This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
function tsvJSON(tsv){ | |
var lines=tsv.split("\n"); | |
var result = []; | |
for(var i=0;i<lines.length;i++){ | |
var obj = {}; | |
var currentline=lines[i].split("\t"); | |
if(currentline.length>2){ | |
obj.gene = currentline[1].split(","); | |
if(currentline[0].indexOf('(GO:')>0){ | |
const startIndex = currentline[0].indexOf('(GO:'); |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"@context": [ | |
"http://schema.org", | |
"http://bioschemas.org/context.jsonld" | |
], | |
"@id": "http://www.alliancegenome.org/gene/ZFIN:ZDB-GENE-001103-2", | |
"@type": ["BioChemEntity", "Gene"], | |
"identifier": "ZFIN:ZDB-GENE-001103-2", | |
"version": "1.8", | |
"license": "CC BY 4.0", |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
```(; datasetFetch | |
(fn [dataset samples probes] | |
(fetch [{:table dataset | |
:columns probes | |
:samples samples}])) | |
"ccle/CCLE_DepMap_18Q2_maf_20180502" ["127399_SOFT_TISSUE" "22RV1_PROSTATE" "A204_SOFT_TISSUE" "A253_SALIVARY_GLAND" "A427_LUNG" "A431_SKIN" "A4FUK_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE" "A673_BONE" "ALLSIL_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE" "BICR16_UPPER_AERODIGESTIVE_TRACT" "BICR78_UPPER_AERODIGESTIVE_TRACT" "BIN67_OVARY" "BT12_SOFT_TISSUE" "BT16_SOFT_TISSUE" "C10_LARGE_INTESTINE" "C125PM_LARGE_INTESTINE" "C75_LARGE_INTESTINE" "C80_LARGE_INTESTINE" "C8166_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE" "C84_LARGE_INTESTINE" "C99_LARGE_INTESTINE" "CADOES1_BONE" "CAKI2_KIDNEY" "CALU1_LUNG" "CCFSTTG1_CENTRAL_NERVOUS_SYSTEM" "CHLA06ATRT_SOFT_TISSUE" "CHLA15_AUTONOMIC_GANGLIA" "CHLA218_BONE" "CHLA258_BONE" "CHLA266_SOFT_TISSUE" "CHLA32_BONE" "CHLA57_BONE" "CHLA99_BONE" "CHLA9_BONE" "CL11_LARGE_INTESTINE" "CME1_SOFT_TISSUE" "COGAR359_SOFT_TISSUE" "COGE352_BONE" "COGN278_AUTONOMIC_GANGLIA" "COGN3 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<html> | |
<head> | |
<title>JBrowse - Retrieve data outside of browser</title> | |
<link rel="stylesheet" type="text/css" href="css/genome.css"> | |
<script type="text/javascript" src="src/dojo/dojo.js" data-dojo-config="async: 1, baseUrl: './src'"></script> | |
<script type="text/javascript" src="src/JBrowse/init.js"></script> | |
<style> | |
pre { | |
white-space: pre-wrap; |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<html> | |
<head> | |
<title>JBrowse - Retrieve data outside of browser</title> | |
<link rel="stylesheet" type="text/css" href="css/genome.css"> | |
<script type="text/javascript" src="src/dojo/dojo.js" data-dojo-config="async: 1, baseUrl: './src'"></script> | |
<script type="text/javascript" src="src/JBrowse/init.js"></script> | |
<style> | |
pre { | |
white-space: pre-wrap; |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<html> | |
<head> | |
<title>JBrowse feature rendering outside of browser</title> | |
<link rel="stylesheet" type="text/css" href="css/genome.css"> | |
<script type="text/javascript" src="src/dojo/dojo.js" data-dojo-config="async: 1, baseUrl: './src'"></script> | |
<script type="text/javascript" src="src/JBrowse/init.js"></script> | |
<script> | |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<!DOCTYPE html> | |
<html> | |
<head> | |
<title>JBrowse - Retrieve data outside of browser</title> | |
<meta content="text/html;charset=utf-8" http-equiv="Content-Type"> | |
<link rel="stylesheet" type="text/css" href="css/genome.css"> | |
<script type="text/javascript" src="src/dojo/dojo.js" data-dojo-config="async: 1, baseUrl: './src'"></script> | |
<script type="text/javascript" src="src/JBrowse/init.js"></script> | |
<style> | |
pre { |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from selenium import webdriver | |
from selenium.webdriver.common.by import By | |
from selenium.webdriver.support.ui import WebDriverWait | |
from selenium.webdriver.support import expected_conditions as EC | |
import cv2 | |
url = 'https://genome.monarchinitiative.org/apollo/Honeybee/jbrowse/index.html?loc=Group1.1%3A724016..726600&tracklist=0&nav=0&tracks=Official%20Gene%20Set%20v3.2&highlight=' | |
driver = webdriver.Chrome() | |
driver.get(url) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Frame 1 longest: | |
TCCGGAACAACGAAGATGAGATGGGATGCCGCTCTATATCTACTCTCGCTGCTGCTCTTCTCGTTGGCCAATCTGTGTTGGGCTCTCGTCGAAACGCGAGGATGCAATCGCACTATCAGAAATTCCGTTGGATGGATACGTTGGACAGGACGAATGGGACGATGCATTGTTCGCATCAGAGCGCCTCCTAGAGATCCTCAGGTGATCGAGTTGAAAGTTAGGAAACTGCAAGTTGGTTTCCTGAAAGAAACCAGATGCGAGGGTGCTTACATTCAATTTTCCGATGGTAGCGAGGACCTTGAAGATGAAACGGGACGTTACTGCGGCTATGTAAGCGGCAACACGACCAGACTGTTCCTGAGAAAGGGACCCAATTTGACGATCATAATGGACTCGGACGTGAGGTTCGCAGCCGAGAATCCCGTGATATTCTCCGCCCAGTTCTCCATACTTCCCGCCCAGCTCGCGTCCGAGCGTCACCGCGGCTTCTCCCCGTCCCCCTCGTCCGAGTGTCCCCTCGAGTGCGCCGTGAGGAACGAGCGAAGATCCTGCAAATTGTCCTCGCCCGGCTACCCGGGCGTCTACCCCCGCGGGATCAAGTGCAGGATAGGGTTGGAGTCGGGCGCCGGCCGATTCAAGATCGGCGGCCAACCGGACGACACTTACGATCTGATGAATCGCACGTGGCAGGAGGGTTGCCAGACCGAGAATTGCGAGGACCACGTGGAGGGGATGGTCGCGGAATTGCGGAGGGCGAGGGTCGAGCCGGGGGACGCGGGGAGGCGCGGGAAGAGGAGCCCGGAGGACCGCGAGGAGGAGGTGGAGTTTATCATCGGGCAGACGTCGTACAGGGGGGGTAGGAATGGTCGGAGGAGGCTTAAGAAGGGGAGGAAGGATGCCGGGAGCGAGGATATCCGGAGAGGAAACATCGGCCGGGCGAAGGGGGGTGGGGAGGGAGGAGAGTCGTTGGCCGGTTATCGGGGGGGCCAGGGGATCAGGTGGCGGG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
package apollo.datamodel; | |
import java.lang.Integer; | |
import java.util.*; | |
import javax.swing.JOptionPane; | |
import apollo.util.SeqFeatureUtil; | |
import apollo.util.FeatureList; | |
import apollo.util.QuickSort; |
NewerOlder