Skip to content

Instantly share code, notes, and snippets.

@oeway
Last active December 10, 2020 16:13
Show Gist options
  • Select an option

  • Save oeway/ac0f5553f6c497aa08d2547aa6ffd4d8 to your computer and use it in GitHub Desktop.

Select an option

Save oeway/ac0f5553f6c497aa08d2547aa6ffd4d8 to your computer and use it in GitHub Desktop.
<config lang="json">
{
"name": "ImJoyGridDemo",
"type": "native-python",
"editor_height": "400px",
"lang": "python",
"api_version": "0.1.8",
"description": "A demo plugin to show case ImJoy Grid with vizarr, folder tree and schema form.",
"tags": [],
"version": "0.1.1",
"ui": "",
"cover": "",
"icon": "extension",
"inputs": null,
"outputs": null,
"env": "",
"permissions": [],
"requirements": [],
"dependencies": []
}
</config>
<script lang="python">
from imjoy import api
class ImJoyPlugin():
async def setup(self):
pass
async def add_image_viewer(self, grid):
# create a window
self.viewer = await grid.createWindow(src="https://hms-dbmi.github.io/vizarr", w=7,h=4, x=3, y=0, hide_title_bar=True, menu_button_location="upper-right")
async def on_image_click(info):
api.alert(info)
self.viewer.add_image({"source": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/4495402.zarr", "name": "idr0053"})
async def add_file_tree(self, grid):
# images are from OME: https://blog.openmicroscopy.org/file-formats/community/2020/11/04/zarr-data/
sources = {
"idr0053": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/4495402.zarr",
"idr0062": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/6001240.zarr",
"idr0062-1": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/6001240.zarr",
"idr0062-2": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/6001241.zarr",
"idr0062-3": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/6001243.zarr",
"idr0077": "https://s3.embassy.ebi.ac.uk/idr/zarr/v0.1/9836839.zarr"
}
async def node_dbclick_callback(node):
self.viewer.add_image({"source": sources[node['title']], "name": node['title']})
await grid.createWindow(type="imjoy/tree", w=3, x=0, y=0, h=2, hide_title_bar=True, config={
"_rintf": True,
"type": "tree",
"name": "Example Zarr Files",
"node_dbclick_callback": node_dbclick_callback,
"nodes": [
{"title": 'idr0077', "isLeaf": True},
{"title": 'idr0053', "isLeaf": True},
{"title": 'idr0062', "isExpanded": True,
"children": [
{"title": 'idr0062-1', "isLeaf": True},
{"title": 'idr0062-2', "isLeaf": True},
{"title": 'idr0062-3', "isLeaf": True},
]
}
],
})
async def add_schema_form(self, grid):
schemaio = await grid.createWindow(name='DeepBindScan', type='imjoy/schema-io', w=3, x=0, y=2, h=2, hide_title_bar=True,data={})
# prepare a schema for the form
schema = {
"fields": [
{
"type": "select",
"label": "Model Type",
"model": "modelType",
"values": ["all species", "Homo_sapiens", "Danio_rerio"]
},
{
"type": "input",
"inputType": "text",
"label": "Input Sequence",
"model": "DNA"
}
]
}
# prepare a callback function
async def callback(results):
await api.alert(str(results))
# generate the form
await schemaio.append({
"type": "form",
"schema": schema,
"model": {
"DNA": "GGAGGCGGGAAGATGGAGGCGGTAGCTGTCACTAGGTTGGGGTTCTCC",
"modelType": "all species"
},
"callback": callback,
"id": 0,
"_rintf": True
})
async def run(self, ctx):
# create a grid container
grid = await api.createWindow(src="https://grid.imjoy.io/#/app", config={"verticalCompact": False, "colNum": 10, "rowHeight": 120})
await self.add_image_viewer(grid)
await self.add_file_tree(grid)
await self.add_schema_form(grid)
api.export(ImJoyPlugin())
</script>
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment