BAM from ChIP-seq. It calls peaks on each replicate and intersect them. In parallel, each BAM is subsetted to smallest number of reads. Peaks are called using all subsets combined. Only peaks called using a combination of all subsets which have summits intersecting the intersection of at least x replicates will be kept.", | |
| "comments": [ | |
| { | |
| "child_steps": [ | |
| 9, | |
| 13 | |
| ], | |
| "color": "green", | |
| "data": { | |
| "title": "Get the average coverage" | |
| }, | |
| "id": 2, | |
| "position": [ | |
| 687.5, | |
| 395.8 | |
| ], | |
| "size": [ | |
| 498.9, | |
| 345.5 | |
| ], | |
| "type": "frame" | |
| }, | |
| { | |
| "child_steps": [ | |
| 4, | |
| 7, | |
| 11, | |
| 10, | |
| 15, | |
| 14, | |
| 16, | |
| 17, | |
| 18, | |
| 19 | |
| ], | |
| "color": "none", | |
| "data": { | |
| "title": "Downsample input BAM to get the same number of reads" | |
| }, | |
| "id": 1, | |
| "position": [ | |
| 180.2, | |
| 744.1 | |
| ], | |
| "size": [ | |
| 1889, | |
| 379 | |
| ], | |
| "type": "frame" | |
| }, | |
| { | |
| "child_steps": [ | |
| 5, | |
| 8, | |
| 12 | |
| ], | |
| "color": "blue", | |
| "data": { | |
| "title": "Get a BED with intersection of at least x rep" | |
| }, | |
| "id": 0, | |
| "position": [ | |
| 764.8, | |
| 0.0 | |
| ], | |
| "size": [ | |
| 531.7, | |
| 370.1 | |
| ], | |
| "type": "frame" | |
| } | |
| ], | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-1964-4960", | |
| "name": "Lucille Delisle" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "release": "1.2", | |
| "name": "Get Confident Peaks From ChIP_PE replicates", | |
| "steps": { | |
| "0": { | |
| "annotation": "A collection with n replicates. BAM should not have duplicates", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "A collection with n replicates. BAM should not have duplicates", | |
| "name": "n rmDup BAMPE" | |
| } | |
| ], | |
| "label": "n rmDup BAMPE", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 155.14998779296874 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"bam\"], \"tag\": \"\", \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "fc7f3d9f-c1a6-4e00-a65a-ff31ab9e6bca", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Minimum number of replicates into which the summit should be present.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Minimum number of replicates into which the summit should be present.", | |
| "name": "Minimum number of overlap" | |
| } | |
| ], | |
| "label": "Minimum number of overlap", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 25, | |
| "top": 233.6 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "025fcb5d-6842-4ed0-9bac-b393942b9d29", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "name": "effective_genome_size" | |
| } | |
| ], | |
| "label": "effective_genome_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 39, | |
| "top": 328.1479148046858 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "dac93661-a2aa-4163-a3ec-f64c4075c881", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "Bin size for average of normalized coverage", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Bin size for average of normalized coverage", | |
| "name": "bin_size" | |
| } | |
| ], | |
| "label": "bin_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 57, | |
| "top": 425.1812399999983 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "ef17ea2d-7f73-44a8-aecf-15279c559fd1", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "count number of reads", | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputcnt", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 200.2051223265678, | |
| "top": 859.5510386258217 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutputcnt": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outputcnt" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "32dc5f781059", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"all_reads\", \"__current_case__\": 0, \"output_options\": {\"reads_report_type\": \"count\", \"__current_case__\": 1}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.20+galaxy3", | |
| "type": "tool", | |
| "uuid": "a864ff43-af08-436a-aa78-54491ff0cce6", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "generate filter rule", | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 793.0213699877876, | |
| "top": 178.96164159176644 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c4 >= \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "e6855df9-0e94-4310-835c-15514bd37974", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "effective_genome_size_options|gsize": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "treatment|input_treatment_file": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "effective_genome_size_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "treatment" | |
| } | |
| ], | |
| "label": "call peaks individually", | |
| "name": "MACS2 callpeak", | |
| "outputs": [ | |
| { | |
| "name": "output_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_narrowpeaks", | |
| "type": "bed" | |
| }, | |
| { | |
| "name": "output_treat_pileup", | |
| "type": "bedgraph" | |
| }, | |
| { | |
| "name": "output_control_lambda", | |
| "type": "bedgraph" | |
| } | |
| ], | |
| "position": { | |
| "left": 454.449951171875, | |
| "top": 139.41457740234202 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_control_lambda": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_control_lambda" | |
| }, | |
| "HideDatasetActionoutput_tabular": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "HideDatasetActionoutput_treat_pileup": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| }, | |
| "RenameDatasetActionoutput_narrowpeaks": { | |
| "action_arguments": { | |
| "newname": "individual macs2 narrowPeaks" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "RenameDatasetActionoutput_tabular": { | |
| "action_arguments": { | |
| "newname": "individual macs2 tabular" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_treat_pileup": { | |
| "action_arguments": { | |
| "newname": "individual macs2 coverage normalized" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86e2413cf3f8", | |
| "name": "macs2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": true, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAMPE\", \"nomodel_type\": {\"nomodel_type_selector\": \"create_model\", \"__current_case__\": 0, \"mfold_lower\": \"5\", \"mfold_upper\": \"50\", \"band_width\": \"300\"}, \"outputs\": [\"bdg\", \"peaks_tabular\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.9.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "8f2a3aa4-704e-4d90-a672-94b97996dd56", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "individual_macs2_narrowPeaks", | |
| "output_name": "output_narrowpeaks", | |
| "uuid": "4552df5d-4397-4118-af11-f97eb8c748a5" | |
| } | |
| ] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "input_list": { | |
| "id": 4, | |
| "output_name": "outputcnt" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "put all nb of reads into single dataset", | |
| "name": "Collapse Collection", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 437.3050979125053, | |
| "top": 856.8156282351949 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "90981f86000f", | |
| "name": "collapse_collections", | |
| "owner": "nml", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filename\": {\"add_name\": false, \"__current_case__\": 1}, \"input_list\": {\"__class__\": \"ConnectedValue\"}, \"one_header\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "5.1.0", | |
| "type": "tool", | |
| "uuid": "bd8b6b03-19ef-4921-96c3-abe5e6992941", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "tag|inputs": { | |
| "id": 6, | |
| "output_name": "output_narrowpeaks" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bedtools Multiple Intersect", | |
| "name": "tag" | |
| } | |
| ], | |
| "label": "compute multi intersect", | |
| "name": "bedtools Multiple Intersect", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 790, | |
| "top": 35.6 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"cluster\": false, \"empty\": {\"empty_selector\": \"\", \"__current_case__\": 1}, \"filler\": \"0\", \"header\": false, \"tag\": {\"tag_select\": \"tag\", \"__current_case__\": 0, \"inputs\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1", | |
| "type": "tool", | |
| "uuid": "9edd1aab-eb4c-4fd4-b9f6-a6dbcae46dd2", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "wig_to_bigWig", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "input1": { | |
| "id": 6, | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "individual normalized bigwig", | |
| "name": "Wig/BedGraph-to-bigWig", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 701.9011607009672, | |
| "top": 524.1953936525294 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "wig_to_bigWig", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "d0d6f92d-3d7e-44c3-b2f6-c10e429d2369", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/table_compute/table_compute/1.2.4+galaxy0", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "singtabop|input": { | |
| "id": 7, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Table Compute", | |
| "name": "singtabop" | |
| } | |
| ], | |
| "label": "get min value", | |
| "name": "Table Compute", | |
| "outputs": [ | |
| { | |
| "name": "table", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 661.2051223265678, | |
| "top": 836.1343516141029 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActiontable": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "table" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/table_compute/table_compute/1.2.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3bf5661c0280", | |
| "name": "table_compute", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"out_opts\": null, \"precision\": \"6\", \"singtabop\": {\"use_type\": \"single\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}, \"col_row_names\": null, \"adv\": {\"header\": null, \"nrows\": null, \"skipfooter\": null, \"skip_blank_lines\": true}, \"user\": {\"mode\": \"matrixapply\", \"__current_case__\": 3, \"matrixapply_func\": {\"vector_op\": \"min\", \"__current_case__\": 1}, \"dimension\": \"0\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.2.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "0d63ffd8-0646-4dbf-9ede-14bffcd5de2d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "wc_gnu", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "input1": { | |
| "id": 7, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "get nb of replicates", | |
| "name": "Line/Word/Character count", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 664.2051223265678, | |
| "top": 946.0510386258217 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "wc_gnu", | |
| "tool_state": "{\"include_header\": false, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "1e4420d0-edfb-4411-b7e0-602b510ff898", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "Filter1", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "cond": { | |
| "id": 5, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 8, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "filter multi intersect", | |
| "name": "Filter", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1058, | |
| "top": 43.6 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Filter1", | |
| "tool_state": "{\"cond\": {\"__class__\": \"ConnectedValue\"}, \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "4acd5289-87cc-4cfb-9863-35248989ab27", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "advancedOpt|binSize": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "bigwigs": { | |
| "id": 9, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| } | |
| ], | |
| "label": "average coverage from replicates", | |
| "name": "bigwigAverage", | |
| "outputs": [ | |
| { | |
| "name": "outFileName", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 944.6735015666067, | |
| "top": 451.87316496226794 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutFileName": { | |
| "action_arguments": { | |
| "newname": "Average Normalized Coverage of all replicates" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outFileName" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4a53856a5b85", | |
| "name": "deeptools_bigwig_average", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"skipNAs\": false, \"scaleFactors\": \"1\", \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"bigwigs\": {\"__class__\": \"ConnectedValue\"}, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.5.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "36059130-5f2a-4fe0-8b36-58073595fdd5", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "average_bigwig", | |
| "output_name": "outFileName", | |
| "uuid": "35dfdb8a-121d-41d1-9ad1-1e0d95a8ab8c" | |
| } | |
| ] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "input1": { | |
| "id": 10, | |
| "output_name": "table" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert min value to text", | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "text_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 903.2051223265678, | |
| "top": 784.0510386258217 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| }, | |
| "HideDatasetActiontext_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "text_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "cdbee56b-9fff-4205-9cb6-741be770985d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "15": { | |
| "annotation": "get nb of rep as param", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 15, | |
| "input_connections": { | |
| "input1": { | |
| "id": 11, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "integer_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 907.2051223265678, | |
| "top": 949.0510386258217 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "2ea49dca-270b-454a-9d86-6947799ab996", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "16": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/9.3+galaxy1", | |
| "errors": null, | |
| "id": 16, | |
| "input_connections": { | |
| "token_set_0|line": { | |
| "id": 14, | |
| "output_name": "text_param" | |
| }, | |
| "token_set_0|repeat_select|times": { | |
| "id": 15, | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "create a dataset with the min value as many times as there are replicates", | |
| "name": "Create text file", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 1136.2051223265678, | |
| "top": 843.0510386258217 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutfile": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"token_set\": [{\"__index__\": 0, \"line\": {\"__class__\": \"ConnectedValue\"}, \"repeat_select\": {\"repeat_select_opts\": \"user\", \"__current_case__\": 0, \"times\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "29ef7038-e10a-47cd-835f-945dccaf9c1c", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "17": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", | |
| "errors": null, | |
| "id": 17, | |
| "input_connections": { | |
| "split_parms|input": { | |
| "id": 16, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Split file", | |
| "name": "split_parms" | |
| } | |
| ], | |
| "label": "split min value", | |
| "name": "Split file", | |
| "outputs": [ | |
| { | |
| "name": "list_output_txt", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1371.2051223265678, | |
| "top": 921.0510386258217 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionlist_output_txt": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "list_output_txt" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2dae863c8f42", | |
| "name": "split_file_to_collection", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"split_parms\": {\"select_ftype\": \"txt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}, \"select_mode\": {\"mode\": \"chunk\", \"__current_case__\": 0, \"chunksize\": \"1\"}, \"newfilenames\": \"split_file\", \"select_allocate\": {\"allocate\": \"byrow\", \"__current_case__\": 2}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.5.2", | |
| "type": "tool", | |
| "uuid": "7db836a5-793a-403e-8db1-b97f619f4c69", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "18": { | |
| "annotation": "", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 18, | |
| "input_connections": { | |
| "input1": { | |
| "id": 17, | |
| "output_name": "list_output_txt" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert min nb of reads to parameter", | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "integer_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 1605.2384475218803, | |
| "top": 912.9677256375404 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "71b1c454-41db-4a8b-8595-8d3fa86a86a0", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "19": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "errors": null, | |
| "id": 19, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| }, | |
| "mode|subsample_config|subsampling_mode|target": { | |
| "id": 18, | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "downsample BAM", | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputsam", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1848.7423727171654, | |
| "top": 894.4010142117592 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutputsam": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "32dc5f781059", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"cond_expr\": {\"select_expr\": \"no\", \"__current_case__\": 0}, \"quality\": null, \"library\": null, \"cigarcons\": null, \"inclusive_filter\": null, \"exclusive_filter\": null, \"exclusive_filter_all\": null, \"tag\": null, \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"target\", \"__current_case__\": 1, \"target\": {\"__class__\": \"ConnectedValue\"}, \"seed\": \"1\"}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": false, \"adv_output\": {\"readtags\": [], \"collapsecigar\": false}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.20+galaxy3", | |
| "type": "tool", | |
| "uuid": "ae46e826-d985-4437-abae-152b6877eea7", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "20": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "errors": null, | |
| "id": 20, | |
| "input_connections": { | |
| "effective_genome_size_options|gsize": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "treatment|input_treatment_file": { | |
| "id": 19, | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "effective_genome_size_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "treatment" | |
| } | |
| ], | |
| "label": "call peaks on merge", | |
| "name": "MACS2 callpeak", | |
| "outputs": [ | |
| { | |
| "name": "output_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_narrowpeaks", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 1456.336227527062, | |
| "top": 482.24653231537656 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_tabular": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_narrowpeaks": { | |
| "action_arguments": { | |
| "newname": "merged macs2 narrowPeaks" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "RenameDatasetActionoutput_tabular": { | |
| "action_arguments": { | |
| "newname": "merged macs2 tabular" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_treat_pileup": { | |
| "action_arguments": { | |
| "newname": "merged macs2 coverage normalized" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86e2413cf3f8", | |
| "name": "macs2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": true, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"1\", \"__current_case__\": 1}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BAMPE\", \"nomodel_type\": {\"nomodel_type_selector\": \"create_model\", \"__current_case__\": 0, \"mfold_lower\": \"5\", \"mfold_upper\": \"50\", \"band_width\": \"300\"}, \"outputs\": [\"peaks_tabular\"], \"treatment\": {\"t_multi_select\": \"Yes\", \"__current_case__\": 1, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.9.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "e183ec20-d4ab-427a-9a0c-3e9bbced8793", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "merged_macs2_narrowPeaks", | |
| "output_name": "output_narrowpeaks", | |
| "uuid": "6d97d620-9486-4d85-9a80-e3595c0bb968" | |
| } | |
| ] | |
| }, | |
| "21": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0", | |
| "errors": null, | |
| "id": 21, | |
| "input_connections": { | |
| "inputA": { | |
| "id": 20, | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "reduce_or_iterate|inputB": { | |
| "id": 12, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bedtools Intersect intervals", | |
| "name": "reduce_or_iterate" | |
| } | |
| ], | |
| "label": "get merged peaks overlapping at least x replicates", | |
| "name": "bedtools Intersect intervals", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1643.5166015625, | |
| "top": 301.09792701171705 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"bed\": false, \"count\": false, \"fraction_cond\": {\"fraction_select\": \"default\", \"__current_case__\": 0}, \"genome_file_opts\": {\"genome_file_opts_selector\": \"loc\", \"__current_case__\": 0, \"genome\": null}, \"header\": false, \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"invert\": false, \"once\": false, \"overlap_mode\": [\"-wa\", \"-wb\"], \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": false, \"split\": false, \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "d6183a41-f78c-49fc-b826-f8aa95ff84cb", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "22": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "errors": null, | |
| "id": 22, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 6, | |
| "output_name": "output_tabular" | |
| }, | |
| "results_1|software_cond|input": { | |
| "id": 20, | |
| "output_name": "output_tabular" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "multiQC", | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "stats", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2091.738158489414, | |
| "top": 26.470097442576304 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionstats": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "stats" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "f7e2f1eb3a16", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.24.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "f7d74248-16e3-4020-8156-caae0e7682ef", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "multiqc_output", | |
| "output_name": "html_report", | |
| "uuid": "a342a984-235e-4d40-9e09-d835aab35282" | |
| } | |
| ] | |
| }, | |
| "23": { | |
| "annotation": "", | |
| "content_id": "Filter1", | |
| "errors": null, | |
| "id": 23, | |
| "input_connections": { | |
| "input": { | |
| "id": 21, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "only keep peaks with summits overlapping intersection of at least x replicates", | |
| "name": "Filter", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1874.401877544738, | |
| "top": 306.13125220702955 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Filter1", | |
| "tool_state": "{\"cond\": \"(c2+c10)>=c12 and (c2+c10)<c13\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "dd65edce-c587-4e3f-9c08-408fe81c557e", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "24": { | |
| "annotation": "", | |
| "content_id": "Cut1", | |
| "errors": null, | |
| "id": 24, | |
| "input_connections": { | |
| "input": { | |
| "id": 23, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "keep only columns of narrowPeak", | |
| "name": "Cut", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2104.095825078475, | |
| "top": 400.23050506519184 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Cut1", | |
| "tool_state": "{\"columnList\": \"c1-c10\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.2", | |
| "type": "tool", | |
| "uuid": "6a58206f-a7b2-4f25-b837-b17185c86c52", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "25": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1", | |
| "errors": null, | |
| "id": 25, | |
| "input_connections": { | |
| "infile": { | |
| "id": 24, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "discard duplicated lines", | |
| "name": "Unique", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2336.462697917632, | |
| "top": 421.3788245160598 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionoutfile": { | |
| "action_arguments": { | |
| "newtype": "bed" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "outfile" | |
| }, | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "narrowPeak shared by at least x replicates" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"ignore_case\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"is_numeric\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "62a36e17-5aea-419d-835d-0fa33dd05e97", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "shared_narrowPeak", | |
| "output_name": "outfile", | |
| "uuid": "47b85acb-10eb-454c-aa95-1253f223641d" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "ATAC-seq" | |
| ], | |
| "uuid": "a2f66906-e9e3-42f9-8629-390017ed2db0", | |
| "version": 6 | |
| }, | |
| "updated": "2024-12-03T18:32:53.981219", | |
| "readme": "# Consensus peaks Workflow\n\nThe goal of this workflow is to get a list of confident peaks with summits from n replicates.\n\n## Inputs dataset\n\n- The workflow needs a single input which is a list of datasets with n BAM where PCR duplicates have been removed (the workflow also works for nested list if you have multiple conditions each with multiple replicates).\n\n## Inputs values\n\n- Minimum number of overlap: Minimum number of replicates into which the final summit should be present.\n- effective_genome_size: this is used by MACS2 and may be entered manually (indications are provided for heavily used genomes).\n- bin_size: this is the bin sized used to compute the average of normalized profiles. Large values will allow to have a smaller output file but with less resolution while small values will increase computation time and size of the output file to produce a more resolutive bigwig.\n\n## Strategy summary\n\nHere is a generated example to highlight the strategy:\n\n\n## Processing\n\n- The workflow will:\n - first part:\n - call peaks and compute normalized coverage on each BAM individually\n - average normalized profiles\n - compute the intersection between all peaks and filter when at least x replicate overlaps\n - second part:\n - subset all BAM to get the same number of reads\n - call peaks on all subsetted BAM combined\n - finally, keep only peaks from the second part that have summits overlapping the filtered intersection of the first part.\n", | |
| "changelog": "# Changelog\n\n## [1.2] 2024-09-24\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3`\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0`\n\n## [1.1] 2024-05-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0`\n\n## [1.0] 2024-05-01\n\n### Changed\nThe workflow changed as it accepts now more than 2 replicates and has a new parameter to define what is the minimum number of replicates where the summit should be found.\nThe workflow for ATAC and CUT&RUN changed the input datatype as now a BAM is required instead of a BED.\n\n## [0.7] 2024-04-15\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n\n## [0.6] 2024-04-08\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n\n## [0.5] 2024-03-05\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/1.1.0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0`\n\n## [0.4] 2023-11-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2`\n\n## [0.3] 2023-11-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2`\n\n## [0.2] 2023-11-10\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0`\n\n## [0.1] 2023-08-31\nFirst release.\n", | |
| "diagrams": "# Workflow diagrams\n\n## Get Confident Peaks From ChIP_PE replicates\n\n```mermaid\ngraph LR\n0[\"ℹ️ n rmDup BAMPE\"]@{ shape: docs }\n1[\"ℹ️ Minimum number of overlap\"]@{ shape: lean-l }\n2[\"ℹ️ effective_genome_size\"]@{ shape: lean-l }\n3[\"ℹ️ bin_size\"]@{ shape: lean-l }\n4[\"count number of reads\"]@{ shape: process }\n0 --> 4\n5[\"generate filter rule\"]@{ shape: process }\n1 --> 5\n6[\"call peaks individually\"]@{ shape: process }\n2 --> 6\n0 --> 6\n7[\"put all nb of reads into single dataset\"]@{ shape: process }\n4 --> 7\n8[\"compute multi intersect\"]@{ shape: process }\n6 --> 8\n9[\"individual normalized bigwig\"]@{ shape: process }\n6 --> 9\n10[\"get min value\"]@{ shape: process }\n7 --> 10\n11[\"get nb of replicates\"]@{ shape: process }\n7 --> 11\n12[\"filter multi intersect\"]@{ shape: process }\n5 --> 12\n8 --> 12\n13[\"average coverage from replicates\"]@{ shape: process }\n3 --> 13\n9 --> 13\n14[\"convert min value to text\"]@{ shape: process }\n10 --> 14\n15[\"Parse parameter value\"]@{ shape: process }\n11 --> 15\n16[\"create a dataset with the min value as many times as there are replicates\"]@{ shape: process }\n14 --> 16\n15 --> 16\n17[\"split min value\"]@{ shape: process }\n16 --> 17\n18[\"convert min nb of reads to parameter\"]@{ shape: process }\n17 --> 18\n19[\"downsample BAM\"]@{ shape: process }\n0 --> 19\n18 --> 19\n20[\"call peaks on merge\"]@{ shape: process }\n2 --> 20\n19 --> 20\n21[\"get merged peaks overlapping at least x replicates\"]@{ shape: process }\n20 --> 21\n12 --> 21\n22[\"multiQC\"]@{ shape: process }\n6 --> 22\n20 --> 22\n23[\"only keep peaks with summits overlapping intersection of at least x replicates\"]@{ shape: process }\n21 --> 23\n24[\"keep only columns of narrowPeak\"]@{ shape: process }\n23 --> 24\n25[\"discard duplicated lines\"]@{ shape: process }\n24 --> 25\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/consensus-peaks/consensus-peaks-chip-pe", | |
| "dockstore_id": 23497, | |
| "categories": [], | |
| "collections": [ | |
| "Epigenetics" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test for consensus-peaks-chip-pe.ga", | |
| "job": { | |
| "n rmDup BAMPE": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "class": "File", | |
| "identifier": "rep1", | |
| "path": "test-data/rep1.bam", | |
| "dbkey": "mm10" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "rep2", | |
| "path": "test-data/rep2.bam", | |
| "dbkey": "mm10" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "rep3", | |
| "path": "test-data/rep3.bam", | |
| "dbkey": "mm10" | |
| } | |
| ] | |
| }, | |
| "Minimum number of overlap": 2, | |
| "effective_genome_size": 1870000000, | |
| "bin_size": 50 | |
| }, | |
| "outputs": { | |
| "individual_macs2_narrowPeaks": { | |
| "element_tests": { | |
| "rep1": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 3 | |
| } | |
| } | |
| }, | |
| "rep2": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 3 | |
| } | |
| } | |
| }, | |
| "rep3": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 2 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "average_bigwig": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 1290, | |
| "delta": 100 | |
| } | |
| } | |
| }, | |
| "merged_macs2_narrowPeaks": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 4 | |
| } | |
| } | |
| }, | |
| "multiqc_output": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "<span class=\"mqc_table_tooltip\" title=\"MACS2: Fragment Length\">Fragment Length</span>" | |
| } | |
| } | |
| }, | |
| "shared_narrowPeak": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 2 | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| }, | |
| { | |
| "name": "consensus-peaks-atac-cutandrun", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/consensus-peaks-atac-cutandrun.ga", | |
| "testParameterFiles": [ | |
| "/consensus-peaks-atac-cutandrun-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Lucille Delisle", | |
| "orcid": "0000-0002-1964-4960" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow takes as input BAM from ATAC-seq or CUT&RUN. It calls peaks on each replicate and intersect them. In parallel, each BAM is subsetted to smallest number of reads. Peaks are called using all subsets combined. Only peaks called using a combination of all subsets which have summits intersecting the intersection of at least x replicates will be kept.", | |
| "comments": [ | |
| { | |
| "child_steps": [ | |
| 5, | |
| 8, | |
| 11, | |
| 12, | |
| 15, | |
| 16, | |
| 17, | |
| 18, | |
| 19, | |
| 20 | |
| ], | |
| "color": "blue", | |
| "data": { | |
| "title": "Downsample input BAM to get the same number of reads" | |
| }, | |
| "id": 2, | |
| "position": [ | |
| 228, | |
| 878.7 | |
| ], | |
| "size": [ | |
| 1917.8, | |
| 397.4 | |
| ], | |
| "type": "frame" | |
| }, | |
| { | |
| "child_steps": [ | |
| 6, | |
| 9, | |
| 13 | |
| ], | |
| "color": "blue", | |
| "data": { | |
| "title": "Get a BED with intersection of at least x rep" | |
| }, | |
| "id": 0, | |
| "position": [ | |
| 776.6, | |
| 0 | |
| ], | |
| "size": [ | |
| 508.7, | |
| 363 | |
| ], | |
| "type": "frame" | |
| }, | |
| { | |
| "child_steps": [ | |
| 10, | |
| 14 | |
| ], | |
| "color": "green", | |
| "data": { | |
| "title": "Get the average coverage" | |
| }, | |
| "id": 1, | |
| "position": [ | |
| 647.1, | |
| 523.9 | |
| ], | |
| "size": [ | |
| 504.5, | |
| 324 | |
| ], | |
| "type": "frame" | |
| } | |
| ], | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-1964-4960", | |
| "name": "Lucille Delisle" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "release": "1.2", | |
| "name": "Get Confident Peaks From ATAC or CUTandRUN replicates", | |
| "steps": { | |
| "0": { | |
| "annotation": "A collection with n replicates. BAM should not have duplicates.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "A collection with n replicates. BAM should not have duplicates.", | |
| "name": "n rmDup BAM" | |
| } | |
| ], | |
| "label": "n rmDup BAM", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 194.74998779296874 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"format\": [\"bam\"], \"tag\": \"\", \"collection_type\": \"list\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "fc7f3d9f-c1a6-4e00-a65a-ff31ab9e6bca", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Minimum number of replicates into which the summit should be present.", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Minimum number of replicates into which the summit should be present.", | |
| "name": "Minimum number of overlap" | |
| } | |
| ], | |
| "label": "Minimum number of overlap", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 25, | |
| "top": 273.2 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "025fcb5d-6842-4ed0-9bac-b393942b9d29", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000", | |
| "name": "effective_genome_size" | |
| } | |
| ], | |
| "label": "effective_genome_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 39, | |
| "top": 367.74791480468576 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "dac93661-a2aa-4163-a3ec-f64c4075c881", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "Bin size for average of normalized coverage", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Bin size for average of normalized coverage", | |
| "name": "bin_size" | |
| } | |
| ], | |
| "label": "bin_size", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 57, | |
| "top": 464.78123999999826 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"integer\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "ef17ea2d-7f73-44a8-aecf-15279c559fd1", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "4": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0", | |
| "errors": null, | |
| "id": 4, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert BAM to BED", | |
| "name": "bedtools BAM to BED", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 217.78016821945388, | |
| "top": 74.30843071525936 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "b62c338c-eb40-4ea5-b5e6-819f39790c07", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "5": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "errors": null, | |
| "id": 5, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "count number of reads", | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputcnt", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 248.01056678577842, | |
| "top": 1011.4507862713202 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutputcnt": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outputcnt" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "32dc5f781059", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"all_reads\", \"__current_case__\": 0, \"output_options\": {\"reads_report_type\": \"count\", \"__current_case__\": 1}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.20+galaxy3", | |
| "type": "tool", | |
| "uuid": "9cff58b2-123e-42df-b562-3b2a4a553934", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "6": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "errors": null, | |
| "id": 6, | |
| "input_connections": { | |
| "components_1|param_type|component_value": { | |
| "id": 1, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "generate filter rule", | |
| "name": "Compose text parameter value", | |
| "outputs": [ | |
| { | |
| "name": "out1", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 796.6100753157618, | |
| "top": 188.622596980592 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out1" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "e188c9826e0f", | |
| "name": "compose_text_param", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c4 >= \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.1", | |
| "type": "tool", | |
| "uuid": "e6855df9-0e94-4310-835c-15514bd37974", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "7": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "errors": null, | |
| "id": 7, | |
| "input_connections": { | |
| "effective_genome_size_options|gsize": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "treatment|input_treatment_file": { | |
| "id": 4, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "effective_genome_size_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "treatment" | |
| } | |
| ], | |
| "label": "call peaks individually", | |
| "name": "MACS2 callpeak", | |
| "outputs": [ | |
| { | |
| "name": "output_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_narrowpeaks", | |
| "type": "bed" | |
| }, | |
| { | |
| "name": "output_treat_pileup", | |
| "type": "bedgraph" | |
| }, | |
| { | |
| "name": "output_control_lambda", | |
| "type": "bedgraph" | |
| } | |
| ], | |
| "position": { | |
| "left": 454.449951171875, | |
| "top": 179.014577402342 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_control_lambda": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_control_lambda" | |
| }, | |
| "HideDatasetActionoutput_tabular": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "HideDatasetActionoutput_treat_pileup": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| }, | |
| "RenameDatasetActionoutput_narrowpeaks": { | |
| "action_arguments": { | |
| "newname": "individual macs2 narrowPeaks" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "RenameDatasetActionoutput_tabular": { | |
| "action_arguments": { | |
| "newname": "individual macs2 tabular" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_treat_pileup": { | |
| "action_arguments": { | |
| "newname": "individual macs2 coverage normalized" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86e2413cf3f8", | |
| "name": "macs2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": true, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"bdg\", \"peaks_tabular\"], \"treatment\": {\"t_multi_select\": \"No\", \"__current_case__\": 0, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.9.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "8f2a3aa4-704e-4d90-a672-94b97996dd56", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "individual_macs2_narrowPeaks", | |
| "output_name": "output_narrowpeaks", | |
| "uuid": "4552df5d-4397-4118-af11-f97eb8c748a5" | |
| } | |
| ] | |
| }, | |
| "8": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "errors": null, | |
| "id": 8, | |
| "input_connections": { | |
| "input_list": { | |
| "id": 5, | |
| "output_name": "outputcnt" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "put all nb of reads into single dataset", | |
| "name": "Collapse Collection", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 487.0999755859375, | |
| "top": 1006.4666625976563 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "90981f86000f", | |
| "name": "collapse_collections", | |
| "owner": "nml", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"filename\": {\"add_name\": false, \"__current_case__\": 1}, \"input_list\": {\"__class__\": \"ConnectedValue\"}, \"one_header\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "5.1.0", | |
| "type": "tool", | |
| "uuid": "bd8b6b03-19ef-4921-96c3-abe5e6992941", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "9": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1", | |
| "errors": null, | |
| "id": 9, | |
| "input_connections": { | |
| "tag|inputs": { | |
| "id": 7, | |
| "output_name": "output_narrowpeaks" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bedtools Multiple Intersect", | |
| "name": "tag" | |
| } | |
| ], | |
| "label": "compute multi intersect", | |
| "name": "bedtools Multiple Intersect", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 797.3086613144798, | |
| "top": 40.02067466199719 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"cluster\": false, \"empty\": {\"empty_selector\": \"\", \"__current_case__\": 1}, \"filler\": \"0\", \"header\": false, \"tag\": {\"tag_select\": \"tag\", \"__current_case__\": 0, \"inputs\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1", | |
| "type": "tool", | |
| "uuid": "9edd1aab-eb4c-4fd4-b9f6-a6dbcae46dd2", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "10": { | |
| "annotation": "", | |
| "content_id": "wig_to_bigWig", | |
| "errors": null, | |
| "id": 10, | |
| "input_connections": { | |
| "input1": { | |
| "id": 7, | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "individual normalized bigwig", | |
| "name": "Wig/BedGraph-to-bigWig", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 680.6833851669262, | |
| "top": 635.8069731504326 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "wig_to_bigWig", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"settings\": {\"settingsType\": \"preset\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "d0d6f92d-3d7e-44c3-b2f6-c10e429d2369", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "11": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/table_compute/table_compute/1.2.4+galaxy0", | |
| "errors": null, | |
| "id": 11, | |
| "input_connections": { | |
| "singtabop|input": { | |
| "id": 8, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Table Compute", | |
| "name": "singtabop" | |
| } | |
| ], | |
| "label": "get min value", | |
| "name": "Table Compute", | |
| "outputs": [ | |
| { | |
| "name": "table", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 719.5, | |
| "top": 974.7833435058594 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActiontable": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "table" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/table_compute/table_compute/1.2.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "3bf5661c0280", | |
| "name": "table_compute", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"out_opts\": null, \"precision\": \"6\", \"singtabop\": {\"use_type\": \"single\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}, \"col_row_names\": null, \"adv\": {\"header\": null, \"nrows\": null, \"skipfooter\": null, \"skip_blank_lines\": true}, \"user\": {\"mode\": \"matrixapply\", \"__current_case__\": 3, \"matrixapply_func\": {\"vector_op\": \"min\", \"__current_case__\": 1}, \"dimension\": \"0\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.2.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "0d63ffd8-0646-4dbf-9ede-14bffcd5de2d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "12": { | |
| "annotation": "", | |
| "content_id": "wc_gnu", | |
| "errors": null, | |
| "id": 12, | |
| "input_connections": { | |
| "input1": { | |
| "id": 8, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "get nb of replicates", | |
| "name": "Line/Word/Character count", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 723, | |
| "top": 1081.7 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "wc_gnu", | |
| "tool_state": "{\"include_header\": false, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.0", | |
| "type": "tool", | |
| "uuid": "1e4420d0-edfb-4411-b7e0-602b510ff898", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "13": { | |
| "annotation": "", | |
| "content_id": "Filter1", | |
| "errors": null, | |
| "id": 13, | |
| "input_connections": { | |
| "cond": { | |
| "id": 6, | |
| "output_name": "out1" | |
| }, | |
| "input": { | |
| "id": 9, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "filter multi intersect", | |
| "name": "Filter", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1065.3086613144797, | |
| "top": 48.02067466199719 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Filter1", | |
| "tool_state": "{\"cond\": {\"__class__\": \"ConnectedValue\"}, \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "4acd5289-87cc-4cfb-9863-35248989ab27", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "14": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "errors": null, | |
| "id": 14, | |
| "input_connections": { | |
| "advancedOpt|binSize": { | |
| "id": 3, | |
| "output_name": "output" | |
| }, | |
| "bigwigs": { | |
| "id": 10, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| }, | |
| { | |
| "description": "runtime parameter for tool bigwigAverage", | |
| "name": "advancedOpt" | |
| } | |
| ], | |
| "label": "average coverage from replicates", | |
| "name": "bigwigAverage", | |
| "outputs": [ | |
| { | |
| "name": "outFileName", | |
| "type": "bigwig" | |
| } | |
| ], | |
| "position": { | |
| "left": 938.7350974129533, | |
| "top": 555.8480470664147 | |
| }, | |
| "post_job_actions": { | |
| "RenameDatasetActionoutFileName": { | |
| "action_arguments": { | |
| "newname": "Average Normalized Coverage of all replicates" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outFileName" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "4a53856a5b85", | |
| "name": "deeptools_bigwig_average", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"yes\", \"__current_case__\": 1, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"skipNAs\": false, \"scaleFactors\": \"1\", \"blackListFileName\": {\"__class__\": \"RuntimeValue\"}}, \"bigwigs\": {\"__class__\": \"ConnectedValue\"}, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "3.5.4+galaxy0", | |
| "type": "tool", | |
| "uuid": "36059130-5f2a-4fe0-8b36-58073595fdd5", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "average_bigwig", | |
| "output_name": "outFileName", | |
| "uuid": "35dfdb8a-121d-41d1-9ad1-1e0d95a8ab8c" | |
| } | |
| ] | |
| }, | |
| "15": { | |
| "annotation": "", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 15, | |
| "input_connections": { | |
| "input1": { | |
| "id": 11, | |
| "output_name": "table" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert min value to text", | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "text_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 972, | |
| "top": 918.7 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| }, | |
| "HideDatasetActiontext_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "text_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "cdbee56b-9fff-4205-9cb6-741be770985d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "16": { | |
| "annotation": "get nb of rep as param", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 16, | |
| "input_connections": { | |
| "input1": { | |
| "id": 12, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": null, | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "integer_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 980.362829492841, | |
| "top": 1090.2503372993485 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "2ea49dca-270b-454a-9d86-6947799ab996", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "17": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/9.3+galaxy1", | |
| "errors": null, | |
| "id": 17, | |
| "input_connections": { | |
| "token_set_0|line": { | |
| "id": 15, | |
| "output_name": "text_param" | |
| }, | |
| "token_set_0|repeat_select|times": { | |
| "id": 16, | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "create a dataset with the min value as many times as there are replicates", | |
| "name": "Create text file", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "txt" | |
| } | |
| ], | |
| "position": { | |
| "left": 1210.95940032202, | |
| "top": 978.1979565079766 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutfile": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_text_file_with_recurring_lines/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"token_set\": [{\"__index__\": 0, \"line\": {\"__class__\": \"ConnectedValue\"}, \"repeat_select\": {\"repeat_select_opts\": \"user\", \"__current_case__\": 0, \"times\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "29ef7038-e10a-47cd-835f-945dccaf9c1c", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "18": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", | |
| "errors": null, | |
| "id": 18, | |
| "input_connections": { | |
| "split_parms|input": { | |
| "id": 17, | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool Split file", | |
| "name": "split_parms" | |
| } | |
| ], | |
| "label": "split min value", | |
| "name": "Split file", | |
| "outputs": [ | |
| { | |
| "name": "list_output_txt", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1454.946894305971, | |
| "top": 1074.616955921246 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionlist_output_txt": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "list_output_txt" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2", | |
| "tool_shed_repository": { | |
| "changeset_revision": "2dae863c8f42", | |
| "name": "split_file_to_collection", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"split_parms\": {\"select_ftype\": \"txt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}, \"select_mode\": {\"mode\": \"chunk\", \"__current_case__\": 0, \"chunksize\": \"1\"}, \"newfilenames\": \"split_file\", \"select_allocate\": {\"allocate\": \"byrow\", \"__current_case__\": 2}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.5.2", | |
| "type": "tool", | |
| "uuid": "7db836a5-793a-403e-8db1-b97f619f4c69", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "19": { | |
| "annotation": "", | |
| "content_id": "param_value_from_file", | |
| "errors": null, | |
| "id": 19, | |
| "input_connections": { | |
| "input1": { | |
| "id": 18, | |
| "output_name": "list_output_txt" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert min nb of reads to parameter", | |
| "name": "Parse parameter value", | |
| "outputs": [ | |
| { | |
| "name": "integer_param", | |
| "type": "expression.json" | |
| } | |
| ], | |
| "position": { | |
| "left": 1679.9454808872808, | |
| "top": 1066.2435805949858 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActioninteger_param": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "tool_id": "param_value_from_file", | |
| "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "0.1.0", | |
| "type": "tool", | |
| "uuid": "71b1c454-41db-4a8b-8595-8d3fa86a86a0", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "20": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "errors": null, | |
| "id": 20, | |
| "input_connections": { | |
| "input": { | |
| "id": 0, | |
| "output_name": "output" | |
| }, | |
| "mode|subsample_config|subsampling_mode|target": { | |
| "id": 19, | |
| "output_name": "integer_param" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "select random reads", | |
| "name": "Samtools view", | |
| "outputs": [ | |
| { | |
| "name": "outputsam", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1925.7976872167908, | |
| "top": 1061.3309439057557 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutputsam": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3", | |
| "tool_shed_repository": { | |
| "changeset_revision": "32dc5f781059", | |
| "name": "samtools_view", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"cond_expr\": {\"select_expr\": \"no\", \"__current_case__\": 0}, \"quality\": null, \"library\": null, \"cigarcons\": null, \"inclusive_filter\": null, \"exclusive_filter\": null, \"exclusive_filter_all\": null, \"tag\": null, \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"target\", \"__current_case__\": 1, \"target\": {\"__class__\": \"ConnectedValue\"}, \"seed\": \"1\"}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": false, \"adv_output\": {\"readtags\": [], \"collapsecigar\": false}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.20+galaxy3", | |
| "type": "tool", | |
| "uuid": "36713e3f-6110-41f7-8df1-9a9966400fab", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "21": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0", | |
| "errors": null, | |
| "id": 21, | |
| "input_connections": { | |
| "input": { | |
| "id": 20, | |
| "output_name": "outputsam" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "convert subsampled bam to bed", | |
| "name": "bedtools BAM to BED", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 1300.0284368938724, | |
| "top": 585.202166486144 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"\", \"split\": false, \"tag\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "7521eb4d-6cb9-463b-8c03-91ac64396ac3", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "22": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "errors": null, | |
| "id": 22, | |
| "input_connections": { | |
| "effective_genome_size_options|gsize": { | |
| "id": 2, | |
| "output_name": "output" | |
| }, | |
| "treatment|input_treatment_file": { | |
| "id": 21, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "effective_genome_size_options" | |
| }, | |
| { | |
| "description": "runtime parameter for tool MACS2 callpeak", | |
| "name": "treatment" | |
| } | |
| ], | |
| "label": "call peaks on merge", | |
| "name": "MACS2 callpeak", | |
| "outputs": [ | |
| { | |
| "name": "output_tabular", | |
| "type": "tabular" | |
| }, | |
| { | |
| "name": "output_narrowpeaks", | |
| "type": "bed" | |
| } | |
| ], | |
| "position": { | |
| "left": 1546.199951171875, | |
| "top": 605.2979025976546 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput_tabular": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_narrowpeaks": { | |
| "action_arguments": { | |
| "newname": "merged macs2 narrowPeaks" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "RenameDatasetActionoutput_tabular": { | |
| "action_arguments": { | |
| "newname": "merged macs2 tabular" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_tabular" | |
| }, | |
| "RenameDatasetActionoutput_treat_pileup": { | |
| "action_arguments": { | |
| "newname": "merged macs2 coverage normalized" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "output_treat_pileup" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86e2413cf3f8", | |
| "name": "macs2", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"advanced_options\": {\"to_large\": false, \"nolambda\": false, \"spmr\": true, \"ratio\": null, \"slocal\": null, \"llocal\": null, \"broad_options\": {\"broad_options_selector\": \"nobroad\", \"__current_case__\": 1, \"call_summits\": true}, \"keep_dup_options\": {\"keep_dup_options_selector\": \"all\", \"__current_case__\": 2}, \"d_min\": \"20\", \"buffer_size\": \"100000\"}, \"control\": {\"c_select\": \"No\", \"__current_case__\": 1}, \"cutoff_options\": {\"cutoff_options_selector\": \"qvalue\", \"__current_case__\": 1, \"qvalue\": \"0.05\"}, \"effective_genome_size_options\": {\"effective_genome_size_options_selector\": \"user_defined\", \"__current_case__\": 4, \"gsize\": {\"__class__\": \"ConnectedValue\"}}, \"format\": \"BED\", \"nomodel_type\": {\"nomodel_type_selector\": \"nomodel\", \"__current_case__\": 1, \"extsize\": \"200\", \"shift\": \"-100\"}, \"outputs\": [\"peaks_tabular\"], \"treatment\": {\"t_multi_select\": \"Yes\", \"__current_case__\": 1, \"input_treatment_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.2.9.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "e183ec20-d4ab-427a-9a0c-3e9bbced8793", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "merged_macs2_narrowPeaks", | |
| "output_name": "output_narrowpeaks", | |
| "uuid": "6d97d620-9486-4d85-9a80-e3595c0bb968" | |
| } | |
| ] | |
| }, | |
| "23": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0", | |
| "errors": null, | |
| "id": 23, | |
| "input_connections": { | |
| "inputA": { | |
| "id": 22, | |
| "output_name": "output_narrowpeaks" | |
| }, | |
| "reduce_or_iterate|inputB": { | |
| "id": 13, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [ | |
| { | |
| "description": "runtime parameter for tool bedtools Intersect intervals", | |
| "name": "reduce_or_iterate" | |
| } | |
| ], | |
| "label": "get merged peaks overlapping at least x replicates", | |
| "name": "bedtools Intersect intervals", | |
| "outputs": [ | |
| { | |
| "name": "output", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1643.5166015625, | |
| "top": 340.697927011717 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionoutput": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "output" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "64e2edfe7a2c", | |
| "name": "bedtools", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"bed\": false, \"count\": false, \"fraction_cond\": {\"fraction_select\": \"default\", \"__current_case__\": 0}, \"genome_file_opts\": {\"genome_file_opts_selector\": \"loc\", \"__current_case__\": 0, \"genome\": null}, \"header\": false, \"inputA\": {\"__class__\": \"ConnectedValue\"}, \"invert\": false, \"once\": false, \"overlap_mode\": [\"-wa\", \"-wb\"], \"reduce_or_iterate\": {\"reduce_or_iterate_selector\": \"iterate\", \"__current_case__\": 0, \"inputB\": {\"__class__\": \"ConnectedValue\"}}, \"sorted\": false, \"split\": false, \"strand\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "2.31.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "d6183a41-f78c-49fc-b826-f8aa95ff84cb", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "24": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "errors": null, | |
| "id": 24, | |
| "input_connections": { | |
| "results_0|software_cond|input": { | |
| "id": 7, | |
| "output_name": "output_tabular" | |
| }, | |
| "results_1|software_cond|input": { | |
| "id": 22, | |
| "output_name": "output_tabular" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "multiQC", | |
| "name": "MultiQC", | |
| "outputs": [ | |
| { | |
| "name": "html_report", | |
| "type": "html" | |
| }, | |
| { | |
| "name": "stats", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2329.32147475926, | |
| "top": 153.52074582627785 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionstats": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "stats" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0", | |
| "tool_shed_repository": { | |
| "changeset_revision": "f7e2f1eb3a16", | |
| "name": "multiqc", | |
| "owner": "iuc", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"macs2\", \"__current_case__\": 16, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": \"false\", \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.24.1+galaxy0", | |
| "type": "tool", | |
| "uuid": "f7d74248-16e3-4020-8156-caae0e7682ef", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "multiqc_output", | |
| "output_name": "html_report", | |
| "uuid": "a342a984-235e-4d40-9e09-d835aab35282" | |
| } | |
| ] | |
| }, | |
| "25": { | |
| "annotation": "", | |
| "content_id": "Filter1", | |
| "errors": null, | |
| "id": 25, | |
| "input_connections": { | |
| "input": { | |
| "id": 23, | |
| "output_name": "output" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "only keep peaks with summits overlapping intersection of at least x replicates", | |
| "name": "Filter", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 1874.401877544738, | |
| "top": 345.7312522070295 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Filter1", | |
| "tool_state": "{\"cond\": \"(c2+c10)>=c12 and (c2+c10)<c13\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.1.1", | |
| "type": "tool", | |
| "uuid": "dd65edce-c587-4e3f-9c08-408fe81c557e", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "26": { | |
| "annotation": "", | |
| "content_id": "Cut1", | |
| "errors": null, | |
| "id": 26, | |
| "input_connections": { | |
| "input": { | |
| "id": 25, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "keep only columns of narrowPeak", | |
| "name": "Cut", | |
| "outputs": [ | |
| { | |
| "name": "out_file1", | |
| "type": "tabular" | |
| } | |
| ], | |
| "position": { | |
| "left": 2104.095825078475, | |
| "top": 439.8305050651918 | |
| }, | |
| "post_job_actions": { | |
| "HideDatasetActionout_file1": { | |
| "action_arguments": {}, | |
| "action_type": "HideDatasetAction", | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "tool_id": "Cut1", | |
| "tool_state": "{\"columnList\": \"c1-c10\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "1.0.2", | |
| "type": "tool", | |
| "uuid": "6a58206f-a7b2-4f25-b837-b17185c86c52", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "27": { | |
| "annotation": "", | |
| "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1", | |
| "errors": null, | |
| "id": 27, | |
| "input_connections": { | |
| "infile": { | |
| "id": 26, | |
| "output_name": "out_file1" | |
| } | |
| }, | |
| "inputs": [], | |
| "label": "discard duplicated lines", | |
| "name": "Unique", | |
| "outputs": [ | |
| { | |
| "name": "outfile", | |
| "type": "input" | |
| } | |
| ], | |
| "position": { | |
| "left": 2336.462697917632, | |
| "top": 460.9788245160598 | |
| }, | |
| "post_job_actions": { | |
| "ChangeDatatypeActionoutfile": { | |
| "action_arguments": { | |
| "newtype": "bed" | |
| }, | |
| "action_type": "ChangeDatatypeAction", | |
| "output_name": "outfile" | |
| }, | |
| "RenameDatasetActionoutfile": { | |
| "action_arguments": { | |
| "newname": "narrowPeak shared by at least x replicates" | |
| }, | |
| "action_type": "RenameDatasetAction", | |
| "output_name": "outfile" | |
| } | |
| }, | |
| "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1", | |
| "tool_shed_repository": { | |
| "changeset_revision": "86755160afbf", | |
| "name": "text_processing", | |
| "owner": "bgruening", | |
| "tool_shed": "toolshed.g2.bx.psu.edu" | |
| }, | |
| "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"ignore_case\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"is_numeric\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", | |
| "tool_version": "9.3+galaxy1", | |
| "type": "tool", | |
| "uuid": "62a36e17-5aea-419d-835d-0fa33dd05e97", | |
| "when": null, | |
| "workflow_outputs": [ | |
| { | |
| "label": "shared_narrowPeak", | |
| "output_name": "outfile", | |
| "uuid": "47b85acb-10eb-454c-aa95-1253f223641d" | |
| } | |
| ] | |
| } | |
| }, | |
| "tags": [ | |
| "ATAC-seq" | |
| ], | |
| "uuid": "f58371cd-2e2d-41da-b1ca-ef10f7330047", | |
| "version": 13 | |
| }, | |
| "updated": "2024-12-03T18:32:53.980899", | |
| "readme": "# Consensus peaks Workflow\n\nThe goal of this workflow is to get a list of confident peaks with summits from n replicates.\n\n## Inputs dataset\n\n- The workflow needs a single input which is a list of datasets with n BAM where PCR duplicates have been removed (the workflow also works for nested list if you have multiple conditions each with multiple replicates).\n\n## Inputs values\n\n- Minimum number of overlap: Minimum number of replicates into which the final summit should be present.\n- effective_genome_size: this is used by MACS2 and may be entered manually (indications are provided for heavily used genomes).\n- bin_size: this is the bin sized used to compute the average of normalized profiles. Large values will allow to have a smaller output file but with less resolution while small values will increase computation time and size of the output file to produce a more resolutive bigwig.\n\n## Strategy summary\n\nHere is a generated example to highlight the strategy:\n\n\n## Processing\n\n- The workflow will:\n - first part:\n - call peaks and compute normalized coverage on each BAM individually\n - average normalized profiles\n - compute the intersection between all peaks and filter when at least x replicate overlaps\n - second part:\n - subset all BAM to get the same number of reads\n - call peaks on all subsetted BAM combined\n - finally, keep only peaks from the second part that have summits overlapping the filtered intersection of the first part.\n", | |
| "changelog": "# Changelog\n\n## [1.2] 2024-09-24\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.20+galaxy3`\n- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0`\n\n## [1.1] 2024-05-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.31.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.30.0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_multiintersectbed/2.31.1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/split_file_to_collection/split_file_to_collection/0.5.2`\n- `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.30.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_intersectbed/2.31.1+galaxy0`\n\n## [1.0] 2024-05-01\n\n### Changed\nThe workflow changed as it accepts now more than 2 replicates and has a new parameter to define what is the minimum number of replicates where the summit should be found.\nThe workflow for ATAC and CUT&RUN changed the input datatype as now a BAM is required instead of a BED.\n\n## [0.7] 2024-04-15\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n\n## [0.6] 2024-04-08\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy1`\n\n## [0.5] 2024-03-05\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/1.1.0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sorted_uniq/9.3+galaxy0`\n\n## [0.4] 2023-11-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2`\n\n## [0.3] 2023-11-27\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy2`\n\n## [0.2] 2023-11-10\n\n### Automatic update\n- `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0`\n- `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.2+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bigwig_average/deeptools_bigwig_average/3.5.4+galaxy0`\n\n## [0.1] 2023-08-31\nFirst release.\n", | |
| "diagrams": "# Workflow diagrams\n\n## Get Confident Peaks From ATAC or CUTandRUN replicates\n\n```mermaid\ngraph LR\n0[\"ℹ️ n rmDup BAM\"]@{ shape: docs }\n1[\"ℹ️ Minimum number of overlap\"]@{ shape: lean-l }\n2[\"ℹ️ effective_genome_size\"]@{ shape: lean-l }\n3[\"ℹ️ bin_size\"]@{ shape: lean-l }\n4[\"convert BAM to BED\"]@{ shape: process }\n0 --> 4\n5[\"count number of reads\"]@{ shape: process }\n0 --> 5\n6[\"generate filter rule\"]@{ shape: process }\n1 --> 6\n7[\"call peaks individually\"]@{ shape: process }\n2 --> 7\n4 --> 7\n8[\"put all nb of reads into single dataset\"]@{ shape: process }\n5 --> 8\n9[\"compute multi intersect\"]@{ shape: process }\n7 --> 9\n10[\"individual normalized bigwig\"]@{ shape: process }\n7 --> 10\n11[\"get min value\"]@{ shape: process }\n8 --> 11\n12[\"get nb of replicates\"]@{ shape: process }\n8 --> 12\n13[\"filter multi intersect\"]@{ shape: process }\n6 --> 13\n9 --> 13\n14[\"average coverage from replicates\"]@{ shape: process }\n3 --> 14\n10 --> 14\n15[\"convert min value to text\"]@{ shape: process }\n11 --> 15\n16[\"Parse parameter value\"]@{ shape: process }\n12 --> 16\n17[\"create a dataset with the min value as many times as there are replicates\"]@{ shape: process }\n15 --> 17\n16 --> 17\n18[\"split min value\"]@{ shape: process }\n17 --> 18\n19[\"convert min nb of reads to parameter\"]@{ shape: process }\n18 --> 19\n20[\"select random reads\"]@{ shape: process }\n0 --> 20\n19 --> 20\n21[\"convert subsampled bam to bed\"]@{ shape: process }\n20 --> 21\n22[\"call peaks on merge\"]@{ shape: process }\n2 --> 22\n21 --> 22\n23[\"get merged peaks overlapping at least x replicates\"]@{ shape: process }\n22 --> 23\n13 --> 23\n24[\"multiQC\"]@{ shape: process }\n7 --> 24\n22 --> 24\n25[\"only keep peaks with summits overlapping intersection of at least x replicates\"]@{ shape: process }\n23 --> 25\n26[\"keep only columns of narrowPeak\"]@{ shape: process }\n25 --> 26\n27[\"discard duplicated lines\"]@{ shape: process }\n26 --> 27\n```\n", | |
| "trsID": "#workflow/github.com/iwc-workflows/consensus-peaks/consensus-peaks-atac-cutandrun", | |
| "dockstore_id": 23499, | |
| "categories": [], | |
| "collections": [ | |
| "Epigenetics" | |
| ], | |
| "tests": [ | |
| { | |
| "doc": "Test for consensus-peaks-atac-cutandrun.ga", | |
| "job": { | |
| "n rmDup BAM": { | |
| "class": "Collection", | |
| "collection_type": "list", | |
| "elements": [ | |
| { | |
| "class": "File", | |
| "identifier": "rep1", | |
| "path": "test-data/rep1.bam", | |
| "dbkey": "mm10" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "rep2", | |
| "path": "test-data/rep2.bam", | |
| "dbkey": "mm10" | |
| }, | |
| { | |
| "class": "File", | |
| "identifier": "rep3", | |
| "path": "test-data/rep3.bam", | |
| "dbkey": "mm10" | |
| } | |
| ] | |
| }, | |
| "Minimum number of overlap": 2, | |
| "effective_genome_size": 1870000000, | |
| "bin_size": 50 | |
| }, | |
| "outputs": { | |
| "individual_macs2_narrowPeaks": { | |
| "element_tests": { | |
| "rep1": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 4 | |
| } | |
| } | |
| }, | |
| "rep2": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 6 | |
| } | |
| } | |
| }, | |
| "rep3": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 4 | |
| } | |
| } | |
| } | |
| } | |
| }, | |
| "average_bigwig": { | |
| "asserts": { | |
| "has_size": { | |
| "value": 1388, | |
| "delta": 100 | |
| } | |
| } | |
| }, | |
| "merged_macs2_narrowPeaks": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 8 | |
| } | |
| } | |
| }, | |
| "multiqc_output": { | |
| "asserts": { | |
| "has_text": { | |
| "text": "<span class=\"mqc_table_tooltip\" title=\"MACS2: Fragment Length\">Fragment Length</span>" | |
| } | |
| } | |
| }, | |
| "shared_narrowPeak": { | |
| "asserts": { | |
| "has_n_lines": { | |
| "n": 4 | |
| } | |
| } | |
| } | |
| } | |
| } | |
| ] | |
| } | |
| ], | |
| "path": "./workflows/epigenetics/consensus-peaks" | |
| }, | |
| { | |
| "version": 1.2, | |
| "workflows": [ | |
| { | |
| "name": "main", | |
| "subclass": "Galaxy", | |
| "publish": true, | |
| "primaryDescriptorPath": "/chipseq-pe.ga", | |
| "testParameterFiles": [ | |
| "/chipseq-pe-tests.yml" | |
| ], | |
| "authors": [ | |
| { | |
| "name": "Lucille Delisle", | |
| "orcid": "0000-0002-1964-4960" | |
| } | |
| ], | |
| "definition": { | |
| "a_galaxy_workflow": "true", | |
| "annotation": "This workflow takes as input a collection of paired fastqs. Remove adapters with cutadapt, map pairs with bowtie2. Keep MAPQ30 and concordant pairs. MACS2 for paired bam.", | |
| "creator": [ | |
| { | |
| "class": "Person", | |
| "identifier": "https://orcid.org/0000-0002-1964-4960", | |
| "name": "Lucille Delisle" | |
| } | |
| ], | |
| "format-version": "0.1", | |
| "license": "MIT", | |
| "release": "0.12", | |
| "name": "ChIPseq_PE", | |
| "steps": { | |
| "0": { | |
| "annotation": "Should be a paired collection with ChIPseq fastqs", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 0, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Should be a paired collection with ChIPseq fastqs", | |
| "name": "PE fastq input" | |
| } | |
| ], | |
| "label": "PE fastq input", | |
| "name": "Input dataset collection", | |
| "outputs": [], | |
| "position": { | |
| "left": 0, | |
| "top": 0 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"optional\": false, \"tag\": \"\", \"collection_type\": \"list:paired\"}", | |
| "tool_version": null, | |
| "type": "data_collection_input", | |
| "uuid": "e09c0852-1db3-4a68-b88c-1b94c205cb6c", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "1": { | |
| "annotation": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 1, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ", | |
| "name": "adapter_forward" | |
| } | |
| ], | |
| "label": "adapter_forward", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 11.01666259765625, | |
| "top": 93.5 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "30c1d867-5e73-4348-8969-848f58d94015", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "2": { | |
| "annotation": "Please use: For R2: - For Nextera: CTGTCTCTTATACACATCTGACGCTGCCGACGA - For TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 2, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "Please use: For R2: - For Nextera: CTGTCTCTTATACACATCTGACGCTGCCGACGA - For TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", | |
| "name": "adapter_reverse" | |
| } | |
| ], | |
| "label": "adapter_reverse", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
| "left": 50.066650390625, | |
| "top": 189.45001220703125 | |
| }, | |
| "tool_id": null, | |
| "tool_state": "{\"parameter_type\": \"text\", \"optional\": false}", | |
| "tool_version": null, | |
| "type": "parameter_input", | |
| "uuid": "ec244ede-8fa3-4d05-85a0-06839f4cf97d", | |
| "when": null, | |
| "workflow_outputs": [] | |
| }, | |
| "3": { | |
| "annotation": "reference_genome", | |
| "content_id": null, | |
| "errors": null, | |
| "id": 3, | |
| "input_connections": {}, | |
| "inputs": [ | |
| { | |
| "description": "reference_genome", | |
| "name": "reference_genome" | |
| } | |
| ], | |
| "label": "reference_genome", | |
| "name": "Input parameter", | |
| "outputs": [], | |
| "position": { | |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment