Last active
December 10, 2020 16:13
-
-
Save oeway/ac0f5553f6c497aa08d2547aa6ffd4d8 to your computer and use it in GitHub Desktop.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <config lang="json"> | |
| { | |
| "name": "ImJoyGridDemo", | |
| "type": "native-python", | |
| "editor_height": "400px", | |
| "lang": "python", | |
| "api_version": "0.1.8", | |
| "description": "A demo plugin to show case ImJoy Grid with vizarr, folder tree and schema form.", | |
| "tags": [], | |
| "version": "0.1.1", | |
| "ui": "", | |
| "cover": "", | |
| "icon": "extension", | |
| "inputs": null, | |
| "outputs": null, | |
| "env": "", | |
| "permissions": [], | |
| "requirements": [], | |
| "dependencies": [] | |
| } | |
| </config> | |
| <script lang="python"> | |
| from imjoy import api | |
| class ImJoyPlugin(): | |
| async def setup(self): | |
| pass | |
| async def add_image_viewer(self, grid): | |
| # create a window | |
| self.viewer = await grid.createWindow(src="https://hms-dbmi.github.io/vizarr", w=7,h=4, x=3, y=0, hide_title_bar=True, menu_button_location="upper-right") | |
| async def on_image_click(info): | |
| api.alert(info) | |
| self.viewer.add_image({"source": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/4495402.zarr", "name": "idr0053"}) | |
| async def add_file_tree(self, grid): | |
| # images are from OME: https://blog.openmicroscopy.org/file-formats/community/2020/11/04/zarr-data/ | |
| sources = { | |
| "idr0053": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/4495402.zarr", | |
| "idr0062": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/6001240.zarr", | |
| "idr0062-1": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/6001240.zarr", | |
| "idr0062-2": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/6001241.zarr", | |
| "idr0062-3": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/6001243.zarr", | |
| "idr0077": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/9836839.zarr" | |
| } | |
| async def node_dbclick_callback(node): | |
| self.viewer.add_image({"source": sources[node['title']], "name": node['title']}) | |
| await grid.createWindow(type="imjoy/tree", w=3, x=0, y=0, h=2, hide_title_bar=True, config={ | |
| "_rintf": True, | |
| "type": "tree", | |
| "name": "Example Zarr Files", | |
| "node_dbclick_callback": node_dbclick_callback, | |
| "nodes": [ | |
| {"title": 'idr0077', "isLeaf": True}, | |
| {"title": 'idr0053', "isLeaf": True}, | |
| {"title": 'idr0062', "isExpanded": True, | |
| "children": [ | |
| {"title": 'idr0062-1', "isLeaf": True}, | |
| {"title": 'idr0062-2', "isLeaf": True}, | |
| {"title": 'idr0062-3', "isLeaf": True}, | |
| ] | |
| } | |
| ], | |
| }) | |
| async def add_schema_form(self, grid): | |
| schemaio = await grid.createWindow(name='DeepBindScan', type='imjoy/schema-io', w=3, x=0, y=2, h=2, hide_title_bar=True,data={}) | |
| # prepare a schema for the form | |
| schema = { | |
| "fields": [ | |
| { | |
| "type": "select", | |
| "label": "Model Type", | |
| "model": "modelType", | |
| "values": ["all species", "Homo_sapiens", "Danio_rerio"] | |
| }, | |
| { | |
| "type": "input", | |
| "inputType": "text", | |
| "label": "Input Sequence", | |
| "model": "DNA" | |
| } | |
| ] | |
| } | |
| # prepare a callback function | |
| async def callback(results): | |
| await api.alert(str(results)) | |
| # generate the form | |
| await schemaio.append({ | |
| "type": "form", | |
| "schema": schema, | |
| "model": { | |
| "DNA": "GGAGGCGGGAAGATGGAGGCGGTAGCTGTCACTAGGTTGGGGTTCTCC", | |
| "modelType": "all species" | |
| }, | |
| "callback": callback, | |
| "id": 0, | |
| "_rintf": True | |
| }) | |
| async def run(self, ctx): | |
| # create a grid container | |
| grid = await api.createWindow(src="https://grid.imjoy.io/#/app", config={"verticalCompact": False, "colNum": 10, "rowHeight": 120}) | |
| await self.add_image_viewer(grid) | |
| await self.add_file_tree(grid) | |
| await self.add_schema_form(grid) | |
| api.export(ImJoyPlugin()) | |
| </script> |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment