Skip to content

Instantly share code, notes, and snippets.

@peterk87
Created April 26, 2013 17:39
Show Gist options
  • Select an option

  • Save peterk87/5468959 to your computer and use it in GitHub Desktop.

Select an option

Save peterk87/5468959 to your computer and use it in GitHub Desktop.
bibtex: Massive bibliography used in MSc thesis
@article{olson_limited_2007,
title = {Limited genetic diversity in \emph{{Salmonella enterica}} Serovar {Enteritidis} {PT13}},
volume = {7},
copyright = {2007 Olson et al; licensee {BioMed} Central Ltd.},
issn = {1471-2180},
url = {http://www.biomedcentral.com/1471-2180/7/87/abstract},
doi = {10.1186/1471-2180-7-87},
abstract = {Salmonella enterica serovar Enteritidis has emerged as a significant foodborne pathogen throughout the world and is commonly characterized by phage typing. In Canada phage types ({PT)} 4, 8 and 13 predominate and in 2005 a large foodborne {PT13} outbreak occurred in the province of Ontario. The ability to link strains during this outbreak was difficult due to the apparent clonality of {PT13} isolates in Canada, as there was a single dominant pulsed-field gel electrophoresis ({PFGE)} profile amongst epidemiologically linked human and food isolates as well as concurrent sporadic strains. The aim of this study was to perform comparative genomic hybridization ({CGH)}, {DNA} sequence-based typing ({SBT)} genomic analyses, plasmid analyses, and automated repetitive sequence-based {PCR} (rep-{PCR)} to identify epidemiologically significant traits capable of subtyping S. Enteritidis {PT13.}},
language = {en},
number = {1},
urldate = {2013-03-25},
journal = {{BMC} Microbiology},
author = {Olson, Adam B. and Andrysiak, Ashleigh K. and Tracz, Dobryan M. and Guard-Bouldin, Jean and Demczuk, Walter and Ng, Lai-King and Maki, Anne and Jamieson, Frances and Gilmour, Matthew W.},
month = oct,
year = {2007},
note = {{PMID:} 17908316},
pages = {87},
file = {Snapshot:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\3lapjt2a.default\zotero\storage\ACK4DESP\87.html:text/html}
},
@article{campioni_genetic_2012,
title = {Genetic diversity, virulence genes and antimicrobial resistance of \emph{{Salmonella}} Enteritidis isolated from food and humans over a 24-year period in {Brazil}},
volume = {32},
issn = {1095-9998},
doi = {10.1016/j.fm.2012.06.008},
abstract = {Salmonellosis is a major health problem worldwide. Serovar Enteritidis has been a primary cause of Salmonella outbreaks in many countries. In Brazil, few molecular typing studies have been performed. The aims of this study were to molecularly type Salmonella Enteritidis strains isolated in Brazil in order to determine the genetic relationship between strains of food and human origin, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 128 S. Enteritidis strains isolated from human feces (67) and food (61) between 1986 and 2010 were studied. The genotypic diversity was assessed by {ERIC-PCR} and {PFGE} using {XbaI}, the antimicrobial resistance by the disc-diffusion assay and the presence of the {SPI-1}, {SPI-2} and {pSTV} virulence genes assessed by {PCR.} The {ERIC-PCR} results revealed that 112 strains exhibited a similarity of {\textgreater}85.4\% and the {PFGE} that 96 strains exhibited a similarity of {\textgreater}80.0\%. Almost all strains (97.6\%) harbored all 13 virulence genes investigated. Thirty-six strains (28.12\%) were resistant to nalidixic acid. In conclusion, the nalidixic acid resistance observed after 1996 is indicative of an increase in the use of this drug. It may be suggested that these 128 strains might have descended from a common ancestor that differed little over 24 years and has been both contaminating food and humans and causing disease for more than two decades in Brazil.},
number = {2},
journal = {Food Microbiology},
author = {Campioni, Fábio and Moratto Bergamini, Alzira Maria and Falc\~ao, Juliana P},
month = dec,
year = {2012},
note = {{PMID:} 22986188},
keywords = {Animals, Anti-Bacterial Agents, Bacterial Proteins, Brazil, Chickens, Drug Resistance, Multiple, Bacterial, Feces, Food Microbiology, Genetic Variation, Humans, Microbial Sensitivity Tests, Molecular Sequence Data, Phylogeny, Salmonella enteritidis, Salmonella Infections, Virulence Factors},
pages = {254--264}
}
@article{silbert_improving_2003,
title = {Improving typeability of multiple bacterial species using pulsed-field gel electrophoresis and thiourea},
volume = {47},
issn = {0732-8893},
abstract = {Although pulsed-field gel electrophoresis is considered the "gold standard" technique for molecular typing, typeability may not be excellent for some bacterial species because of {DNA} degradation. Previous reports suggest that the addition of thiourea in the gel buffer can improved the typeability for some species. In the present study, 66 Gram-negative strains (seven species) known to be affected by {DNA} degradation and four control strains were evaluated by {PFGE} with and without the addition of 50 {microg/M} of thiourea to the buffer used in the electrophoresis. Macrorestriction patterns were obtained for all K. pneumoniae, S. marcescens, P. aeruginosa, and Salmonella spp., for 95.4\% of E. coli, and for 50\% of E. cloacae strains from the gels performed in the buffer with throurea. However, typeability was not improved for Acinetobacter spp. The range of non-typeable species for which thiourea can limit the problem of {DNA} degradation is considerably wider than described in previous publications.},
number = {4},
journal = {Diagnostic Microbiology and Infectious Disease},
author = {Silbert, Suzane and Boyken, Linda and Hollis, Richard J and Pfaller, Michael A},
month = dec,
year = {2003},
note = {{PMID:} 14711485},
keywords = {Bacterial Typing Techniques, {DNA}, Bacterial, Electrophoresis, Gel, Pulsed-Field, Gram-Positive Bacteria, Humans, Sampling Studies, Sensitivity and Specificity, Thiourea},
pages = {619--621}
}
% Kruczkiewicz P., Tudor A., Mutschall S. K., Buchanan C. J., Laing C. R., Thomas J. E., Gannon V. P., Clark C. G., Carrillo C. D., Taboada E. N. (2011). “A bioinformatics toolkit for comparative genomic analysis of Campylobacter jejuni in support of next-generation genotyping methods design,” in 16th International Workshop on Campylobacter, Helicobacter and Related Organisms, Vancouver.
@misc{kruczkiewicz_toolkit_2011,
title = {A bioinformatics toolkit for comparative genomic analysis of \emph{{Campylobacter jejuni}} in support of next-generation genotyping methods design},
author = {Kruczkiewicz, P. and Tudor, A. and Mutschall, S. K. and Buchanan, C. J. and Laing, C. R. and Thomas, J. E. and Gannon, V. P. and Clark, C. G. and Carrillo, C. D. and Taboada, E. N.},
year = {2011},
month = {September},
howpublished = {16th International Workshop on Campylobacter, Helicobacter and Related Organisms (CHRO; poster)},
location = {Vancouver, BC, CA}
}
@article{kruczkiewicz_mist,
title = {{MIST}: a tool for rapid \emph{in silico} generation of molecular data from bacterial genome sequences},
author = {Kruczkiewicz, Peter and Mutschall, Steven and Barker, Dillon and Thomas, James and Van Domselaar, Gary and Gannon, Victor P.J. and Carrillo, Catherine D. and Taboada, Eduardo N.},
year = {2013},
location = {Barcelona, Spain},
pages = {316--323},
isbn = {978-989-8565-35-8},
publisher = {SCITEPRESS},
journal = {Proceedings of Bioinformatics 2013: 4th International Conference on Bioinformatics Models, Methods and Algorithms}
}
@article{schlech_epidemic_1983,
title = {Epidemic Listeriosis — Evidence for Transmission by Food},
volume = {308},
url = {http://www.nejm.org/doi/full/10.1056/NEJM198301273080407},
doi = {10.1056/NEJM198301273080407},
number = {4},
journal = {New England Journal of Medicine},
author = {Schlech, Walter F. and Lavigne, Pierre M. and Bortolussi, Robert A. and Allen, Alexander C. and Haldane, E. Vanora and Wort, A. John and Hightower, Allen W. and Johnson, Scott E. and King, Stanley H. and Nicholls, Eric S. and Broome, Claire V.},
year = {1983},
pages = {203--206}
}
@article{edman_listeria_1968,
title = {Listeria monocytogenes L Forms I. Induction, Maintenance, and Biological Characteristics},
volume = {96},
issn = {0021-9193, 1098-5530},
url = {http://jb.asm.org/content/96/2/352},
abstract = {L forms were induced from 15 of 16 strains of Listeria monocytogenes on penicillin gradient plates incubated under aerobic conditions. The culture medium for maintenance of these L forms must contain an electrolyte in a concentration of 1\% or sucrose in a concentration of 10\%. The electrolytes {NaCl}, {KCl}, or {MgSO4} were used in both induction and maintenance media. Induction of L forms occurred more rapidly on media containing {KCl.} Listeria L forms had the same fermentation reactions as the parent bacterium. The L-form growth in liquid medium was slow, not extensive, and appeared as clumps on the bottom of culture tubes. The morphology of Listeria L forms was similar to that reported for other bacterial L forms. The L forms derived from strain 10403, serotype 1, were stable after two or more passages on penicillin media. They did not revert to the bacterial form after 40 subcultures on penicillin-free media. Some L-form colonies derived from strain 10403 did revert to the bacterial form when transferred directly from induction plates to penicillin-free media. Studies of the growth characteristics for L forms derived from strain 10403 gave the following results: an optimal temperature of 30 C, high electrolyte or sucrose concentration necessary for induction and maintenance, and no requirement for serum.},
language = {en},
number = {2},
urldate = {2012-12-14},
journal = {Journal of Bacteriology},
author = {Edman, David C. and Pollock, Mary B. and Hall, Elizabeth R.},
month = aug,
year = {1968},
pages = {352--357},
file = {Full Text PDF:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\3lapjt2a.default\zotero\storage\A95IE7PF\Edman et al. - 1968 - Listeria monocytogenes L Forms I. Induction, Maint.pdf:application/pdf;Snapshot:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\3lapjt2a.default\zotero\storage\GCQRD7GK\352.html:text/html}
}
@article{nightingale_listeria_2007,
title = {\emph{{Listeria monocytogenes}} {F2365} carries several authentic mutations potentially leading to truncated gene products, including {inlB}, and demonstrates atypical phenotypic characteristics},
volume = {70},
issn = {0362-{028X}},
abstract = {Searches of the genome annotation of Listeria monocytogenes F2365, an isolate from the 1985 listeriosis epidemic in California, showed that this strain carries 20 authentic mutations resulting in premature stop codons, including a nonsense mutation in {inlB.} Here we showed that L. monocytogenes F2365 demonstrates atypical virulence-associated characteristics, including significantly {(P} \{\textless\} 0.05) reduced invasion efficiency in Caco-2 cells as compared with a closely related lineage I serotype 4b strain as well as significantly {(P} \{\textless\} 0.05) greater variation in invasiveness when grown under different conditions compared with standard laboratory control and other lineage I serotype 4b strains. In addition, L. monocytogenes F2365 demonstrated distinct growth characteristics, including a significantly {(P} \{\textless\} 0.05) reduced exponential growth rate when compared with laboratory control and other lineage I serotype 4b outbreak-associated strains as well as a significantly {(P} \{\textless\} 0.05) longer lag phase duration time compared with another lineage I serotype 4b strain. Our results support that L. monocytogenes F2365 is characterized by genotypic and phenotypic properties that are atypical of other L. monocytogenes strains.},
number = {2},
journal = {Journal of Food Protection},
author = {Nightingale, K K and Milillo, S R and Ivy, R A and Ho, A J and Oliver, H F and Wiedmann, M},
month = feb,
year = {2007},
note = {{PMID:} 17340887},
keywords = {Caco-2 Cells, Codon, Nonsense, Codon, Terminator, Disease Outbreaks, Food Microbiology, Genes, Bacterial, Genome, Bacterial, Genotype, Humans, Listeria monocytogenes, Phenotype, Salmonella Food Poisoning, Species Specificity},
pages = {482--488}
}
@article{laksanalamai_genomic_2012,
title = {Genomic Characterization of \emph{{Listeria monocytogenes}} Strains Involved in a Multistate Listeriosis Outbreak Associated with Cantaloupe in {US}},
volume = {7},
url = {http://dx.doi.org/10.1371/journal.pone.0042448},
doi = {10.1371/journal.pone.0042448},
abstract = {A multistate listeriosis outbreak associated with cantaloupe consumption was reported in the United States in September, 2011. The outbreak investigation recorded a total of 146 invasive illnesses, 30 deaths and one miscarriage. Subtyping of the outbreak associated clinical, food and environmental isolates revealed two serotypes (1/2a and 1/2b) and four pulsed-field gel electrophoresis two-enzyme pattern combinations I, {II}, {III}, and {IV}, including one rarely seen before this outbreak. A {DNA-microarray}, Listeria {GeneChip®}, developed by {FDA} from 24 Listeria monocytogenes genome sequences, was used to further characterize a representative sample of the outbreak isolates. The microarray data (in the form of present or absent calls of specific {DNA} sequences) separated the isolates into two distinct groups as per their serotypes. The gene content of the outbreak-associated isolates was distinct from that of the previously-reported outbreak strains belonging to the same serotypes. Although the 1/2b outbreak associated isolates are closely related to each other, the 1/2a isolates could be further divided into two distinct genomic groups, one represented by pattern combination I strains and the other represented by highly similar pattern combinations {III} and {IV} strains. Gene content analysis of these groups revealed unique genomic sequences associated with these two 1/2a genovars. This work underscores the utility of multiple approaches, such as serotyping, {PFGE} and {DNA} microarray analysis to characterize the composition of complex polyclonal listeriosis outbreaks.},
number = {7},
urldate = {2012-09-05},
journal = {{PLoS} {ONE}},
author = {Laksanalamai, Pongpan and Joseph, Lavin A. and Silk, Benjamin J. and Burall, Laurel S. and L. Tarr, Cheryl and Gerner-Smidt, Peter and Datta, Atin R.},
month = jul,
year = {2012},
pages = {e42448},
file = {PLoS Full Text PDF:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\w7cp5xk2.default\zotero\storage\6T49XPMR\Laksanalamai et al. - 2012 - Genomic Characterization of Listeria monocytogenes.pdf:application/pdf}
}
@article{koser_rapid_2012,
title = {Rapid whole-genome sequencing for investigation of a neonatal {MRSA} outbreak},
volume = {366},
issn = {1533-4406},
url = {http://www.ncbi.nlm.nih.gov/pubmed/22693998},
doi = {10.1056/NEJMoa1109910},
abstract = {{BACKGROUND}
Isolates of methicillin-resistant Staphylococcus aureus {(MRSA)} belonging to a single lineage are often indistinguishable by means of current typing techniques. Whole-genome sequencing may provide improved resolution to define transmission pathways and characterize outbreaks.
{METHODS}
We investigated a putative {MRSA} outbreak in a neonatal intensive care unit. By using rapid high-throughput sequencing technology with a clinically relevant turnaround time, we retrospectively sequenced the {DNA} from seven isolates associated with the outbreak and another seven {MRSA} isolates associated with carriage of {MRSA} or bacteremia in the same hospital.
{RESULTS}
We constructed a phylogenetic tree by comparing single-nucleotide polymorphisms {(SNPs)} in the core genome to a reference genome (an epidemic {MRSA} clone, {EMRSA-15} [sequence type 22]). This revealed a distinct cluster of outbreak isolates and clear separation between these and the nonoutbreak isolates. A previously missed transmission event was detected between two patients with bacteremia who were not part of the outbreak. We created an artificial "resistome" of antibiotic-resistance genes and demonstrated concordance between it and the results of phenotypic susceptibility testing; we also created a "toxome" consisting of toxin genes. One outbreak isolate had a hypermutator phenotype with a higher number of {SNPs} than the other outbreak isolates, highlighting the difficulty of imposing a simple threshold for the number of {SNPs} between isolates to decide whether they are part of a recent transmission chain.
{CONCLUSIONS}
Whole-genome sequencing can provide clinically relevant data within a time frame that can influence patient care. The need for automated data interpretation and the provision of clinically meaningful reports represent hurdles to clinical implementation. {(Funded} by the {U.K.} Clinical Research Collaboration Translational Infection Research Initiative and others.).},
number = {24},
urldate = {2012-09-26},
journal = {The New England Journal of Medicine},
author = {K\"oser, Claudio U and Holden, Matthew T G and Ellington, Matthew J and Cartwright, Edward J P and Brown, Nicholas M and Ogilvy-Stuart, Amanda L and Hsu, Li Yang and Chewapreecha, Claire and Croucher, Nicholas J and Harris, Simon R and Sanders, Mandy and Enright, Mark C and Dougan, Gordon and Bentley, Stephen D and Parkhill, Julian and Fraser, Louise J and Betley, Jason R and Schulz-Trieglaff, Ole B and Smith, Geoffrey P and Peacock, Sharon J},
month = jun,
year = {2012},
note = {{PMID:} 22693998},
keywords = {Bacteremia, Cross Infection, Disease Outbreaks, {DNA}, Bacterial, Genome, Bacterial, Humans, Infant, Newborn, Intensive Care Units, Neonatal, Methicillin Resistance, Methicillin-Resistant Staphylococcus aureus, Microbial Sensitivity Tests, Phenotype, Phylogeny, Polymorphism, Single Nucleotide, Retrospective Studies, Sequence Analysis, {DNA}, Staphylococcal Infections},
pages = {2267--2275},
file = {ProQuestDocuments-2012-09-26.html:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\w7cp5xk2.default\zotero\storage\EMTEUNTT\ProQuestDocuments-2012-09-26.html:text/html}
}
@article{gardy_tuberculosis_2011,
title = {Whole-genome sequencing and social-network analysis of a tuberculosis outbreak},
volume = {364},
issn = {1533-4406},
url = {http://www.ncbi.nlm.nih.gov/pubmed/21345102},
doi = {10.1056/NEJMoa1003176},
abstract = {{BACKGROUND}
An outbreak of tuberculosis occurred over a 3-year period in a medium-size community in British Columbia, Canada. The results of mycobacterial interspersed repetitive unit-variable-number tandem-repeat {(MIRU-VNTR)} genotyping suggested the outbreak was clonal. Traditional contact tracing did not identify a source. We used whole-genome sequencing and social-network analysis in an effort to describe the outbreak dynamics at a higher resolution.
{METHODS}
We sequenced the complete genomes of 32 Mycobacterium tuberculosis outbreak isolates and 4 historical isolates (from the same region but sampled before the outbreak) with matching genotypes, using short-read sequencing. Epidemiologic and genomic data were overlaid on a social network constructed by means of interviews with patients to determine the origins and transmission dynamics of the outbreak.
{RESULTS}
Whole-genome data revealed two genetically distinct lineages of M. tuberculosis with identical {MIRU-VNTR} genotypes, suggesting two concomitant outbreaks. Integration of social-network and phylogenetic analyses revealed several transmission events, including those involving "superspreaders." Both lineages descended from a common ancestor and had been detected in the community before the outbreak, suggesting a social, rather than genetic, trigger. Further epidemiologic investigation revealed that the onset of the outbreak coincided with a recorded increase in crack cocaine use in the community.
{CONCLUSIONS}
Through integration of large-scale bacterial whole-genome sequencing and social-network analysis, we show that a socioenvironmental factor--most likely increased crack cocaine use--triggered the simultaneous expansion of two extant lineages of M. tuberculosis that was sustained by key members of a high-risk social network. Genotyping and contact tracing alone did not capture the true dynamics of the outbreak. {(Funded} by Genome British Columbia and others.).},
number = {8},
urldate = {2012-09-26},
journal = {The New England Journal of Medicine},
author = {Gardy, Jennifer L and Johnston, James C and Ho Sui, Shannan J and Cook, Victoria J and Shah, Lena and Brodkin, Elizabeth and Rempel, Shirley and Moore, Richard and Zhao, Yongjun and Holt, Robert and Varhol, Richard and Birol, Inanc and Lem, Marcus and Sharma, Meenu K and Elwood, Kevin and Jones, Steven J M and Brinkman, Fiona S L and Brunham, Robert C and Tang, Patrick},
month = feb,
year = {2011},
note = {{PMID:} 21345102},
keywords = {Adult, British Columbia, Cocaine-Related Disorders, Contact Tracing, Disease Outbreaks, Female, Genome, Bacterial, Genotype, Humans, Incidence, Male, Middle Aged, Mycobacterium tuberculosis, Phylogeny, Polymorphism, Single Nucleotide, Questionnaires, Risk Factors, Sequence Analysis, {DNA}, Social Support, Tuberculosis, Young Adult},
pages = {730--739},
file = {nejmoa1003176.pdf:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\w7cp5xk2.default\zotero\storage\VKRRITNX\nejmoa1003176.pdf:application/pdf}
}
@article{foxman_molecular_2001,
title = {Molecular Epidemiology: Focus on Infection},
volume = {153},
lccn = {0052},
shorttitle = {Molecular Epidemiology},
url = {http://aje.oxfordjournals.org/content/153/12/1135.abstract},
doi = {10.1093/aje/153.12.1135},
abstract = {Molecular biology techniques have become increasingly integrated into the practice of infectious disease epidemiology. The term “molecular epidemiology” routinely appears in the titles of articles that use molecular strain-typing (“fingerprinting”) techniques—regardless of whether there is any epidemiologic application. What distinguishes molecular epidemiology is both the “molecular,” the use of the techniques of molecular biology, and the “epidemiology,” the study of the distribution and determinants of disease occurrence in human populations. The authors review various definitions of molecular epidemiology. They then comment on the range of molecular techniques available and present some examples of the benefits and challenges of applying these techniques to infectious agents and their affected host using tuberculosis and urinary tract infection as examples. They close with some thoughts about training future epidemiologists to best take advantage of the new opportunities that arise from integrating epidemiologic methods with modern molecular biology.},
number = {12},
urldate = {2011-01-12},
journal = {American Journal of Epidemiology},
author = {Foxman, Betsy and Riley, Lee},
month = jun,
year = {2001},
pages = {1135 --1141},
file = {Snapshot:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\w7cp5xk2.default\zotero\storage\Z4S6MUAZ\1135.html:text/html}
}
@book{merrill_epidemiology_2010,
title = {Introduction to Epidemiology},
isbn = {9780763766221},
abstract = {Introduction to Epidemiology, Fifth Edition is the ideal introductory text for the epidemiology student with minimal training in the biomedical sciences and statistics. With updated tables, figures, and examples throughout, the Fifth Edition is a thorough revision that offers an all new chapter covering areas of modern epidemiology such as environmental epidemiology, social epidemiology, and reproductive epidemiology. The chapters feature several new case studies and news files representing applications of commonly used research designs. Learning objectives, as well as study questions with descriptive answers, in each chapter engage the student in further analysis and reflection.},
language = {en},
publisher = {Jones \& Bartlett Learning},
author = {Merrill, Ray},
month = jan,
year = {2010},
keywords = {Medical / Epidemiology}
}
@article{behringer_typing_2011,
title = {Typing of \emph{{Campylobacter jejuni}} and \emph{{Campylobacter coli}} isolated from live broilers and retail broiler meat by {flaA-RFLP}, {MLST}, {PFGE} and {REP-PCR}},
volume = {84},
issn = {1872-8359},
url = {http://www.ncbi.nlm.nih.gov/pubmed/21130125},
doi = {10.1016/j.mimet.2010.11.016},
abstract = {We analyzed 100 Campylobacter spp. isolates {(C.} jejuni and C. coli) from Grenada, Puerto Rico and Alabama, which were collected from live broilers or retail broiler meat. We analyzed these isolates with four molecular typing methods: restriction fragment length polymorphism of the {flaA} gene {(flaA-RFLP)}, multilocus sequence typing {(MLST)}, pulsed-field gel electrophoresis {(PFGE)}, and automated repetitive extragenic palindromic polymerase chain reaction {(REP-PCR)} using the {DiversiLab} system. All methods performed similarly for the typing of C. jejuni and C. coli. The {DNA} extraction method appears to influence the results obtained with {REP-PCR.} This method was better for the typing of C. jejuni than C. coli, however both {REP-PCR} and {flaA-RFLP} generated types that were indistinguishable between C. jejuni and C. coli and appeared to be random, without any relationship to species, location, or source of isolates. {PFGE} and {MLST} generated typing results that had a better correlation with the geographic location of the isolates and showed higher concordance with the Wallace coefficient. The adjusted Rand coefficient did not show higher concordance among the methods, although the {PFGE/MLST} combination exhibited the highest concordance. {PFGE} and {MLST} revealed a better discriminatory power for C. coli isolates than {REP-PCR} or {flaA-RFLP.} The use of readily available online tools to calculate the confidence interval of the Simpson's index of diversity and the adjusted Rand and Wallace coefficients helped estimate the discriminatory power of typing methods. Further studies using different C. jejuni and C. coli strains may expand our understanding of the benefits and limitations of each of these typing methods for epidemiological studies of Campylobacter spp.},
number = {2},
urldate = {2011-07-29},
journal = {Journal of Microbiological Methods},
author = {Behringer, Megan and Miller, William G and Oyarzabal, Omar A},
month = feb,
year = {2011},
note = {{PMID:} 21130125},
keywords = {Alabama, Animals, Bacterial Typing Techniques, Campylobacter coli, Campylobacter jejuni, Chickens, {DNA} Fingerprinting, Electrophoresis, Gel, Pulsed-Field, Flagellin, Genotype, Grenada, Meat, Molecular Typing, Multilocus Sequence Typing, Polymerase Chain Reaction, Polymorphism, Restriction Fragment Length, Puerto Rico},
pages = {194--201}
}
@article{howard-jones_robert_1984,
title = {{Robert} {Koch} and the cholera vibrio: a centenary.},
volume = {288},
issn = {0267-0623},
shorttitle = {Robert Koch and the cholera vibrio},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1444283/},
number = {6414},
urldate = {2012-12-04},
journal = {British Medical Journal {(Clinical} Research Ed.)},
author = {Howard-Jones, N},
month = feb,
year = {1984},
note = {{PMID:} 6419937
{PMCID:} {PMC1444283}},
pages = {379--381},
file = {PubMed Central Full Text PDF:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\w7cp5xk2.default\zotero\storage\F4CZ5878\Howard-Jones - 1984 - Robert Koch and the cholera vibrio a centenary..pdf:application/pdf}
}
@book{vinten-johansen_cholera_2003,
title = {Cholera, Chloroform, and the Science of Medicine: A Life of {John} {Snow}},
isbn = {9780195135442},
shorttitle = {Cholera, Chloroform, and the Science of Medicine},
abstract = {The product of six years of collaborative research, this fine biography offers new interpretations of a pioneering figure in anesthesiology, epidemiology, medical cartography, and public health. It modifies the conventional rags to riches portrait of John Snow by synthesizing fresh information about his early life from archival research and recent studies. It explores the intellectual roots of his commitments to vegetarianism, temperance, and pure drinking water, first developed when he was a medical apprentice and assistant in the north of England. The authors argue that all of Snow's later contributions are traceable to the medical paradigm he imbibed as a medical student in London and put into practice early in his career as a clinician: that medicine as a science required the incorporation of recent developments in its collateral sciences--chiefly anatomy, chemistry, and physiology--in order to understand the causes of disease. Snow's theoretical breakthroughs in anesthesia were extensions of his experimental research in respiratory physiology and the properties of inhaled gases. Shortly thereafter, his understanding of gas laws led him to reject miasmatic explanations for the spread of cholera, and to develop an alternative theory in consonance with what was then known about chemistry and the physiology of digestion. Using all of Snow's writings, the authors follow him when working in his home laboratory, visiting patients throughout London, attending medical society meetings, and conducting studies during the cholera epidemics of 1849 and 1854. The result is a book that demythologizes some overly heroic views of Snow by providing a fairer measure of his actual contributions. It will have an impact not only on the understanding of the man but also on the history of epidemiology and medical science.},
language = {en},
publisher = {Oxford University Press},
author = {Vinten-Johansen, Peter},
year = {2003},
keywords = {Biography \& Autobiography / General, Biography \& Autobiography / Medical, Language Arts \& Disciplines / Linguistics / General, Medical / Anesthesiology, Medical / Epidemiology, Medical / History, Medical / Public Health}
},
@article{snow_cholera_1857,
title = {Cholera, and the Water Supply in the South Districts of {London}},
volume = {1},
issn = {0007-1447},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2250686/},
number = {42},
urldate = {2012-12-04},
journal = {British Medical Journal},
author = {Snow, John},
month = oct,
year = {1857},
note = {{PMID:} null
{PMCID:} {PMC2250686}},
pages = {864--865},
file = {PubMed Central Full Text PDF:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\w7cp5xk2.default\zotero\storage\DS25AT3J\Snow - 1857 - Cholera, and the Water Supply in the South Distric.pdf:application/pdf}
}
@article{nachamkin_flagellin_1993,
title = {Flagellin gene typing of \emph{{Campylobacter jejuni}} by restriction fragment length polymorphism analysis.},
volume = {31},
issn = {0095-1137},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC265573/},
abstract = {We developed and studied a molecular typing approach for Campylobacter spp. with restriction fragment length polymorphism {(RFLP)} analysis of the flagellin gene {flaA} in C. jejuni. Using polymerase chain reaction, we amplified the {flaA} gene from strains comprising different {HL:O} serotypes by using a primer set directed at the conserved 5' and 3' {flaA} gene sequence to generate a 1.7-kb amplicon. The amplicon was further digested with the restriction enzyme {DdeI}, and the fragments generated were analyzed by agarose gel electrophoresis. In 43 non-outbreak strains of six common {HL} serotypes {(HL} 1, 2, 4, 5, 9, and 36) in the United States, 18 {RFLP} patterns were observed. In {U.S.} outbreak strains previously studied by 10 other typing methods, {flaA} typing correlated with the {HL} serotype within each outbreak, and six additional {flaA} types were identified. Our results suggest that {RFLP} analysis of the {flaA} gene from Campylobacter spp. has sufficient discrimination to be useful as a practical typing method for clinical and epidemiologic investigations.},
number = {6},
urldate = {2012-12-04},
journal = {Journal of Clinical Microbiology},
author = {Nachamkin, I and Bohachick, K and Patton, C M},
month = jun,
year = {1993},
note = {{PMID:} 8100241
{PMCID:} {PMC265573}},
pages = {1531--1536},
file = {PubMed Central Full Text PDF:C:\Users\Peter\AppData\Roaming\Mozilla\Firefox\Profiles\w7cp5xk2.default\zotero\storage\M24NCJZJ\Nachamkin et al. - 1993 - Flagellin gene typing of Campylobacter jejuni by r.pdf:application/pdf}
}
@article{sugimoto_evaluation_2011,
title = {Evaluation of a {PCR-restriction} fragment length polymorphism {(PCR-RFLP)} assay for molecular epidemiological study of {Shiga} toxin-producing \emph{{Escherichia coli}}},
volume = {73},
issn = {1347-7439},
url = {http://www.ncbi.nlm.nih.gov/pubmed/21321474},
abstract = {In this study, we have evaluated our recently developed polymerase chain reaction-restriction fragment length polymorphism {(PCR-RFLP)} assay for the molecular subtyping of Shiga toxin-producing Escherichia coli {(STEC).} A total of 200 {STEC} strains including O157 (n=100), O26 (n=50), O111 (n=10), and non-{O26/O111/O157} (n=40) serogroups isolated during 2005-2006 in Japan, which were identified to be clonally different by pulsed-field gel electrophoresis {(PFGE)} were further analyzed by the {PCR-RFLP} assay in comparison to {PFGE.} Ninety-five of O157, 48 of O26, five of O111 and 19 of non-{O26/O111/O157} {STEC} strains yielded one to three amplicons ranging from 6.0 to 15.5 kb in size by the specific primer set targeting region V which is located in the upstream of stx genes. These strains were classified into 41 {(O157)}, 8 {(O26)}, 4 {(O111)} and 17 (non-{O26/O111/O157)} groups based on the {RFLP} patterns obtained by subsequent restriction digestion, respectively. Although the discriminatory power of {PCR-RFLP} assay was somewhat less than that of {PFGE}, it is more convenient for molecular subtyping of {STEC} strains especially for O157, the most important serogroup implicated in human diseases, as well as to identify the outbreak-associated isolates because of its simplicity, rapidity, ease and good reproducibility.},
number = {7},
urldate = {2012-04-18},
journal = {The Journal of Veterinary Medical Science / the Japanese Society of Veterinary Science},
author = {Sugimoto, Norihiko and Shima, Kensuke and Hinenoya, Atsushi and Asakura, Masahiro and Matsuhisa, Akio and Watanabe, Haruo and Yamasaki, Shinji},
month = jul,
year = {2011},
note = {{PMID:} 21321474},
keywords = {{DNA}, Bacterial, Genetic Variation, Humans, Molecular Epidemiology, O Antigens, Polymerase Chain Reaction, Polymorphism, Restriction Fragment Length, Shiga-Toxigenic Escherichia coli},
pages = {859--867}
}
@article{bochner_phenotype_2001,
title = {Phenotype MicroArrays for High-Throughput Phenotypic Testing and Assay of Gene Function},
volume = {11},
issn = {1088-9051, 1549-5469},
url = {http://genome.cshlp.org/content/11/7/1246},
doi = {10.1101/gr.186501},
abstract = {An international, peer-reviewed genome sciences journal featuring outstanding original research that offers novel insights into the biology of all organisms},
number = {7},
journal = {Genome Research},
author = {Bochner, Barry R. and Gadzinski, Peter and Panomitros, Eugenia},
month = jul,
year = {2001},
pages = {1246--1255}
},
@article{odumeru_evaluation_1999,
title = {Evaluation of Accuracy and Repeatability of Identification of Food-Borne Pathogens by Automated Bacterial Identification Systems},
volume = {37},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/37/4/944},
abstract = {The performances of five automated microbial identification systems, relative to that of a reference identification system, for their ability to accurately and repeatedly identify six common food-borne pathogens were assessed. The systems assessed were the {MicroLog} system {(Biolog} Inc., Hayward, Calif.), the Microbial Identification System {(MIS;} {MIDI} Inc., Newark, Del.), the {VITEK} system {(bioMérieux} Vitek, Hazelwood, Mo.), the {MicroScan} {WalkAway} 40 system {(Dade-MicroScan} International, West Sacramento, Calif.), and the Replianalyzer system {(Oxoid} Inc., Nepean, Ontario, Canada). The sensitivities and specificities of these systems for the identification of food-borne isolates of Bacillus {cereus,Campylobacter} jejuni, Listeria {monocytogenes,Staphylococcus} aureus, Salmonella spp., and verotoxigenic \emph{Escherichia coli} were determined with 40 reference positive isolates and 40 reference negative isolates for each pathogen. The sensitivities of these systems for the identification of these pathogens ranged from 42.5 to 100\%, and the specificities of these systems for the identification of these pathogens ranged from 32.5 to 100\%. Some of the systems had difficulty correctly identifying the reference isolates when the results were compared to those from the reference identification tests. The sensitivity of {MIS} for the identification of S. aureus, B. {cereus,E.} coli, and C. jejuni, for example, ranged from 47.5 to 72.5\%. The sensitivity of the Microlog system for the identification of \emph{E. coli} was 72.5\%, and the sensitivity of the {VITEK} system for the identification of B. cereus was 42.5\%. The specificities of four of the five systems for the identification of all of the species tested with the available databases were greater than or equal to 97.5\%; the exception was {MIS} for the identification of C. jejuni, which displayed a specificity of 32.5\% when it was tested with reference negative isolates including Campylobact\emph{er coli} and {otherCampylobacter} species. All systems had {\textgreater}80\% sensitivities for the identification of Salmonella species {andListeria} species at the genus level. The repeatability of these systems for the identification of test isolates ranged from 30 to 100\%. Not all systems included all six pathogens in their databases; thus, some species could not be tested with all systems. The choice of automated microbial identification system for the identification of a food-borne pathogen would depend on the availability of identification libraries within the systems and the performance of the systems for the identification of the pathogen.},
number = {4},
journal = {Journal of Clinical Microbiology},
author = {Odumeru, Joseph A. and Steele, Marina and Fruhner, Lynne and Larkin, Carolyn and Jiang, Jiangdong and Mann, Elroy and {McNab}, W. Bruce},
month = apr,
year = {1999},
pages = {944--949}
},
@article{miller_preliminary_1991,
title = {Preliminary evaluation of {Biolog}, a carbon source utilization method for bacterial identification.},
volume = {29},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/29/6/1143},
abstract = {The Biolog Identification System {(Biolog}, Inc., Hayward, Calif.) is a new bacterial identification method that establishes an identification based on the exchange of electrons generated during respiration, leading to a subsequent tetrazolium-based color change. This system tests the ability of a microorganism to oxidize a panel of 95 different carbon sources. We report on a preliminary investigation of the ability of the instrument to identify, using its computer-driven enzyme immunoassay reader, a diverse group of clinically relevant members of the family Enterobacteriaceae and gram-negative non-Enterobacteriaceae. The Biolog reported identifications (correct or incorrect) for 266 of 352 organisms tested (75.6\%). Of the 266 identifications reported, 87.3\% were correct at the genus level and 75.6\% were correct at the species level at 24 h. In the total study of 352 strains, 46.6\% were correct to the species level at 4 h and 57.1\% were correct to the species level at 24 h. The error rate was 10.4\% after 4 h and 9.6\% after 24 h. The Biolog performed well with many genera, but problems were encountered with some strains of Klebsiella, Enterobacter, and Serratia. We found the system to be versatile and easy to use.},
number = {6},
journal = {Journal of Clinical Microbiology},
author = {Miller, J M and Rhoden, D L},
month = jun,
year = {1991},
pages = {1143--1147}
},
@article{baumler_evolution_2011,
title = {The evolution of metabolic networks of \emph{{E. coli}}},
volume = {5},
copyright = {2011 Baumler et al; licensee {BioMed} Central Ltd.},
issn = {1752-0509},
url = {http://www.biomedcentral.com/1752-0509/5/182/abstract},
doi = {10.1186/1752-0509-5-182},
abstract = {Despite the availability of numerous complete genome sequences from \emph{E. coli} strains, published genome-scale metabolic models exist only for two commensal \emph{E. coli} strains. These models have proven useful for many applications, such as engineering strains for desired product formation, and we sought to explore how constructing and evaluating additional metabolic models for \emph{E. coli} strains could enhance these efforts.},
number = {1},
journal = {{BMC} Systems Biology},
author = {Baumler, David J. and Peplinski, Roman G. and Reed, Jennifer L. and Glasner, Jeremy D. and Perna, Nicole T.},
month = nov,
year = {2011},
pages = {182}
},
@article{chizhikov_microarray_2001,
title = {Microarray analysis of microbial virulence factors},
volume = {67},
issn = {0099-2240},
url = {http://www.ncbi.nlm.nih.gov/pubmed/11425749},
doi = {10.1128/AEM.67.7.3258-3263.2001},
abstract = {Hybridization with oligonucleotide microchips (microarrays) was used for discrimination among strains of Escherichia coli and other pathogenic enteric bacteria harboring various virulence factors. Oligonucleotide microchips are miniature arrays of gene-specific oligonucleotide probes immobilized on a glass surface. The combination of this technique with the amplification of genetic material by {PCR} is a powerful tool for the detection of and simultaneous discrimination among food-borne human pathogens. The presence of six genes {(eaeA}, slt-I, slt-{II}, {fliC}, {rfbE}, and {ipaH)} encoding bacterial antigenic determinants and virulence factors of bacterial strains was monitored by multiplex {PCR} followed by hybridization of the denatured {PCR} product to the gene-specific oligonucleotides on the microchip. The assay was able to detect these virulence factors in 15 Salmonella, Shigella, and E. coli strains. The results of the chip analysis were confirmed by hybridization of radiolabeled gene-specific probes to genomic {DNA} from bacterial colonies. In contrast, gel electrophoretic analysis of the multiplex {PCR} products used for the microarray analysis produced ambiguous results due to the presence of unexpected and uncharacterized bands. Our results suggest that microarray analysis of microbial virulence factors might be very useful for automated identification and characterization of bacterial pathogens.},
number = {7},
urldate = {2012-09-04},
journal = {Applied and Environmental Microbiology},
author = {Chizhikov, V and Rasooly, A and Chumakov, K and Levy, D D},
month = jul,
year = {2001},
note = {{PMID:} 11425749},
keywords = {Bacterial Proteins, Enterobacteriaceae, Enterobacteriaceae Infections, Fluorescent Dyes, Food Microbiology, Humans, Nucleic Acid Hybridization, Oligonucleotide Array Sequence Analysis, Polymerase Chain Reaction, Virulence},
pages = {3258--3263}
}
@article{doumith_use_2006,
title = {Use of {DNA} arrays for the analysis of outbreak-related strains of \emph{{Listeria monocytogenes}}},
volume = {296},
issn = {1438-4221},
url = {http://www.ncbi.nlm.nih.gov/pubmed/17002895},
doi = {10.1016/j.ijmm.2006.06.002},
abstract = {We evaluated the discriminative power and usefulness of the {DNA} array technology as compared to {DNA} macrorestriction pattern analysis for monitoring epidemiologically related clusters of Listeria monocytogenes strains that differ slightly in {DNA} macrorestriction patterns. We show that this approach allows clarifying the genetic basis of the pattern variations. In the reported outbreak, the differences were due to phage excision, showing the power of this technique in epidemiological studies.},
number = {8},
urldate = {2012-09-04},
journal = {International Journal of Medical Microbiology: {IJMM}},
author = {Doumith, Michel and Jacquet, Christine and Goulet, Véronique and Oggioni, Chiara and Van Loock, Frank and Buchrieser, Carmen and Martin, Paul},
month = dec,
year = {2006},
note = {{PMID:} 17002895},
keywords = {Bacterial Typing Techniques, Disease Outbreaks, {DNA}, Bacterial, Electrophoresis, Gel, Pulsed-Field, Listeria monocytogenes, Listeriosis, Oligonucleotide Array Sequence Analysis, Restriction Mapping},
pages = {559--562}
}
@article{lucchini_microarrays_2001,
title = {Microarrays for microbiologists},
volume = {147},
issn = {1350-0872, 1465-2080},
url = {http://mic.sgmjournals.org/content/147/6/1403},
language = {en},
number = {6},
urldate = {2012-11-27},
journal = {Microbiology},
author = {Lucchini, S. and Thompson, A. and Hinton, J. C. D.},
month = jun,
year = {2001},
keywords = {{DNA} microarray, Gene Expression Profiling, microbial genomotyping},
pages = {1403--1414}
}
@article{call_mixed-genome_2003,
title = {Mixed-Genome Microarrays Reveal Multiple Serotype and Lineage-Specific Differences among Strains of \emph{{Listeria monocytogenes}}},
volume = {41},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/41/2/632},
doi = {10.1128/JCM.41.2.632-639.2003},
abstract = {Epidemiological studies and analysis of putative virulence genes have shown that Listeria monocytogenes has diverged into several phylogenetic divisions. We hypothesize that similar divergence has occurred for many genes that influence niche-specific fitness and virulence and that identifying these differences may offer new opportunities for the detection, treatment, and control of this important pathogen. To explore this issue further, we developed a microarray composed of fragmented {DNA} taken from 10 strains of L. monocytogenes. We then hybridized genomic {DNA} from 50 different strains to replicate arrays and analyzed the resulting hybridization patterns. A simple Euclidean distance metric permitted the reconstruction of previously described genetic relationships between serotypes, and only four microarray probes were needed to discriminate between the most important serotypes (1/2a, 1/2b, 1/2c, and 4). We calculated an index of linkage equilibrium from the microarray data and confirmed that L. monocytogenes has a strongly clonal population structure {(IA} = 3.85). Twenty-nine informative probes were retrieved from the library and sequenced. These included genes associated with repairing {UV-damaged} {DNA}, salt tolerance, biofilm formation, heavy metal transport, ferrous iron transport, and teichoic acid synthesis. Several membrane-bound lipoproteins and one internalin were identified, plus three phage sequences and six sequences with unknown function. Collectively, these data confirm that many genes have diverged between lineages of L. monocytogenes. Furthermore, these results demonstrate the value of mixed-genome microarrays as a tool for deriving biologically useful information and for identifying and screening genetic markers for clinically important microbes.},
language = {en},
number = {2},
urldate = {2012-11-28},
journal = {Journal of Clinical Microbiology},
author = {Call, Douglas R. and Borucki, Monica K. and Besser, Thomas E.},
month = feb,
year = {2003},
pages = {632--639}
}
@article{zhang_genome_2003,
title = {Genome diversification in phylogenetic lineages {I} and {II} of \emph{{Listeria monocytogenes}}: identification of segments unique to lineage {II} populations},
volume = {185},
issn = {0021-9193},
shorttitle = {Genome diversification in phylogenetic lineages I and {II} of Listeria monocytogenes},
url = {http://www.ncbi.nlm.nih.gov/pubmed/12949110},
abstract = {Thirteen different serotypes of Listeria monocytogenes can be distinguished on the basis of variation in somatic and flagellar antigens. Although the known virulence genes are present in all serotypes, greater than 90\% of human cases of listeriosis are caused by serotypes 1/2a, 1/2b, and 4b and nearly all outbreaks of food-borne listeriosis have been caused by serotype 4b strains. Phylogenetic analysis of these three common clinical serotypes places them into two different lineages, with serotypes 1/2b and 4b belonging to lineage I and 1/2a belonging to lineage {II.} To begin examining evolution of the genome in these serotypes, {DNA} microarray analysis was used to identify lineage-specific and serotype-specific differences in genome content. A set of 44 strains representing serotypes 1/2a, 1/2b, and 4b was probed with a shotgun {DNA} microarray constructed from the serotype 1/2a strain 10403s. Clones spanning 47 different genes in 16 different contiguous segments relative to the lineage {II} 1/2a genome were found to be absent in all lineage I strains tested (serotype 4b and 1/2b) and an additional nine were altered exclusively in 4b strains. Southern hybridization confirmed that conserved alterations were, in all but two loci, due to absence of the segments from the genome. Genes within these contiguous segments comprise five functional categories, including genes involved in synthesis of cell surface molecules and regulation of virulence gene expression. Phylogenetic reconstruction and examination of compositional bias in the regions of difference are consistent with a model in which the ancestor of the two lineages had the 1/2 somatic serotype and the regions absent in the lineage I genome arose by loss of ancestral sequences.},
number = {18},
urldate = {2012-09-04},
journal = {Journal of Bacteriology},
author = {Zhang, Chaomei and Zhang, Min and Ju, Jingliang and Nietfeldt, Joseph and Wise, John and Terry, Philip M and Olson, Michael and Kachman, Stephen D and Wiedmann, Martin and Samadpour, Mansour and Benson, Andrew K},
month = sep,
year = {2003},
note = {{PMID:} 12949110},
keywords = {Biological Transport, Cell Membrane, Codon, Gene Expression Regulation, Bacterial, Genetic Variation, Genetics, Population, Genome, Bacterial, Listeria monocytogenes, Oligonucleotide Array Sequence Analysis, Phylogeny, Serotyping, Transcription, Genetic},
pages = {5573--5584}
}
@article{lashkari_yeast_1997,
title = {Yeast microarrays for genome wide parallel genetic and gene expression analysis},
volume = {94},
issn = {0027-8424},
url = {http://www.ncbi.nlm.nih.gov/pubmed/9371799},
abstract = {We have developed high-density {DNA} microarrays of yeast {ORFs.} These microarrays can monitor hybridization to {ORFs} for applications such as quantitative differential gene expression analysis and screening for sequence polymorphisms. Automated scripts retrieved sequence information from public databases to locate predicted {ORFs} and select appropriate primers for amplification. The primers were used to amplify yeast {ORFs} in 96-well plates, and the resulting products were arrayed using an automated micro arraying device. Arrays containing up to 2,479 yeast {ORFs} were printed on a single slide. The hybridization of fluorescently labeled samples to the array were detected and quantitated with a laser confocal scanning microscope. Applications of the microarrays are shown for genetic and gene expression analysis at the whole genome level.},
number = {24},
urldate = {2012-09-06},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
author = {Lashkari, D A and {DeRisi}, J L and {McCusker}, J H and Namath, A F and Gentile, C and Hwang, S Y and Brown, P O and Davis, R W},
month = nov,
year = {1997},
note = {{PMID:} 9371799},
keywords = {Cold Temperature, {DNA} Primers, {DNA}, Complementary, Galactose, Gene Expression, Genome, Fungal, Genotype, Glucose, Heat-Shock Response, Open Reading Frames, Saccharomyces cerevisiae},
pages = {13057--13062}
}
@article{schena_quantitative_1995,
title = {Quantitative monitoring of gene expression patterns with a complementary {DNA} microarray},
volume = {270},
issn = {0036-8075},
url = {http://www.ncbi.nlm.nih.gov/pubmed/7569999},
abstract = {A high-capacity system was developed to monitor the expression of many genes in parallel. Microarrays prepared by high-speed robotic printing of complementary {DNAs} on glass were used for quantitative expression measurements of the corresponding genes. Because of the small format and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived from 2 micrograms of total cellular messenger {RNA.} Differential expression measurements of 45 Arabidopsis genes were made by means of simultaneous, two-color fluorescence hybridization.},
number = {5235},
urldate = {2012-09-06},
journal = {Science},
author = {Schena, M and Shalon, D and Davis, R W and Brown, P O},
month = oct,
year = {1995},
note = {{PMID:} 7569999},
keywords = {Arabidopsis, Arabidopsis Proteins, {DNA}, Complementary, {DNA}, Plant, {DNA-Binding} Proteins, Gene Expression, Genes, Plant, Genetic Techniques, Genome, Human, Homeodomain Proteins, Humans, Molecular Sequence Data, Nucleic Acid Hybridization, Plant Leaves, Plant Roots, Plants, Genetically Modified, Polymerase Chain Reaction, {RNA} Probes, {RNA}, Messenger, {RNA}, Plant, Transcription Factors},
pages = {467--470}
}
@article{taboada_studying_2007,
title = {Studying bacterial genome dynamics using microarray-based comparative genomic hybridization},
volume = {396},
issn = {1064-3745},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18025696},
doi = {10.1007/978-1-59745-515-2_15},
abstract = {Genome sequencing has revealed the remarkable amount of genetic diversity that can be encountered in bacterial genomes. In particular, the comparison of genome sequences from closely related strains has uncovered significant differences in gene content, hinting at the dynamic nature of bacterial genomes. The study of these genome dynamics is crucial to leveraging genomic information because the genome sequence of a single bacterial strain may not accurately represent the genome of the species. The dynamic nature of bacterial genome content has required us to apply the concepts of comparative genomics {(CG)} at the species level. Although direct genome sequence comparisons are an ideal method of performing {CG}, one current constraint is the limited availability of multiple genome sequences from a given bacterial species. {DNA} microarray-based comparative genomic hybridization {(MCGH)}, which can be used to determine the presence or absence of thousands of genes in a single hybridization experiment, provides a powerful alternative for determining genome content and has been successfully used to investigate the genome dynamics of a wide number of bacterial species. Although {MCGH-based} studies have already provided a new vista on bacterial genome diversity, original methods for {MCGH} have been limited by the absence of novel gene sequences included in the microarray. New applications of the {MCGH} platform not only promise to accelerate the pace of novel gene discovery but will also help provide an integrated microarray-based approach to the study of bacterial {CG.}},
urldate = {2012-09-06},
journal = {Methods in Molecular Biology {(Clifton}, {N.J.)}},
author = {Taboada, Eduardo N and Luebbert, Christian C and Nash, John H E},
year = {2007},
note = {{PMID:} 18025696},
keywords = {Evolution, Molecular, Genome, Bacterial, Oligonucleotide Array Sequence Analysis, Phylogeny},
pages = {223--253}
}
@article{clark_comparison_2012,
title = {Comparison of Molecular Typing Methods Useful for Detecting Clusters of \emph{{Campylobacter jejuni}} and \emph{{C. coli}} Isolates Through Routine Surveillance},
volume = {50},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/50/3/798},
doi = {10.1128/JCM.05733-11},
abstract = {Campylobacter spp. may be responsible for unreported outbreaks of food-borne disease. The detection of these outbreaks is made more difficult by the fact that appropriate methods for detecting clusters of Campylobacter have not been well defined. We have compared the characteristics of five molecular typing methods on Campylobacter jejuni and C. coli isolates obtained from human and nonhuman sources during sentinel site surveillance during a 3-year period. Comparative genomic fingerprinting {(CGF)} appears to be one of the optimal methods for the detection of clusters of cases, and it could be supplemented by the sequencing of the {flaA} gene short variable region {(flaA} {SVR} sequence typing), with or without subsequent multilocus sequence typing {(MLST).} Different methods may be optimal for uncovering different aspects of source attribution. Finally, the use of several different molecular typing or analysis methods for comparing individuals within a population reveals much more about that population than a single method. Similarly, comparing several different typing methods reveals a great deal about differences in how the methods group individuals within the population.},
language = {en},
number = {3},
urldate = {2012-05-23},
journal = {Journal of Clinical Microbiology},
author = {Clark, Clifford G and Taboada, Eduardo and Grant, Christopher C. R and Blakeston, Connie and Pollari, Frank and Marshall, Barbara and Rahn, Kris and {MacKinnon}, Joanne and Daignault, Danielle and Pillai, Dylan and Ng, Lai-King},
month = mar,
year = {2012},
pages = {798--809}
}
@article{vogel_ion_2012,
title = {{Ion Torrent Personal Genome Machine} Sequencing for Genomic Typing of \emph{{Neisseria Meningitidis}} for Rapid Determination of Multiple Layers of Typing Information},
volume = {50},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/50/6/1889},
doi = {10.1128/JCM.00038-12},
abstract = {Neisseria meningitidis causes invasive meningococcal disease in infants, toddlers, and adolescents worldwide. {DNA} sequence-based typing, including multilocus sequence typing, analysis of genetic determinants of antibiotic resistance, and sequence typing of vaccine antigens, has become the standard for molecular epidemiology of the organism. However, {PCR} of multiple targets and consecutive Sanger sequencing provide logistic constraints to reference laboratories. Taking advantage of the recent development of benchtop next-generation sequencers {(NGSs)} and of {BIGSdb}, a database accommodating and analyzing genome sequence data, we therefore explored the feasibility and accuracy of Ion Torrent Personal Genome Machine {(PGM)} sequencing for genomic typing of meningococci. Three strains from a previous meningococcus serogroup B community outbreak were selected to compare conventional typing results with data generated by semiconductor chip-based sequencing. In addition, sequencing of the meningococcal type strain {MC58} provided information about the general performance of the technology. The {PGM} technology generated sequence information for all target genes addressed. The results were 100\% concordant with conventional typing results, with no further editing being necessary. In addition, the amount of typing information, i.e., nucleotides and target genes analyzed, could be substantially increased by the combined use of genome sequencing and {BIGSdb} compared to conventional methods. In the near future, affordable and fast benchtop {NGS} machines like the {PGM} might enable reference laboratories to switch to genomic typing on a routine basis. This will reduce workloads and rapidly provide information for laboratory surveillance, outbreak investigation, assessment of vaccine preventability, and antibiotic resistance gene monitoring.},
language = {en},
number = {6},
urldate = {2012-05-28},
journal = {Journal of Clinical Microbiology},
author = {Vogel, Ulrich and Szczepanowski, Rafael and Claus, Heike and Jünemann, Sebastian and Prior, Karola and Harmsen, Dag},
month = jun,
year = {2012},
pages = {1889--1894}
}
@article{akopyanz_dna_1992,
title = {{DNA} diversity among clinical isolates of \emph{{Helicobacter pylori}} detected by {PCR-based} {RAPD} fingerprinting},
volume = {20},
issn = {0305-1048, 1362-4962},
url = {http://nar.oxfordjournals.org/content/20/19/5137},
doi = {10.1093/nar/20.19.5137},
abstract = {The {RAPD} (or {AP-PCR)} {DNA} fingerprinting method was used to distinguish among clinical isolates of Helicobacter pylori, a bacterium whose long term carriage is associated with gastritis, peptic ulcers and gastric carcinomas. This method uses arbitrarily chosen oligonucleotides to prime {DNA} synthesis from genomlc sites to which they are fortuitously matched, or almost matched. Most 10-nt primers with ss 60\% G + C yielded strain-specific arrays of up to 15 prominent fragments, as did most longer (≥ 17-nt) primers, whereas most 10-nt primers with 50\% G + C did not. Each of 64 Independent H.pylori isolates, 60 of which were from patients in the same hospital, was distinguishable with a single {RAPD} primer, which suggests a high level of {DNA} sequence diversity within this species. In contrast, isolates from initial and followup biopsies were indistinguishable in each of three cases tested.},
language = {en},
number = {19},
urldate = {2012-11-27},
journal = {Nucleic Acids Research},
author = {Akopyanz, Natalia and Bukanov, Nickolai O. and Westblom, T. Ulf and Kresovich, Stephen and Berg, Douglas E.},
month = oct,
year = {1992},
pages = {5137--5142}
}
@article{williams_dna_1990,
title = {{DNA} polymorphisms amplified by arbitrary primers are useful as genetic markers},
volume = {18},
issn = {0305-1048},
abstract = {Molecular genetic maps are commonly constructed by analyzing the segregation of restriction fragment length polymorphisms {(RFLPs)} among the progeny of a sexual cross. Here we describe a new {DNA} polymorphism assay based on the amplification of random {DNA} segments with single primers of arbitrary nucleotide sequence. These polymorphisms, simply detected as {DNA} segments which amplify from one parent but not the other, are inherited in a Mendelian fashion and can be used to construct genetic maps in a variety of species. We suggest that these polymorphisms be called {RAPD} markers, after Random Amplified Polymorphic {DNA.}},
number = {22},
journal = {Nucleic Acids Research},
author = {Williams, J G and Kubelik, A R and Livak, K J and Rafalski, J A and Tingey, S V},
month = nov,
year = {1990},
note = {{PMID:} 1979162},
keywords = {Base Composition, Base Sequence, Crossing Over, Genetic, {DNA}, Genetic Markers, Humans, Molecular Sequence Data, Neurospora crassa, Nucleotide Mapping, Polymerase Chain Reaction, Polymorphism, Restriction Fragment Length, Soybeans, Zea mays},
pages = {6531--6535}
}
@article{zhang_genome_2007,
title = {Genome evolution in major \emph{{Escherichia coli}} {O157:H7} lineages},
volume = {8},
copyright = {http://creativecommons.org/licenses/by/2.0/},
issn = {1471-2164},
shorttitle = {Genome evolution in major Escherichia coli O157},
url = {http://www.biomedcentral.com/1471-2164/8/121},
doi = {10.1186/1471-2164-8-121},
abstract = {Genetic analysis of Escherichia coli {O157:H7} strains has shown divergence into two distinct lineages, lineages I and {II}, that appear to have distinct ecological characteristics, with lineage I strains more commonly associated with human disease. In this study, microarray-based comparative genomic hybridization {(CGH)} was used to identify genomic differences among 31 E. coli {O157:H7} strains that belong to various phage types {(PTs)} and different lineage-specific polymorphism assay {(LSPA)} types.},
language = {en},
number = {1},
urldate = {2012-03-27},
journal = {{BMC} Genomics},
author = {Zhang, Yongxiang and Laing, Chad and Steele, Marina and Ziebell, Kim and Johnson, Roger and Benson, Andrew K and Taboada, Eduardo and Gannon, Victor {PJ}},
month = may,
year = {2007},
pages = {121}
}
@article{dorrell_whole_2001,
title = {Whole Genome Comparison of \emph{{Campylobacter jejuni}} Human Isolates Using a Low-Cost Microarray Reveals Extensive Genetic Diversity},
volume = {11},
issn = {1088-9051},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC311159/},
doi = {10.1101/gr.185801},
abstract = {Campylobacter jejuni is the leading cause of bacterial food-borne diarrhoeal disease throughout the world, and yet is still a poorly understood pathogen. Whole genome microarray comparisons of 11 C. jejuni strains of diverse origin identified genes in up to 30 {NCTC} 11168 loci ranging from 0.7 to 18.7 kb that are either absent or highly divergent in these isolates. Many of these regions are associated with the biosynthesis of surface structures including flagella, lipo-oligosaccharide, and the newly identified capsule. Other strain-variable genes of known function include those responsible for iron acquisition, {DNA} restriction/modification, and sialylation. In fact, at least 21\% of genes in the sequenced strain appear dispensable as they are absent or highly divergent in one or more of the isolates tested, thus defining 1300 C. jejuni core genes. Such core genes contribute mainly to metabolic, biosynthetic, cellular, and regulatory processes, but many virulence determinants are also conserved. Comparison of the capsule biosynthesis locus revealed conservation of all the genes in this region in strains with the same Penner serotype as strain {NCTC} 11168. By contrast, between 5 and 17 {NCTC} 11168 genes in this region are either absent or highly divergent in strains of a different serotype from the sequenced strain, providing further evidence that the capsule accounts for Penner serotype specificity. These studies reveal extensive genetic diversity among C. jejuni strains and pave the way toward identifying correlates of pathogenicity and developing improved epidemiological tools for this problematic pathogen.},
number = {10},
urldate = {2012-11-27},
journal = {Genome Research},
author = {Dorrell, Nick and Mangan, Joseph A. and Laing, Kenneth G. and Hinds, Jason and Linton, Dennis and Al-Ghusein, Hasan and Barrell, Bart G. and Parkhill, Julian and Stoker, Neil G. and Karlyshev, Andrey V. and Butcher, Philip D. and Wren, Brendan W.},
month = oct,
year = {2001},
note = {{PMID:} 11591647
{PMCID:} {PMC311159}},
pages = {1706--1715}
}
@article{musser_negligible_2000,
title = {Negligible genetic diversity of \emph{{Mycobacterium tuberculosis}} host immune system protein targets: evidence of limited selective pressure},
volume = {155},
issn = {0016-6731},
shorttitle = {Negligible genetic diversity of mycobacterium tuberculosis host immune system protein targets},
abstract = {A common theme in medical microbiology is that the amount of amino acid sequence variation in proteins that are targets of the host immune system greatly exceeds that found in metabolic enzymes or other housekeeping proteins. Twenty-four Mycobacterium tuberculosis genes coding for targets of the host immune system were sequenced in 16 strains representing the breadth of genomic diversity in the species. Of the 24 genes, 19 were invariant and only six polymorphic nucleotide sites were identified in the 5 genes that did have variation. The results document the highly unusual circumstance that prominent M. tuberculosis antigenic proteins have negligible structural variation worldwide. The data are best explained by a combination of three factors: (i) evolutionarily recent global dissemination in humans, (ii) lengthy intracellular quiescence, and (iii) active replication in relatively few fully immunocompetent hosts. The very low level of amino acid diversity in antigenic proteins may be cause for optimism in the difficult fight to control global tuberculosis.},
number = {1},
journal = {Genetics},
author = {Musser, J M and Amin, A and Ramaswamy, S},
month = may,
year = {2000},
note = {{PMID:} 10790380},
keywords = {Acyltransferases, Amino Acid Sequence, Antigens, Bacterial, Bacterial Proteins, Genetic Variation, Glycoproteins, Humans, Molecular Sequence Data, Mycobacterium tuberculosis, Sequence Homology, Amino Acid, Tuberculosis},
pages = {7--16}
},
@article{sreevatsan_restricted_1997,
title = {Restricted structural gene polymorphism in the \emph{{Mycobacterium tuberculosis}} complex indicates evolutionarily recent global dissemination},
volume = {94},
issn = {0027-8424},
abstract = {One-third of humans are infected with Mycobacterium tuberculosis, the causative agent of tuberculosis. Sequence analysis of two megabases in 26 structural genes or loci in strains recovered globally discovered a striking reduction of silent nucleotide substitutions compared with other human bacterial pathogens. The lack of neutral mutations in structural genes indicates that M. tuberculosis is evolutionarily young and has recently spread globally. Species diversity is largely caused by rapidly evolving insertion sequences, which means that mobile element movement is a fundamental process generating genomic variation in this pathogen. Three genetic groups of M. tuberculosis were identified based on two polymorphisms that occur at high frequency in the genes encoding catalase-peroxidase and the A subunit of gyrase. Group 1 organisms are evolutionarily old and allied with M. bovis, the cause of bovine tuberculosis. A subset of several distinct insertion sequence {IS6110} subtypes of this genetic group have {IS6110} integrated at the identical chromosomal insertion site, located between {dnaA} and {dnaN} in the region containing the origin of replication. Remarkably, study of approximately 6,000 isolates from patients in Houston and the New York City area discovered that 47 of 48 relatively large case clusters were caused by genotypic group 1 and 2 but not group 3 organisms. The observation that the newly emergent group 3 organisms are associated with sporadic rather than clustered cases suggests that the pathogen is evolving toward a state of reduced transmissability or virulence.},
number = {18},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
author = {Sreevatsan, S and Pan, X and Stockbauer, K E and Connell, N D and Kreiswirth, B N and Whittam, T S and Musser, J M},
month = sep,
year = {1997},
note = {{PMID:} 9275218},
keywords = {Alleles, Animals, Biological Evolution, Cattle, Genes, Bacterial, Humans, Mycobacterium tuberculosis, Polymorphism, Genetic},
pages = {9869--9874}
}
@article{wroblewska_outbreak_2004,
title = {Outbreak of nosocomial meningitis caused by \emph{{Acinetobacter baumannii}} in neurosurgical patients},
volume = {57},
issn = {0195-6701},
doi = {10.1016/j.jhin.2004.04.009},
abstract = {An outbreak of nosocomial meningitis caused by Acinetobacter baumannii, which developed postoperatively in seven neurosurgical patients is described. The clinical isolates of A. baumannii were typed by biochemical profiles and antibiogram patterns, and by random amplified polymorphic {DNA} polymerase chain reaction {(RAPD-PCR)} and amplified fragment length polymorphism {(AFLP)} fingerprinting. The implicated strain was multi-drug resistant, however, susceptibility to imipenem and netilmicin was detected. An extensive search for the environmental source of the epidemic strain was carried out. Two of several isolates from hospital environment, corresponded to the A. baumannii outbreak strain, one being cultured from the suctioning equipment used in the care of these patients. The introduction of multiresistant epidemic A. baumannii into a neurosurgical unit is a severe risk factor for patients undergoing neurosurgical procedures. Genotypic typing methods are important for definitive identification of these strains in patients and their environment.},
number = {4},
journal = {The Journal of Hospital Infection},
author = {Wroblewska, M M and Dijkshoorn, L and Marchel, H and van den Barselaar, M and Swoboda-Kopec, E and van den Broek, P J and Luczak, M},
month = aug,
year = {2004},
note = {{PMID:} 15262390},
keywords = {Acinetobacter baumannii, Acinetobacter Infections, Bacterial Typing Techniques, Cerebrospinal Fluid, Cluster Analysis, Cross Infection, Disease Outbreaks, {DNA} Fingerprinting, {DNA}, Bacterial, Drug Resistance, Multiple, Bacterial, Environmental Monitoring, Equipment Contamination, Genotype, Hospital Mortality, Humans, Infection Control, Meningitis, Bacterial, Microbial Sensitivity Tests, Neurosurgical Procedures, Polymorphism, Restriction Fragment Length, Random Amplified Polymorphic {DNA} Technique, Retrospective Studies, Risk Factors, Suction},
pages = {300--307}
},
@article{dijkshoorn_comparison_1996,
title = {Comparison of outbreak and nonoutbreak \emph{{Acinetobacter baumannii}} strains by genotypic and phenotypic methods.},
volume = {34},
issn = {0095-1137},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC229053/},
abstract = {Thirty-one Acinetobacter baumannii strains, comprising 14 strains from 14 outbreaks in different northwestern European cities and 17 sporadic strains, were compared by investigating various properties of the strains including biotype, antibiogram, cell envelope protein electrophoretic profile, ribotype pattern, and the band pattern generated by a novel genomic fingerprinting method, named {AFLP}, which is based on the selective amplification of restriction fragments. Results showed that 12 strains from unrelated outbreaks were linked together in two clusters according to their similarities by these typing methods, whereas sporadic strains were more heterogeneous. Outbreak strains appeared to be markedly more resistant to antibiotics than nonoutbreak strains. The uniformity of typing characters in two sets of outbreak strains suggests that strains in each cluster have a common clonal origin.},
number = {6},
urldate = {2012-11-27},
journal = {Journal of Clinical Microbiology},
author = {Dijkshoorn, L and Aucken, H and Gerner-Smidt, P and Janssen, P and Kaufmann, M E and Garaizar, J and Ursing, J and Pitt, T L},
month = jun,
year = {1996},
note = {{PMID:} 8735109
{PMCID:} {PMC229053}},
pages = {1519--1525}
},
@article{nemec_long-term_2004,
title = {Long-term predominance of two pan-{European} clones among multi-resistant \emph{{Acinetobacter baumannii}} strains in the {Czech Republic}},
volume = {53},
issn = {0022-2615, 1473-5644},
url = {http://jmm.sgmjournals.org/content/53/2/147},
doi = {10.1099/jmm.0.05445-0},
abstract = {In a recent study, a large proportion of multi-drug-resistant {(MDR)} Acinetobacter baumannii strains that were isolated from hospitalized patients in the Czech Republic was found to belong to two major groups {(A} and B). These groups appeared to be similar to epidemic clones I and {II}, respectively, which were identified previously among outbreak strains from north-western European hospitals. The aim of the present study was to assess in detail the genetic relatedness of Czech A. baumannii strains and those of epidemic clones I and {II} by using ribotyping with {HindIII} and {HincII} and by {AFLP} fingerprinting. The study collection included 70 {MDR} strains that were isolated in 30 Czech hospitals in 1991–2001, 15 susceptible Czech strains from 1991 to 1996 and 13 reference strains of clones I and {II} from 1982 to 1990. One major {HindIII/HincIII} ribotype {(R1-1)} was observed in 38 {MDR} Czech strains and eight reference strains of clone I, whereas another major ribotype {(R2-2)} was observed in 11 {MDR} Czech strains and in three reference strains of clone {II.} A selection of 59 Czech strains (representative of all ribotypes) and the 13 reference strains were investigated by {AFLP} fingerprinting. At a clustering level of 83 \%, two large clusters could be distinguished: cluster 1 included all reference strains of clone I and 25 {MDR} Czech strains, whilst cluster 2 contained all reference strains of clone {II} and 11 {MDR} Czech strains. There was a clear correlation between the groupings by {AFLP} analysis and by ribotyping, as all strains with ribotype R1-1 and four strains with slightly different ribotypes were found in {AFLP} cluster 1, whereas all strains with ribotype R2-2 and seven strains with similar ribotypes were in {AFLP} cluster 2. Thus, 41 and 21 {MDR} Czech strains could be classified as belonging to clones I and {II}, respectively. The remaining eight {MDR} and 15 susceptible strains were highly heterogeneous and were distinct from clones I and {II} by both {AFLP} fingerprinting and ribotyping. These results indicate that the two predominant groups observed among {MDR} Czech A. baumannii strains from the 1990s are genetically congruent with the north-western European epidemic clones that were found in the 1980s. Recognition of these clinically relevant, widespread clones is important in infection prevention and control; they are also interesting subjects to study genetic mechanisms that give rise to their antibiotic resistance and epidemic behaviour.},
language = {en},
number = {2},
urldate = {2012-11-27},
journal = {Journal of Medical Microbiology},
author = {Nemec, Alexandr and Dijkshoorn, Lenie and Reijden, Tanny J. K. van der},
month = feb,
year = {2004},
pages = {147--153}
},
@article{dagata_comparison_2001,
title = {Comparison of Pulsed‐Field Gel Electrophoresis and Amplified Fragment‐Length Polymorphism for Epidemiological Investigations of Common Nosocomial Pathogens},
volume = {22},
copyright = {Copyright © 2001 The University of Chicago Press},
issn = {0899-{823X}},
url = {http://www.jstor.org/stable/10.1086/501950},
doi = {10.1086/501950},
abstract = {{OBJECTIVE.}  To compare molecular typing by amplified fragment‐length polymorphism {(AFLP)} analysis with pulsed‐field gel electrophoresis {(PFGE)} with respect to the ability to differentiate between epidemiologically related and unrelated isolates of common nosocomial pathogens recovered during a period of endemicity. {DESIGN.}  Retrospective laboratory analysis. {SETTING.}  Tertiary‐care institution. {METHODS.}  17 isolates of Acinetobacter baumannii, 22 isolates of Pseudomonas aeruginosa, and 22 vancomycin‐resistant Enterococcus faecium {(VRE)} were typed by both methods. {RESULTS.}  {AFLP} generated comparable results to {PFGE} for A baumannii and P aeruginosa isolates; both methods identified epidemiologically related and unrelated isolates. However, strain typing of {VRE} isolates produced discordant results between the two methods. {PFGE} identified 10 different strain types and differentiated between all epidemiologically related and unrelated isolates. In contrast, {AFLP} generated only five different strain types, three of which contained both epidemiologically related and unrelated isolates. {CONCLUSION.}  Molecular typing by {AFLP} is comparable to {PFGE} for A baumannii and P aeruginosa isolates. For {VRE} isolates, however, {PFGE} remains the method of choice..
note = {{ArticleType:} research-article / Full publication date: September 2001 / Copyright © 2001 The University of Chicago Press},},
number = {9},
urldate = {2012-11-27},
journal = {Infection Control and Hospital Epidemiology},
author = {{D'Agata}, Erika {M.C.} and Gerrits, Monique M. and Tang, {Yi‐Wei} and Samore, M. and Kusters, Johannes G.},
month = sep,
year = {2001},
pages = {550--554}
},
@article{janssen_discrimination_1997,
title = {Discrimination of \emph{{Acinetobacter}} genomic species by {AFLP} fingerprinting},
volume = {47},
issn = {0020-7713},
abstract = {{AFLP} is a novel genomic fingerprinting method based on the selective {PCR} amplification of restriction fragments. The usability of this method for the differentiation of genomic species in the genus Acinetobacter was investigated. A total of 151 classified strains (representing 18 genomic species, including type, reference, and field strains) and 8 unclassified strains were analyzed. By using a single set of restriction enzymes {(HindIII} and {TaqI)} and one particular set of selective {PCR} primers, all strains could be allocated to the correct genomic species and all groups were properly separated, with minimal intraspecific similarity levels ranging from 29 to 74\%. Strains belonging to genomic species 8 {(Acinetobacter} lwoffii sensu stricto) and 9 grouped together in one cluster. The closely related {DNA} groups 1 {(Acinetobacter} calcoaceticus), 2 {(Acinetobacter} baumannii), 3 and {13TU} (sensu Tjernberg \& Ursing 1989) were clearly distinguishable, with intraspecific linkage levels above 50\%. Strains of the independently described genomic species {13BJ} (sensu Bouvet \& Jeanjean 1989) and {14TU} linked together at a relatively low level (33\%). Although a previous {DNA-DNA} hybridization study seemed to justify the unification of these genomic species, {AFLP} analysis actually divides the {13BJ-14TU} group into three well-separated subgroups. Finally, four unclassified strains obtained from diverse sources and origins grouped convincingly together, with a similarity linkage level of approximately 50\%. These strains showed no similarities in their {AFLP} patterns with any of the other 155 strains studied and may represent a thus-far-undescribed Acinetobacter species. Based on these results, {AFLP} should be regarded as an important auxiliary method for the delineation of genomic species. Furthermore, because {AFLP} provides a detailed insight into the infraspecific structure of Acinetobacter taxa, the method also represents a highly effective means for the confirmation of strain identity in the epidemiology of acinetobacters.},
number = {4},
journal = {International Journal of Systematic Bacteriology},
author = {Janssen, P and Maquelin, K and Coopman, R and Tjernberg, I and Bouvet, P and Kersters, K and Dijkshoorn, L},
month = oct,
year = {1997},
note = {{PMID:} 9336926},
keywords = {Acinetobacter, Cluster Analysis, {DNA} Fingerprinting, {DNA}, Bacterial, Genome, Bacterial, Polymerase Chain Reaction},
pages = {1179--1187}
},
@article{vos_aflp_1995,
title = {{AFLP:} a new technique for {DNA} fingerprinting.},
volume = {23},
issn = {0305-1048},
shorttitle = {{AFLP}},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC307397/},
abstract = {A novel {DNA} fingerprinting technique called {AFLP} is described. The {AFLP} technique is based on the selective {PCR} amplification of restriction fragments from a total digest of genomic {DNA.} The technique involves three steps: (i) restriction of the {DNA} and ligation of oligonucleotide adapters, (ii) selective amplification of sets of restriction fragments, and (iii) gel analysis of the amplified fragments. {PCR} amplification of restriction fragments is achieved by using the adapter and restriction site sequence as target sites for primer annealing. The selective amplification is achieved by the use of primers that extend into the restriction fragments, amplifying only those fragments in which the primer extensions match the nucleotides flanking the restriction sites. Using this method, sets of restriction fragments may be visualized by {PCR} without knowledge of nucleotide sequence. The method allows the specific co-amplification of high numbers of restriction fragments. The number of fragments that can be analyzed simultaneously, however, is dependent on the resolution of the detection system. Typically 50-100 restriction fragments are amplified and detected on denaturing polyacrylamide gels. The {AFLP} technique provides a novel and very powerful {DNA} fingerprinting technique for {DNAs} of any origin or complexity.},
number = {21},
urldate = {2012-11-27},
journal = {Nucleic Acids Research},
author = {Vos, P and Hogers, R and Bleeker, M and Reijans, M and van de Lee, T and Hornes, M and Frijters, A and Pot, J and Peleman, J and Kuiper, M},
month = nov,
year = {1995},
note = {{PMID:} 7501463
{PMCID:} {PMC307397}},
pages = {4407--4414}
},
@article{vaneechoutte_comparison_1998,
title = {Comparison of {PCR-based} {DNA} fingerprinting techniques for the identification of \emph{{Listeria}} species and their use for atypical \emph{{Listeria}} isolates},
volume = {48},
issn = {1466-5026, 1466-5034},
url = {http://ijs.sgmjournals.org/content/48/1/127},
doi = {10.1099/00207713-48-1-127},
language = {en},
number = {1},
urldate = {2012-11-27},
journal = {International Journal of Systematic Bacteriology},
author = {Vaneechoutte, Mario and Boerlin, Patrick and Tichy, Hans-Volker and Bannerman, Elizabeth and Jäger, Birgit and Bille, Jacques},
month = jan,
year = {1998},
pages = {127--139}
}
@article{wang_rapd_1993,
title = {{RAPD} (arbitrary primer) {PCR} is more sensitive than multilocus enzyme electrophoresis for distinguishing related bacterial strains},
volume = {21},
issn = {0305-1048, 1362-4962},
url = {http://nar.oxfordjournals.org/content/21/25/5930},
doi = {10.1093/nar/21.25.5930},
abstract = {The {RAPD} (random amplified polymorphic {DNA)} fingerprinting method, which utilizes low stringency {PCR} amplification with single primers of arbitrary sequence to generate strain-specific arrays of anonymous {DNA} fragments, was calibrated relative to the widely used, protein-based multilocus enzyme electrophoretic {(MLEE)} typing method. {RAPD} fingerprinting was carried out on five isolates from each of 15 major groups of Escherichia coli strains that cause diarrheal disease worldwide (75 isolates in all). Each group consisted of isolates that were not distinguishable from one another by {MLEE} typing using 20 diagnostic enzyme markers. In our {RAPD} tests, three or more distinct subgroups in each {MLEE} group were distinguished with each of five primers, and 74 of the 75 isolates were distinguished when data obtained with five primers were combined. Thus, {RAPD} typing is far more sensitive than {MLEE} typing for discriminating among related strains of a species. Despite their different sensitivities, the same general relationships among strains were inferred from {MLEE} and {RAPD} data. Thus, our results recommend use of the {RAPD} method for studies of bacterial population genetic structure and evolution, as well as for epidemiology.},
language = {en},
number = {25},
urldate = {2012-11-27},
journal = {Nucleic Acids Research},
author = {Wang, Gan and Whittam, Thomas S. and Berg, Claire M. and Berg, Douglas E.},
month = dec,
year = {1993},
pages = {5930--5933}
}
@article{taboada_comparative_2008,
title = {Comparative genomic assessment of Multi-Locus Sequence Typing: rapid accumulation of genomic heterogeneity among clonal isolates of \emph{{Campylobacter jejuni}}},
volume = {8},
issn = {1471-2148},
shorttitle = {Comparative genomic assessment of Multi-Locus Sequence Typing},
doi = {10.1186/1471-2148-8-229},
abstract = {{BACKGROUND}
Multi-Locus Sequence Typing {(MLST)} has emerged as a leading molecular typing method owing to its high ability to discriminate among bacterial isolates, the relative ease with which data acquisition and analysis can be standardized, and the high portability of the resulting sequence data. While {MLST} has been successfully applied to the study of the population structure for a number of different bacterial species, it has also provided compelling evidence for high rates of recombination in some species. We have analyzed a set of Campylobacter jejuni strains using {MLST} and Comparative Genomic Hybridization {(CGH)} on a full-genome microarray in order to determine whether recombination and high levels of genomic mosaicism adversely affect the inference of strain relationships based on the analysis of a restricted number of genetic loci.
{RESULTS}
Our results indicate that, in general, there is significant concordance between strain relationships established by {MLST} and those based on shared gene content as established by {CGH.} While {MLST} has significant predictive power with respect to overall genome similarity of isolates, we also found evidence for significant differences in genomic content among strains that would otherwise appear to be highly related based on their {MLST} profiles.
{CONCLUSION}
The extensive genomic mosaicism between closely related strains has important implications in the context of establishing strain to strain relationships because it suggests that the exact gene content of strains, and by extension their phenotype, is less likely to be "predicted" based on a small number of typing loci. This in turn suggests that a greater emphasis should be placed on analyzing genes of clinical interest as we forge ahead with the next generation of molecular typing methods.},
journal = {{BMC} Evolutionary Biology},
author = {Taboada, Eduardo N and Mackinnon, Joanne M and Luebbert, Christian C and Gannon, Victor P J and Nash, John H E and Rahn, Kris},
year = {2008},
note = {{PMID:} 18691421},
keywords = {Bacterial Typing Techniques, Base Sequence, Campylobacter jejuni, Conserved Sequence, {DNA}, Bacterial, Genetic Linkage, Genetic Variation, Genome, Bacterial, Oligonucleotide Array Sequence Analysis, Phylogeny, Recombination, Genetic, Sequence Analysis, {DNA}},
pages = {229}
}
@article{francisco_global_2009,
title = {Global optimal {eBURST} analysis of multilocus typing data using a graphic matroid approach},
volume = {10},
copyright = {2009 Francisco et al; licensee {BioMed} Central Ltd.},
issn = {1471-2105},
url = {http://www.biomedcentral.com/1471-2105/10/152/abstract},
doi = {10.1186/1471-2105-10-152},
abstract = {Multilocus Sequence Typing {(MLST)} is a frequently used typing method for the analysis of the clonal relationships among strains of several clinically relevant microbial species. {MLST} is based on the sequence of housekeeping genes that result in each strain having a distinct numerical allelic profile, which is abbreviated to a unique identifier: the sequence type {(ST).} The relatedness between two strains can then be inferred by the differences between allelic profiles. For a more comprehensive analysis of the possible patterns of evolutionary descent, a set of rules were proposed and implemented in the {eBURST} algorithm. These rules allow the division of a data set into several clusters of related strains, dubbed clonal complexes, by implementing a simple model of clonal expansion and diversification. Within each clonal complex, the rules identify which links between {STs} correspond to the most probable pattern of descent. However, the {eBURST} algorithm is not globally optimized, which can result in links, within the clonal complexes, that violate the rules proposed.},
language = {en},
number = {1},
urldate = {2012-11-27},
journal = {{BMC} Bioinformatics},
author = {Francisco, Alexandre and Bugalho, Miguel and Ramirez, Mário and Carriço, João},
month = may,
year = {2009},
pages = {152}
}
@article{feil_eburst_2004,
title = {{eBURST:} Inferring Patterns of Evolutionary Descent among Clusters of Related Bacterial Genotypes from Multilocus Sequence Typing Data},
volume = {186},
issn = {0021-9193, 1098-5530},
shorttitle = {{eBURST}},
url = {http://jb.asm.org/content/186/5/1518},
doi = {10.1128/JB.186.5.1518-1530.2004},
abstract = {The introduction of multilocus sequence typing {(MLST)} for the precise characterization of isolates of bacterial pathogens has had a marked impact on both routine epidemiological surveillance and microbial population biology. In both fields, a key prerequisite for exploiting this resource is the ability to discern the relatedness and patterns of evolutionary descent among isolates with similar genotypes. Traditional clustering techniques, such as dendrograms, provide a very poor representation of recent evolutionary events, as they attempt to reconstruct relationships in the absence of a realistic model of the way in which bacterial clones emerge and diversify to form clonal complexes. An increasingly popular approach, called {BURST}, has been used as an alternative, but present implementations are unable to cope with very large data sets and offer crude graphical outputs. Here we present a new implementation of this algorithm, {eBURST}, which divides an {MLST} data set of any size into groups of related isolates and clonal complexes, predicts the founding (ancestral) genotype of each clonal complex, and computes the bootstrap support for the assignment. The most parsimonious patterns of descent of all isolates in each clonal complex from the predicted founder(s) are then displayed. The advantages of {eBURST} for exploring patterns of evolutionary descent are demonstrated with a number of examples, including the simple {Spain23F-1} clonal complex of Streptococcus pneumoniae, “population snapshots” of the entire S. pneumoniae and Staphylococcus aureus {MLST} databases, and the more complicated clonal complexes observed for Campylobacter jejuni and Neisseria meningitidis.},
language = {en},
number = {5},
urldate = {2012-11-27},
journal = {Journal of Bacteriology},
author = {Feil, Edward J. and Li, Bao C. and Aanensen, David M. and Hanage, William P. and Spratt, Brian G.},
month = mar,
year = {2004},
pages = {1518--1530}
}
@article{killgore_comparison_2008,
title = {Comparison of Seven Techniques for Typing International Epidemic Strains of \emph{{Clostridium difficile}}: Restriction Endonuclease Analysis, Pulsed-Field Gel Electrophoresis, {PCR}-Ribotyping, Multilocus Sequence Typing, Multilocus Variable-Number Tandem-Repeat Analysis, Amplified Fragment Length Polymorphism, and Surface Layer Protein {A} Gene Sequence Typing},
volume = {46},
issn = {0095-1137, 1098-{660X}},
shorttitle = {Comparison of Seven Techniques for Typing International Epidemic Strains of Clostridium difficile},
url = {http://jcm.asm.org/content/46/2/431},
doi = {10.1128/JCM.01484-07},
abstract = {Using 42 isolates contributed by laboratories in Canada, The Netherlands, the United Kingdom, and the United States, we compared the results of analyses done with seven Clostridium difficile typing techniques: multilocus variable-number tandem-repeat analysis {(MLVA)}, amplified fragment length polymorphism {(AFLP)}, surface layer protein A gene sequence typing {(slpAST)}, {PCR-ribotyping}, restriction endonuclease analysis {(REA)}, multilocus sequence typing {(MLST)}, and pulsed-field gel electrophoresis {(PFGE).} We assessed the discriminating ability and typeability of each technique as well as the agreement among techniques in grouping isolates by allele profile A {(AP-A)} through {AP-F}, which are defined by toxinotype, the presence of the binary toxin gene, and deletion in the {tcdC} gene. We found that all isolates were typeable by all techniques and that discrimination index scores for the techniques tested ranged from 0.964 to 0.631 in the following order: {MLVA}, {REA}, {PFGE}, {slpAST}, {PCR-ribotyping}, {MLST}, and {AFLP.} All the techniques were able to distinguish the current epidemic strain of C. difficile {(BI/027/NAP1)} from other strains. All of the techniques showed multiple types for {AP-A} (toxinotype 0, binary toxin negative, and no {tcdC} gene deletion). {REA}, {slpAST}, {MLST}, and {PCR-ribotyping} all included {AP-B} (toxinotype {III}, binary toxin positive, and an 18-bp deletion in {tcdC)} in a single group that excluded other {APs.} {PFGE}, {AFLP}, and {MLVA} grouped two, one, and two different non-{AP-B} isolates, respectively, with their {AP-B} isolates. All techniques appear to be capable of detecting outbreak strains, but only {REA} and {MLVA} showed sufficient discrimination to distinguish strains from different outbreaks.},
language = {en},
number = {2},
urldate = {2012-11-27},
journal = {Journal of Clinical Microbiology},
author = {Killgore, George and Thompson, Angela and Johnson, Stuart and Brazier, Jon and Kuijper, Ed and Pepin, Jacques and Frost, Eric H. and Savelkoul, Paul and Nicholson, Brad and Berg, Renate J. van den and Kato, Haru and Sambol, Susan P. and Zukowski, Walter and Woods, Christopher and Limbago, Brandi and Gerding, Dale N. and {McDonald}, L. Clifford},
month = feb,
year = {2008},
pages = {431--437}
}
@article{whittam_geographic_1983,
title = {Geographic components of linkage disequilibrium in natural populations of \emph{{Escherichia coli}}},
volume = {1},
issn = {0737-4038},
abstract = {Geographic variation in the genetic structure of natural enteric populations of Escherichia coli was assessed at both the single-locus and dilocus levels from allozyme genotypes at 12 enzyme loci in 178 cell lines isolated from human hosts in Sweden, Iowa, and Tonga. Although there was significant heterogeneity in allele frequencies at six of the 12 loci, geographic variation accounted for only 2.0\% of the total genetic diversity {(HT} = 0.518). Ohta's D-statistics were used to partition the total variance of dilocus linkage disequilibrium into within-population and between-population components. The observed total variance in disequilibrium (0.0339), averaged over 66 locus-pairs, was significantly greater than would be expected (0.0103) if alleles were randomly associated in an unstructured total population; and both within-locality and between-locality components made substantial contributions to the total variance. Half the locus-pairs exhibited the specific dual relationship among components expected when random factors are generating disequilibrium, but 20\% of the locus-pairs showed the opposite relationship, reflecting systematic allele associations. The magnitude of dilocus disequilibrium apparently is unrelated to the chromosomal distance between loci. This and other evidence indicates that substitutive recombination rates in natural populations are sufficiently low to permit indirect periodic selection to play a prominent role in generating multilocus genetic structure.},
number = {1},
journal = {Molecular Biology and Evolution},
author = {Whittam, T S and Ochman, H and Selander, R K},
month = dec,
year = {1983},
note = {{PMID:} 6400648},
keywords = {Escherichia coli, Genetic Linkage, Genetic Variation, Humans, Iowa, Sweden, Tonga},
pages = {67--83}
}
@article{selander_population_1987,
title = {Population genetics of pathogenic bacteria},
volume = {3},
issn = {0882-4010},
url = {http://www.sciencedirect.com/science/article/pii/0882401087900325},
doi = {10.1016/0882-4010(87)90032-5},
number = {1},
urldate = {2012-11-27},
journal = {Microbial Pathogenesis},
author = {Selander, Robert K. and Musser, James M. and Caugant, Dominique A. and Gilmour, Marion N. and Whittam, Thomas S.},
month = jul,
year = {1987},
pages = {1--7}
}
@article{selander_methods_1986,
title = {Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics.},
volume = {51},
issn = {0099-2240},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC238981/},
abstract = {Images
null},
number = {5},
urldate = {2012-11-27},
journal = {Applied and Environmental Microbiology},
author = {Selander, R K and Caugant, D A and Ochman, H and Musser, J M and Gilmour, M N and Whittam, T S},
month = may,
year = {1986},
note = {{PMID:} 2425735
{PMCID:} {PMC238981}},
pages = {873--884}
}
@article{aeschbacher_population_1989,
title = {Population genetics of human and animal enteric \emph{{Campylobacter}} strains.},
volume = {57},
issn = {0019-9567, 1098-5522},
url = {http://iai.asm.org/content/57/5/1432},
abstract = {A total of 125 strains of Campylobacter jejuni and Campylobacter coli from human and animal hosts were analyzed by multilocus enzyme electrophoresis. Ten genetic loci were characterized by the electrophoretic mobilities of their products, and all were found to be polymorphic. The nine loci considered for genetic analysis had an average allele number of 6.9 and a mean genetic diversity of 0.634. The strains were grouped into 64 electrophoretic types {(ETs)} forming two principal clusters; the first cluster consisted of 50 {ETs} represented by 104 isolates of C.jejuni, and the second included 14 {ETs} represented by 21 isolates of C. coli. The genetic distance between the two species was 0.939. The data support the conclusions that (i) campylobacteriosis caused by C. jejuni and C. coli is a zoonosis, (ii) human and animal strains do not constitute subpopulations, and (iii) every animal strain may be considered a potential human pathogen. The frequency of intraspecies gene transfer seems to be moderately high whereas interspecies gene transfer is very rare at best, which suggests the existence of a biological barrier between C. jejuni and C. coli.},
language = {en},
number = {5},
urldate = {2012-11-25},
journal = {Infection and Immunity},
author = {Aeschbacher, M. and Piffaretti, J. C.},
month = may,
year = {1989},
pages = {1432--1437}
}
@article{smith_localized_1991,
title = {Localized sex in bacteria},
volume = {349},
copyright = {© 1991 Nature Publishing Group},
issn = {\${{footerJournalISSN}}},
url = {http://0-www.nature.com.darius.uleth.ca/nature/journal/v349/n6304/abs/349029a0.html},
doi = {10.1038/349029a0},
number = {6304},
urldate = {2012-11-26},
author = {Smith, John Maynard and Dowson, Christopher G. and Spratt, Brian G.},
month = jan,
year = {1991},
pages = {29--31}
}
@article{wentworth_bacteriophage_1963,
title = {Bacteriophage Typing Of The Staphylococci},
volume = {27},
issn = {0005-3678},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC441186/},
number = {3},
urldate = {2012-11-26},
journal = {Bacteriological Reviews},
author = {Wentworth, Berttina B.},
month = sep,
year = {1963},
note = {{PMID:} 14063853
{PMCID:} {PMC441186}},
pages = {253--272}
}
@article{aarts_discrepancy_1995,
title = {Discrepancy between Penner serotyping and polymerase chain reaction fingerprinting of \emph{{Campylobacter}} isolated from poultry and other animal sources},
volume = {20},
issn = {0266-8254},
abstract = {Thirty-four Campylobacter jejuni or coli strains, isolated from various livestock and darkling beetles from two Dutch poultry farms during different broiler production cycles, were subjected to Penner serotyping and polymerase chain reaction {(PCR)} fingerprint analysis. Ten different Penner serotypes were determined in the isolates. Visual scoring of the {PCR} fingerprints resulted in 14 clearly different profiles. Some strains with identical Penner serotypes exhibited different {PCR} fingerprints and conversely strains with different serotypes produced identical {PCR} fingerprints. Discrepancies between Penner serotyping and {PCR} fingerprinting were most obvious between isolates from different animal sources. Indications for the occurrence of genomic rearrangements were found. The inconsistency between serotyping and fingerprinting of Campylobacter strains suggests that conventional typing methods should be used in combination with fingerprinting if the epidemiological factors that contribute to Campylobacter colonization of live chickens are to be assessed reliably.},
number = {6},
journal = {Letters in Applied Microbiology},
author = {Aarts, H J and van Lith, L A and Jacobs-Reitsma, W F},
month = jun,
year = {1995},
note = {{PMID:} 7786504},
keywords = {Animals, Bacterial Typing Techniques, Beetles, Campylobacter, Chickens, {DNA} Fingerprinting, {DNA}, Bacterial, Feces, Polymerase Chain Reaction},
pages = {371--374}
}
@article{genus_salmonella_1934,
title = {The Genus Salmonella Ligni\`eres, 1900},
author = {{Salmonella Subcommittee of the Nomenclature Committee of the International Society for Microbiology}},
volume = {34},
issn = {0022-1724},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2170865/},
number = {3},
urldate = {2012-11-26},
journal = {The Journal of Hygiene},
month = oct,
year = {1934},
note = {{PMID:} 20475239
{PMCID:} {PMC2170865}},
pages = {333--350}
}
@article{lancefield_serological_1933,
title = {A Serological Differentiation of Human and Other Groups of Hemolytic Streptococci},
volume = {57},
issn = {0022-1007, 1540-9538},
url = {http://jem.rupress.org/content/57/4/571},
doi = {10.1084/jem.57.4.571},
abstract = {1. All except two of 106 strains of hemolytic streptococci isolated from man, other animals, milk, and cheese have been classified into five groups, which bear a definite relationship to the sources of the cultures. These broad groups may be subdivided into specific types by methods discussed elsewhere. The specific group classification is made possible by employing two special reagents: (a) extracts prepared by treatment of the bacteria with hot hydrochloric acid, and (b) serum of animals immunized with formalinized cultures. This differentiation is not detected by the agglutination reaction. The grouping agrees with that described by other investigators on the basis of cultural and biochemical characteristics.
2. The group-specific substance present in strains of Group A has been identified chemically as carbohydrate in nature. The chemical composition of the specific substances upon which the specificity of the other groups depends has not been determined. It seems not unlikely, however, that all of them may belong in the general class of carbohydrates, each being chemically distinct and serologically specific in the individual groups.},
language = {en},
number = {4},
urldate = {2012-11-26},
journal = {The Journal of Experimental Medicine},
author = {Lancefield, Rebecca C.},
month = apr,
year = {1933},
pages = {571--595}
}
@article{smith_how_1993,
title = {How clonal are bacteria?},
volume = {90},
issn = {0027-8424, 1091-6490},
url = {http://www.pnas.org/content/90/10/4384},
doi = {10.1073/pnas.90.10.4384},
abstract = {Data from multilocus enzyme electrophoresis of bacterial populations were analyzed using a statistical test designed to detect associations between genes at different loci. Some species (e.g., Salmonella) were found to be clonal at all levels of analysis. At the other extreme, Neisseria gonorrhoeae is panmictic, with random association between loci. Two intermediate types of population structure were also found. Neisseria meningitidis displays what we have called an "epidemic" structure. There is significant association between loci, but this arises only because of the recent, explosive, increase in particular electrophoretic types; when this effect is eliminated the population is found to be effectively panmictic. In contrast, linkage disequilibrium in a population of Rhizobium meliloti exists because the sample consisted of two genetically isolated divisions, often fixed for different alleles: within each division association between loci was almost random. The method of analysis is appropriate whenever there is doubt about the extent of genetic recombination between members of a population. To illustrate this we analyzed data on protozoan parasites and again found panmictic, epidemic, and clonal population structures.},
language = {en},
number = {10},
urldate = {2012-11-24},
journal = {Proceedings of the National Academy of Sciences},
author = {Smith, J. M. and Smith, N. H. and {O'Rourke}, M. and Spratt, B. G.},
month = may,
year = {1993},
pages = {4384--4388}
}
@article{griffith_significance_1928,
title = {The Significance of Pneumococcal Types},
volume = {27},
doi = {10.1017/S0022172400031879},
number = {02},
journal = {Epidemiology \& Infection},
author = {Griffith, Fred},
year = {1928},
pages = {113--159}
}
@article{perna_genome_2001,
title = {Genome sequence of enterohaemorrhagic \emph{{Escherichia coli}} {O157:H7}},
volume = {409},
issn = {0028-0836},
shorttitle = {Genome sequence of enterohaemorrhagic Escherichia coli O157},
url = {http://dx.doi.org/10.1038/35054089},
doi = {10.1038/35054089},
number = {6819},
urldate = {2010-10-14},
journal = {Nature},
author = {Perna, Nicole T. and Plunkett, Guy and Burland, Valerie and Mau, Bob and Glasner, Jeremy D. and Rose, Debra J. and Mayhew, George F. and Evans, Peter S. and Gregor, Jason and Kirkpatrick, Heather A. and Posfai, Gyorgy and Hackett, Jeremiah and Klink, Sara and Boutin, Adam and Shao, Ying and Miller, Leslie and Grotbeck, Erik J. and Davis, N. Wayne and Lim, Alex and Dimalanta, Eileen T. and Potamousis, Konstantinos D. and Apodaca, Jennifer and Anantharaman, Thomas S. and Lin, Jieyi and Yen, Galex and Schwartz, David C. and Welch, Rodney A. and Blattner, Frederick R.},
month = jan,
year = {2001},
keywords = {astronomy, astrophysics, biochemistry, Bioinformatics, biology, Biotechnology, cancer, Cell Cycle, cell signalling, climate change, Computational Biology, development, developmental biology, {DNA}, Drug Discovery, earth science, Ecology, environmental science, Evolution, evolutionary biology, Functional genomics, genetics, Genomics, geophysics, immunology, interdisciplinary science, life, marine biology, materials science, medical research, medicine, metabolomics, Molecular Biology, molecular interactions, nanotechnology, Nature, neurobiology, neuroscience, palaeobiology, pharmacology, physics, Proteomics, quantum physics, {RNA}, science, science news, science policy, Signal Transduction, structural biology, Systems biology, transcriptomics},
pages = {529--533}
}
@article{goering_pulsed_2010,
title = {Pulsed field gel electrophoresis: A review of application and interpretation in the molecular epidemiology of infectious disease},
volume = {10},
issn = {1567-1348},
shorttitle = {Pulsed field gel electrophoresis},
url = {http://www.sciencedirect.com/science/article/pii/S156713481000211X},
doi = {10.1016/j.meegid.2010.07.023},
abstract = {Over the years, approaches to the epidemiological analysis of infectious disease have undergone a remarkable evolutionary transition moving from phenotypic to molecular in nature. As discussed here, the quest for a clearer comparison of genomic relatedness between bacterial clinical isolates has involved four generations of molecular iteration. First generation plasmid analysis gave way to a second generation use of restriction enzymes and probes. This was followed by third generation pulsed field gel electrophoresis {(PFGE)} and {PCR-based} methods with movement now to fourth-generation {DNA} sequence-based approaches. Remarkably, despite (or perhaps because of) its more than 20-year history as a typing method, {PFGE} has demonstrated exceptional staying power. The reasons for this endurance as well as the pros and cons of {PFGE} use are examined in this review. In broad context the history and technology behind {PFGE} are considered. Issues commonly influencing the quality of {PFGE} data and its analysis are discussed. Specifics regarding the mechanics of {DNA} preparation, restriction-enzyme digestion, and proper conditions for electrophoresis are detailed and, most importantly for any approach to epidemiological assessment, issues regarding the analysis and interpretation of {PFGE} data are explored.},
number = {7},
urldate = {2012-11-23},
journal = {Infection, Genetics and Evolution},
author = {Goering, Richard V.},
month = oct,
year = {2010},
keywords = {Epidemiology, Molecular Typing, {PFGE}},
pages = {866--875}
}
% PFGE PulseNet - E coli, Vibrio parahaemolyticus
@article{ribot_standardization_2006,
title = {Standardization of pulsed-field gel electrophoresis protocols for the subtyping of \emph{{Escherichia coli}} {O157:H7}, \emph{{Salmonella}}, and \emph{{Shigella}} for {PulseNet}},
volume = {3},
issn = {1535-3141},
shorttitle = {Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157},
doi = {10.1089/fpd.2006.3.59},
abstract = {Standardized rapid pulsed-field gel electrophoresis {(PFGE)} protocols for the subtyping of Escherichia coli {O157:H7}, Salmonella serotypes, and Shigella species are described. These protocols are used by laboratories in {PulseNet}, a network of state and local health departments, and other public health laboratories that perform real-time {PFGE} subtyping of these bacterial foodborne pathogens for surveillance and outbreak investigations. Development and standardization of these protocols consisted of a thorough optimization of reagents and reaction conditions to ensure that the protocols yielded consistent results and high-quality {PFGE} pattern data in all the {PulseNet} participating laboratories. These rapid {PFGE} protocols are based on the original 3-4-day standardized procedure developed at Centers for Disease Control and Prevention that was validated in 1996 and 1997 by eight independent laboratories. By using these rapid standardized {PFGE} protocols, {PulseNet} laboratories are able to subtype foodborne pathogens in approximately 24 h, allowing for the early detection of foodborne disease case clusters and often aiding in the identification of the source responsible for the infections.},
number = {1},
journal = {Foodborne Pathogens and Disease},
author = {Ribot, Efrain M and Fair, M A and Gautom, R and Cameron, D N and Hunter, S B and Swaminathan, B and Barrett, Timothy J},
year = {2006},
note = {{PMID:} 16602980},
keywords = {Cluster Analysis, Electrophoresis, Gel, Pulsed-Field, Escherichia coli O157, Food Microbiology, Laboratories, Molecular Epidemiology, Phylogeny, Public Health, Reproducibility of Results, Salmonella, Sensitivity and Specificity, Serotyping, Shigella},
pages = {59--67}
},
@article{parsons_pulsenet_2007,
title = {{PulseNet} {USA} standardized pulsed-field gel electrophoresis protocol for subtyping of \emph{{Vibrio parahaemolyticus}}},
volume = {4},
issn = {1535-3141},
doi = {10.1089/fpd.2007.0089},
abstract = {{PulseNet} is a national molecular subtyping network for foodborne disease surveillance composed of public health and food regulatory agencies. Participants employ molecular subtyping of foodborne pathogens using a standardized method of pulsed-field gel electrophoresis {(PFGE)} for conducting laboratory-based surveillance of foodborne pathogens. The {PulseNet} standardized {PFGE} protocols are developed through a comprehensive testing process. The reproducibility of the protocol undergoes an internal evaluation at the Centers for Disease Control and Prevention and an external evaluation in multiple {PulseNet} laboratories. Here we describe the development and evaluation of a rapid {PFGE} protocol for subtyping Vibrio parahaemolyticus for use in {PulseNet} activities. The protocol was derived from the existing standardized {PulseNet} protocols for Escherichia coli {O157:H7} and Vibrio cholerae. An external evaluation of this protocol was undertaken in collaboration with three {PulseNet} {USA} participating public health laboratories. Comparative analysis of the {PFGE} fingerprints generated by each of these laboratories demonstrated that the protocol is both reliable and reproducible in the hands of multiple users.},
number = {3},
journal = {Foodborne Pathogens and Disease},
author = {Parsons, M B and Cooper, K L F and Kubota, K A and Puhr, N and Simington, S and Calimlim, P S and Schoonmaker-Bopp, D and Bopp, C and Swaminathan, B and Gerner-Smidt, P and Ribot, E M},
year = {2007},
note = {{PMID:} 17883312},
keywords = {Bacterial Typing Techniques, {DNA} Restriction Enzymes, {DNA}, Bacterial, Electrophoresis, Gel, Pulsed-Field, Food Microbiology, Humans, Laboratories, Phylogeny, Public Health, Reproducibility of Results, Restriction Mapping, Sensitivity and Specificity, Serotyping, United States, Vibrio parahaemolyticus},
pages = {285--292}
},
@article{graves_pulsenet_2001,
title = {{PulseNet} standardized protocol for subtyping \emph{{Listeria monocytogenes}} by macrorestriction and pulsed-field gel electrophoresis},
volume = {65},
issn = {0168-1605},
abstract = {{PulseNet} is a national network of pubic health and food regulatory laboratories established in the {US} to detect clusters of foodborne disease and respond quickly to foodborne outbreak investigations. {PulseNet} laboratories currently subtype Escherichia coli {O157:H7}, non-typhoidal Salmonella, and Shigella isolates by a highly standardized 1-day pulsed-field gel electrophoresis {(PFGE)}, and exchange normalized {DNA} "fingerprint" patterns via the Internet. We describe a standardized molecular subtyping protocol for subtyping Listeria monocytogenes that was recently added to {PulseNet.} The subtyping can be completed within 30 h from the time a pure culture of the bacteria is obtained.},
number = {1-2},
journal = {International Journal of Food Microbiology},
author = {Graves, L M and Swaminathan, B},
month = apr,
year = {2001},
note = {{PMID:} 11322701},
keywords = {Bacterial Typing Techniques, Databases, Factual, {DNA} Restriction Enzymes, {DNA}, Bacterial, Electrophoresis, Gel, Pulsed-Field, Food Microbiology, Internet, Laboratories, Listeria monocytogenes, Public Health, United States},
pages = {55--62}
}
@article{achtman_multilocus_2012,
title = {Multilocus Sequence Typing as a Replacement for Serotyping in Salmonella enterica},
volume = {8},
url = {http://dx.doi.org/10.1371/journal.ppat.1002776},
doi = {10.1371/journal.ppat.1002776},
abstract = {Author {SummaryMicrobiologists} have used serological and nutritional characteristics to subdivide pathogenic bacteria for nearly 100 years. These subdivisions in Salmonella enterica are called serovars, some of which are thought to be associated with particular diseases and epidemiology. We used {MultiLocus} Sequence-based Typing {(MLST)} to identify clusters of S. enterica isolates that are related by evolutionary descent. Some clusters correspond to serovars on a one to one basis. But many clusters include multiple serovars, which is of public health significance, and most serovars span multiple, unrelated clusters. Despite its broad usage, serological typing of S. enterica has resulted in confusing systematics, with a few exceptions. We recommend that serotyping for strain discrimination of S. enterica be replaced by a {DNA-based} method, such as {MLST.} Serotyping and other non-sequence based typing methods are routinely used for detecting outbreaks and to support public health responses. Moving away from these methods will require a major shift in thinking by public health microbiology laboratories as well as national and international agencies. However, a transition to the routine use of {MLST}, supplemented where appropriate by even more discriminatory sequence-based typing methods based on entire genomes, will provide a clearer picture of long-term transmission routes of Salmonella, facilitate data transfer and support global control measures.},
number = {6},
urldate = {2012-10-23},
journal = {{PLoS} Pathogens},
author = {Achtman, Mark and Wain, John and Weill, Fran\,cois-Xavier and Nair, Satheesh and Zhou, Zhemin and Sangal, Vartul and Krauland, Mary G. and Hale, James L. and Harbottle, Heather and Uesbeck, Alexandra and Dougan, Gordon and Harrison, Lee H. and Brisse, Sylvain and the S. enterica {MLST} study group},
month = jun,
year = {2012},
pages = {e1002776}
}
% ELISA serotyping for Escherichia coli
@article{mcconnell_enzyme-linked_1985,
title = {Enzyme-linked immunosorbent assays for the detection of adhesion factor antigens of enterotoxigenic \emph{{Escherichia coli}}},
volume = {152},
issn = {0022-1899},
abstract = {Two hundred forty-four specimens of Escherichia coli isolated in Bangladesh and Thailand and identified as enterotoxin producers were tested for the presence of adhesion antigens by mannose-resistant hemagglutination, immunodiffusion, and enzyme-linked immunosorbent assays {(ELISAs).} Specific antisera to the antigens colonization factor antigen {(CFA)/I}, {CFA/II} (consisting of coli surface antigens {[CS]} 1, 2, and 3), and putative colonization factor antigen {(PCF)} 8775 (consisting of {CS4}, 5, and 6) were used in immunodiffusion tests and {ELISAs.} The results showed that the antigens could be detected in more strains by {ELISA} than by immunodiffusion. Twenty-nine percent of specimens of E. coli from Thailand and 47\% from Bangladesh carried an adhesion antigen. Many of the strains had lost the ability to produce enterotoxins. Forty percent of strains from Thailand and 64\% from Bangladesh that were still enterotoxigenic carried adhesion factors. These antigens were found on strains with heat-stable or heat-stable and heat-labile enterotoxin but not on strains producing only heat-labile enterotoxin. {PCF8775} antigens were associated mainly with strains from Bangladesh, where 10 strains that produced only {CS6} were detected.},
number = {6},
journal = {The Journal of Infectious Diseases},
author = {{McConnell}, M M and Thomas, L V and Day, N P and Rowe, B},
month = dec,
year = {1985},
note = {{PMID:} 3934290},
keywords = {Adolescent, Antigens, Bacterial, Child, Enterotoxins, Enzyme-Linked Immunosorbent Assay, Escherichia coli, Fimbriae Proteins, Hemagglutination Tests, Humans, Immunodiffusion, Infant, Serotyping},
pages = {1120--1127}
}
% Salmonella serotyping
@book{kauffmann1975classification,
title={Classification of bacteria: a realistic scheme with special reference to the classification of \emph{{Salmonella}}- and \emph{{Escherichia}}-species},
author={Kauffmann, F.},
url={http://books.google.ca/books?id=mV-KZwEACAAJ},
year={1975},
publisher={Munksgaard}
}
@article{yoshida_methodologies_2007,
title = {Methodologies towards the development of an oligonucleotide microarray for determination of \emph{{Salmonella}} serotypes},
volume = {70},
issn = {0167-7012},
url = {http://www.sciencedirect.com/science/article/pii/S0167701207001662},
doi = {10.1016/j.mimet.2007.04.018},
abstract = {A {DNA-based} microarray designed to detect somatic {(O)} and flagellar {(H)} antigens present in the five most commonly isolated Salmonella serovars within Canada was developed as an alternative to the traditional {Kauffmann–White} serotyping scheme currently used to serotype salmonellae. Short oligonucleotide probes were designed based on publicly available sequence data of selected genes responsible for O and H antigen biosynthesis. These targets included: antigen-specific sequences within the flagella {(H)} antigen phase 1 {(fliC)} and phase 2 {(fljB)} genes and somatic {(O)} antigen biosynthesis genes within the rfb cluster {(Groups} {B—rfbJ}, {C1—wbaA}, {C2—rfbJ}, {D1—rfbS).} A prototype microarray with 117 O and H antigen-specific probes and controls was used to assess probe performance against two pools of gene target {PCR} amplicons. A set of 31 of these antigen-specific probes (8 O and 23 H) with high specific signal and low non-specific signal were selected based on t-test (p-value \< 0.01) and log2 ratio distribution analysis to create a prototype microarray. The microarray was tested against 16 Salmonella strains of known serotype. Based on the strains tested in this study, these probes successfully identified and differentiated 11 of the 12 antigens targeted. The prototype {DNA-based} typing microarray described here has the potential to be an automated alternative to the traditional antigen–antibody serotyping scheme currently used for Salmonella.},
number = {2},
urldate = {2012-09-25},
journal = {Journal of Microbiological Methods},
author = {Yoshida, Catherine and Franklin, Kristyn and Konczy, Paulina and {McQuiston}, John R. and Fields, Patricia I. and Nash, John H. and Taboada, Ed N. and Rahn, Kris},
month = aug,
year = {2007},
keywords = {Microarray, Salmonella, Serotyping},
pages = {261--271}
},
@article{scaria_microarray_2008,
title = {Microarray for molecular typing of \emph{{Salmonella enterica}} serovars},
volume = {22},
issn = {0890-8508},
url = {http://www.sciencedirect.com/science/article/pii/S0890850808000340},
doi = {10.1016/j.mcp.2008.04.002},
abstract = {We describe the development of a spotted array for the delineation of the most common 14 disease-causing Salmonella serovars in the United States. Our array consists of 414 70 mers targeting core genes of Salmonella enterica, subspecies I specific genes, fimbrial genes, pathogenicity islands, Gifsy elements and other variable genes. Using this array we were able to identify a unique gene presence/absence profile for each of the targeted serovar which was used as the serovar differentiating criteria. Based on this profile, we developed a Matlab programme that compares the profile of an unknown sample to all 14 reference serovar profiles and give out the closest serovar match. Since we have included probes targeting most of the virulence genes and variable genes in Salmonella, in addition to using for serovar detection this array could also be used for studying the virulence gene content and also for evaluating the genetic relation between different isolates of Salmonella.},
number = {4},
urldate = {2012-09-25},
journal = {Molecular and Cellular Probes},
author = {Scaria, Joy and Palaniappan, Raghavan {U.M.} and Chiu, David and Phan, Julie Ann and Ponnala, Lalit and {McDonough}, Patrick and Grohn, Yrjo T. and Porwollik, Steffen and {McClelland}, Michael and Chiou, Chien-Shun and Chu, Chishih and Chang, Yung-Fu},
month = aug,
year = {2008},
keywords = {Microarray, Oligonucleotide, Salmonella},
pages = {238--243}
},
@article{franklin_rapid_2011,
title = {Rapid Genoserotyping Tool for Classification of \emph{{Salmonella}} Serovars},
volume = {49},
issn = {0095-1137},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3147765/},
doi = {10.1128/JCM.02347-10},
abstract = {We have developed a Salmonella genoserotyping array {(SGSA)} which rapidly generates an antigenic formula consistent with the White-Kauffmann-Le Minor scheme, currently the gold standard for Salmonella serotyping. A set of 287 strains representative of 133 Salmonella serovars was assembled to validate the array and to test the array probes for accuracy, specificity, and reproducibility. Initially, 76 known serovars were utilized to validate the specificity and repeatability of the array probes and their expected probe patterns. The {SGSA} generated the correct serovar designations for 100\% of the known subspecies I serovars tested in the validation panel and an antigenic formula consistent with that of the White-Kauffmann-Le Minor scheme for 97\% of all known serovars tested. Once validated, the {SGSA} was assessed against a blind panel of 100 Salmonella enterica subsp. I samples serotyped using traditional methods. In summary, the {SGSA} correctly identified all of the blind samples as representing Salmonella and successfully identified 92\% of the antigens found within the unknown samples. Antigen- and serovar-specific probes, in combination with a {pepT} {PCR} for confirmation of S. enterica subsp. Enteritidis determinations, generated an antigenic formula and/or a serovar designation consistent with the White-Kauffmann-Le Minor scheme for 87\% of unknown samples tested with the {SGSA.} Future experiments are planned to test the specificity of the array probes with other Salmonella serovars to demonstrate the versatility and utility of this array as a public health tool in the identification of Salmonella.},
number = {8},
urldate = {2012-09-24},
journal = {Journal of Clinical Microbiology},
author = {Franklin, Kristyn and Lingohr, Erika J. and Yoshida, Catherine and Anjum, Muna and Bodrossy, Levente and Clark, Clifford G. and Kropinski, Andrew M. and Karmali, Mohamed A.},
month = aug,
year = {2011},
note = {{PMID:} 21697324
{PMCID:} {PMC3147765}},
pages = {2954--2965}
}
% confidence intervals on Simpson's index of diversity
@article{grundmann_determining_2001,
title = {Determining Confidence Intervals When Measuring Genetic Diversity and the Discriminatory Abilities of Typing Methods for Microorganisms},
volume = {39},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/39/11/4190},
doi = {10.1128/JCM.39.11.4190-4192.2001},
abstract = {We describe here a method for determining confidence intervals for a commonly used index of diversity. This approach facilitates the comparison of the genetic population structure of microorganisms isolated from different environments and improves the objective assessment of the discriminatory power of typing techniques.},
language = {en},
number = {11},
urldate = {2012-11-22},
journal = {Journal of Clinical Microbiology},
author = {Grundmann, Hajo and Hori, Satoshi and Tanner, Gregor},
month = nov,
year = {2001},
pages = {4190--4192}
}
@article{versalovic_penicillin-resistant_1993,
title = {Penicillin-resistant \emph{{Streptococcus pneumoniae}} strains recovered in {Houston}: identification and molecular characterization of multiple clones},
volume = {167},
issn = {0022-1899},
shorttitle = {Penicillin-resistant Streptococcus pneumoniae strains recovered in Houston},
abstract = {A sample of 48 penicillin-resistant Streptococcus pneumoniae {(PRSP)} strains recovered between January 1989 and May 1991, primarily from infected children in Houston, was characterized by multilocus enzyme electrophoresis and repetitive extragenic palindromic-polymerase chain reaction genomic profiling. A heterogeneous array of 22 clonal genotypes was identified, but 64\% of the {PRSP} strains in the sample were assigned to five clones that are closely similar in overall chromosomal character and express serotype 6 capsule. A close genetic association between these five clones and penicillin-resistant {6B} clones recovered in Alaska, Iceland, and Spain was identified by multilocus enzyme electrophoresis. Taken together, the results suggest either that the common resistant {6B} clones in Alaska, Iceland, Spain, and Houston have a recent ancestor or that isolates of a certain pneumococcal phylogenetic lineage are more likely to develop penicillin resistance.},
number = {4},
journal = {The Journal of Infectious Diseases},
author = {Versalovic, J and Kapur, V and Mason, E O, Jr and Shah, U and Koeuth, T and Lupski, J R and Musser, J M},
month = apr,
year = {1993},
note = {{PMID:} 8450250},
keywords = {Base Sequence, Child, Genetic Variation, Genotype, Humans, Microbial Sensitivity Tests, Molecular Sequence Data, Penicillin Resistance, Polymerase Chain Reaction, Serotyping, Streptococcus pneumoniae, Texas},
pages = {850--856}
}
@article{rand_objective_1971,
title = {Objective Criteria for the Evaluation of Clustering Methods},
volume = {66},
issn = {0162-1459},
url = {http://www.tandfonline.com/doi/abs/10.1080/01621459.1971.10482356},
doi = {10.1080/01621459.1971.10482356},
abstract = {Abstract Many intuitively appealing methods have been suggested for clustering data, however, interpretation of their results has been hindered by the lack of objective criteria. This article proposes several criteria which isolate specific aspects of the performance of a method, such as its retrieval of inherent structure, its sensitivity to resampling and the stability of its results in the light of new data. These criteria depend on a measure of similarity between two different clusterings of the same set of data; the measure essentially considers how each pair of data points is assigned in each clustering.},
number = {336},
urldate = {2012-11-22},
journal = {Journal of the American Statistical Association},
author = {Rand, William M.},
year = {1971},
pages = {846--850}
},
@article{hubert_comparing_1985,
title = {Comparing partitions},
volume = {2},
issn = {0176-4268},
url = {http://www.springerlink.com/content/x64124718341j1j0/abstract/},
doi = {10.1007/BF01908075},
abstract = {The problem of comparing two different partitions of a finite set of objects reappears continually in the clustering literature. We begin by reviewing a well-known measure of partition correspondence often attributed to Rand (1971), discuss the issue of correcting this index for chance, and note that a recent normalization strategy developed by Morey and Agresti (1984) and adopted by others (e.g., Miligan and Cooper 1985) is based on an incorrect assumption. Then, the general problem of comparing partitions is approached indirectly by assessing the congruence of two proximity matrices using a simple cross-product measure. They are generated from corresponding partitions using various scoring rules. Special cases derivable include traditionally familiar statistics and/or ones tailored to weight certain object pairs differentially. Finally, we propose a measure based on the comparison of object triples having the advantage of a probabilistic interpretation in addition to being corrected for chance (i.e., assuming a constant value under a reasonable null hypothesis) and bounded between ±1.},
number = {1},
urldate = {2012-11-22},
journal = {Journal of Classification},
author = {Hubert, Lawrence and Arabie, Phipps},
year = {1985},
keywords = {Mathematics and Statistics},
pages = {193--218}
}
@article{severiano_adjusted_2011,
title = {{Adjusted Wallace} as a Measure of Congruence between Typing Methods},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/early/2011/09/14/JCM.00624-11},
doi = {10.1128/JCM.00624-11},
abstract = {We propose the new coefficient Adjusted Wallace {(AW)} and corresponding confidence intervals {(CI)} as quantitative measures of congruence between typing methods. The performance of the derived {CI} was evaluated using simulated data. Published microbial typing data was used to demonstrate the advantages of {AW} over the Wallace coefficient.},
language = {en},
urldate = {2012-11-21},
journal = {Journal of Clinical Microbiology},
author = {Severiano, Ana and Pinto, Francisco R. and Ramirez, M\'ario and Carri\c{c}o, Jo\~{a}o A.},
month = sep,
year = {2011},
volume = {49},
doi = {10.1128/JCM.00624-11},
pages = {3997--4000},
number = {11}
}
@article{hunter_numerical_1988,
title = {Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity.},
volume = {26},
issn = {0095-1137, 1098-{660X}},
shorttitle = {Numerical index of the discriminatory ability of typing systems},
url = {http://jcm.asm.org/content/26/11/2465},
abstract = {An index of discrimination for typing methods is described, based on the probability of two unrelated strains being characterized as the same type. This index may be used to compare typing methods and select the most discriminatory system.},
language = {en},
number = {11},
urldate = {2012-11-21},
journal = {Journal of Clinical Microbiology},
author = {Hunter, P. R. and Gaston, M. A.},
month = nov,
year = {1988},
pages = {2465--2466}
}
% inlB gene HRM curve analysis
@article{pietzka_gene_2011,
title = {Gene Scanning of an Internalin {B} Gene Fragment Using High-Resolution Melting Curve Analysis as a Tool for Rapid Typing of \emph{{Listeria monocytogenes}}},
volume = {13},
issn = {1525-1578},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3069814/},
doi = {10.1016/j.jmoldx.2010.11.002},
abstract = {The ability to accurately track Listeria monocytogenes strains involved in outbreaks is essential for control and prevention of listeriosis. Because current typing techniques are time-consuming, cost-intensive, technically demanding, and difficult to standardize, we developed a rapid and cost-effective method for typing of L. monocytogenes. In all, 172 clinical L. monocytogenes isolates and 20 isolates from culture collections were typed by high-resolution melting {(HRM)} curve analysis of a specific locus of the internalin B gene {(inlB).} All obtained {HRM} curve profiles were verified by sequence analysis. The 192 tested L. monocytogenes isolates yielded 15 specific {HRM} curve profiles. Sequence analysis revealed that these 15 {HRM} curve profiles correspond to 18 distinct {inlB} sequence types. The {HRM} curve profiles obtained correlated with the five phylogenetic groups I.1, I.2, {II.1}, {II.2}, and {III.} Thus, {HRM} curve analysis constitutes an inexpensive assay and represents an improvement in typing relative to classical serotyping or multiplex {PCR} typing protocols. This method provides a rapid and powerful screening tool for simultaneous preliminary typing of up to 384 samples in approximately 2 hours.},
number = {1},
urldate = {2012-11-20},
journal = {The Journal of Molecular Diagnostics : {JMD}},
author = {Pietzka, Ariane T. and St\"oger, Anna and Huhulescu, Steliana and Allerberger, Franz and Ruppitsch, Werner},
month = jan,
year = {2011},
note = {{PMID:} 21227395
{PMCID:} {PMC3069814}},
pages = {57--63}
}
@article{pearson_phylogenetic_2009,
title = {Phylogenetic understanding of clonal populations in an era of whole genome sequencing},
volume = {9},
issn = {1567-1348},
url = {http://www.sciencedirect.com/science/article/pii/S1567134809001294},
doi = {10.1016/j.meegid.2009.05.014},
abstract = {Phylogenetic hypotheses using whole genome sequences have the potential for unprecedented accuracy, yet a failure to understand issues associated with discovery bias, character sampling, and strain sampling can lead to highly erroneous conclusions. For microbial pathogens, phylogenies derived from whole genome sequences are becoming more common, as large numbers of characters distributed across entire genomes can yield extremely accurate phylogenies, particularly for strictly clonal populations. The availability of whole genomes is increasing as new sequencing technologies reduce the cost and time required for genome sequencing. Until entire sample collections can be fully sequenced, harnessing the phylogenetic power from whole genome sequences in more than a small subset of fully sequenced strains requires the integration of whole genome and partial genome genotyping data. Such integration involves discovering evolutionarily stable polymorphic characters by whole genome comparisons, then determining allelic states across a wide panel of isolates using high-throughput genotyping technologies. Here, we demonstrate how such an approach using single nucleotide polymorphisms {(SNPs)} yields highly accurate, but biased phylogenetic reconstructions and how the accuracy of the resulting tree is compromised by incomplete taxon and character sampling. Despite recent phylogenetic work detailing the strengths and biases of integrating whole genome and partial genome genotype data, these issues are relatively new and remain poorly understood by many researchers. Here, we revisit these biases and provide strategies for maximizing phylogenetic accuracy. Although we write this review with bacterial pathogens in mind, these concepts apply to any clonally reproducing population or indeed to any evolutionarily stable marker that is inherited in a strictly clonal manner. Understanding the ways in which current and emerging technologies can be used to maximize phylogenetic knowledge is advantageous only with a complete understanding of the strengths and weaknesses of these methods.},
number = {5},
urldate = {2012-11-20},
journal = {Infection, Genetics and Evolution},
author = {Pearson, Talima and Okinaka, Richard T. and Foster, Jeffrey T. and Keim, Paul},
month = sep,
year = {2009},
keywords = {B. anthracis, Clonal populations, Discovery bias, Phylogeny, Whole genome sequence},
pages = {1010--1019}
},
% Illumina sequencing paper
@article{bentley_accurate_2008,
title = {Accurate whole human genome sequencing using reversible terminator chemistry},
volume = {456},
copyright = {© 2008 Nature Publishing Group},
issn = {0028-0836},
url = {http://www.nature.com/nature/journal/v456/n7218/full/nature07517.html},
doi = {10.1038/nature07517},
abstract = {{DNA} sequence information underpins genetic research, enabling discoveries of important biological or medical benefit. Sequencing projects have traditionally used long (400–800 base pair) reads, but the existence of reference sequences for the human and many other genomes makes it possible to develop new, fast approaches to re-sequencing, whereby shorter reads are compared to a reference to identify intraspecies genetic variation. Here we report an approach that generates several billion bases of accurate nucleotide sequence per experiment at low cost. Single molecules of {DNA} are attached to a flat surface, amplified in situ and used as templates for synthetic sequencing with fluorescent reversible terminator deoxyribonucleotides. Images of the surface are analysed to generate high-quality sequence. We demonstrate application of this approach to human genome sequencing on flow-sorted X chromosomes and then scale the approach to determine the genome sequence of a male Yoruba from Ibadan, Nigeria. We build an accurate consensus sequence from {\textgreater}30× average depth of paired 35-base reads. We characterize four million single-nucleotide polymorphisms and four hundred thousand structural variants, many of which were previously unknown. Our approach is effective for accurate, rapid and economical whole-genome re-sequencing and many other biomedical applications.},
language = {en},
number = {7218},
urldate = {2012-11-20},
journal = {Nature},
author = {Bentley, David R. and Balasubramanian, Shankar and Swerdlow, Harold P. and Smith, Geoffrey P. and Milton, John and Brown, Clive G. and Hall, Kevin P. and Evers, Dirk J. and Barnes, Colin L. and Bignell, Helen R. and Boutell, Jonathan M. and Bryant, Jason and Carter, Richard J. and Cheetham, R. Keira and Cox, Anthony J. and Ellis, Darren J. and Flatbush, Michael R. and Gormley, Niall A. and Humphray, Sean J. and Irving, Leslie J. and Karbelashvili, Mirian S. and Kirk, Scott M. and Li, Heng and Liu, Xiaohai and Maisinger, Klaus S. and Murray, Lisa J. and Obradovic, Bojan and Ost, Tobias and Parkinson, Michael L. and Pratt, Mark R. and Rasolonjatovo, Isabelle M. J. and Reed, Mark T. and Rigatti, Roberto and Rodighiero, Chiara and Ross, Mark T. and Sabot, Andrea and Sankar, Subramanian V. and Scally, Aylwyn and Schroth, Gary P. and Smith, Mark E. and Smith, Vincent P. and Spiridou, Anastassia and Torrance, Peta E. and Tzonev, Svilen S. and Vermaas, Eric H. and Walter, Klaudia and Wu, Xiaolin and Zhang, Lu and Alam, Mohammed D. and Anastasi, Carole and Aniebo, Ify C. and Bailey, David M. D. and Bancarz, Iain R. and Banerjee, Saibal and Barbour, Selena G. and Baybayan, Primo A. and Benoit, Vincent A. and Benson, Kevin F. and Bevis, Claire and Black, Phillip J. and Boodhun, Asha and Brennan, Joe S. and Bridgham, John A. and Brown, Rob C. and Brown, Andrew A. and Buermann, Dale H. and Bundu, Abass A. and Burrows, James C. and Carter, Nigel P. and Castillo, Nestor and Catenazzi, Maria Chiara E. and Chang, Simon and Cooley, R. Neil and Crake, Natasha R. and Dada, Olubunmi O. and Diakoumakos, Konstantinos D. and Dominguez-Fernandez, Belen and Earnshaw, David J. and Egbujor, Ugonna C. and Elmore, David W. and Etchin, Sergey S. and Ewan, Mark R. and Fedurco, Milan and Fraser, Louise J. and Fajardo, Karin V. Fuentes and Furey, W. Scott and George, David and Gietzen, Kimberley J. and Goddard, Colin P. and Golda, George S. and Granieri, Philip A. and Green, David E. and Gustafson, David L. and Hansen, Nancy F. and Harnish, Kevin and Haudenschild, Christian D. and Heyer, Narinder I. and Hims, Matthew M. and Ho, Johnny T. and Horgan, Adrian M. and Hoschler, Katya and Hurwitz, Steve and Ivanov, Denis V. and Johnson, Maria Q. and James, Terena and Jones, T. A. Huw and Kang, Gyoung-Dong and Kerelska, Tzvetana H. and Kersey, Alan D. and Khrebtukova, Irina and Kindwall, Alex P. and Kingsbury, Zoya and Kokko-Gonzales, Paula I. and Kumar, Anil and Laurent, Marc A. and Lawley, Cynthia T. and Lee, Sarah E. and Lee, Xavier and Liao, Arnold K. and Loch, Jennifer A. and Lok, Mitch and Luo, Shujun and Mammen, Radhika M. and Martin, John W. and {McCauley}, Patrick G. and {McNitt}, Paul and Mehta, Parul and Moon, Keith W. and Mullens, Joe W. and Newington, Taksina and Ning, Zemin and Ng, Bee Ling and Novo, Sonia M. and {O'Neill}, Michael J. and Osborne, Mark A. and Osnowski, Andrew and Ostadan, Omead and Paraschos, Lambros L. and Pickering, Lea and Pike, Andrew C. and Pike, Alger C. and Pinkard, D. Chris and Pliskin, Daniel P. and Podhasky, Joe and Quijano, Victor J. and Raczy, Come and Rae, Vicki H. and Rawlings, Stephen R. and Rodriguez, Ana Chiva and Roe, Phyllida M. and Rogers, John and Bacigalupo, Maria C. Rogert and Romanov, Nikolai and Romieu, Anthony and Roth, Rithy K. and Rourke, Natalie J. and Ruediger, Silke T. and Rusman, Eli and Sanches-Kuiper, Raquel M. and Schenker, Martin R. and Seoane, Josefina M. and Shaw, Richard J. and Shiver, Mitch K. and Short, Steven W. and Sizto, Ning L. and Sluis, Johannes P. and Smith, Melanie A. and Sohna, Jean Ernest Sohna and Spence, Eric J. and Stevens, Kim and Sutton, Neil and Szajkowski, Lukasz and Tregidgo, Carolyn L. and Turcatti, Gerardo and {vandeVondele}, Stephanie and Verhovsky, Yuli and Virk, Selene M. and Wakelin, Suzanne and Walcott, Gregory C. and Wang, Jingwen and Worsley, Graham J. and Yan, Juying and Yau, Ling and Zuerlein, Mike and Rogers, Jane and Mullikin, James C. and Hurles, Matthew E. and {McCooke}, Nick J. and West, John S. and Oaks, Frank L. and Lundberg, Peter L. and Klenerman, David and Durbin, Richard and Smith, Anthony J.},
month = nov,
year = {2008},
keywords = {astronomy, astrophysics, biochemistry, Bioinformatics, biology, Biotechnology, cancer, Cell Cycle, cell signalling, climate change, Computational Biology, development, developmental biology, {DNA}, Drug Discovery, earth science, Ecology, environmental science, Evolution, evolutionary biology, Functional genomics, genetics, Genomics, geophysics, immunology, interdisciplinary science, life, marine biology, materials science, medical research, medicine, metabolomics, Molecular Biology, molecular interactions, nanotechnology, Nature, neurobiology, neuroscience, palaeobiology, pharmacology, physics, Proteomics, quantum physics, {RNA}, science, science news, science policy, Signal Transduction, structural biology, Systems biology, transcriptomics},
pages = {53--59}
}
% MLST and similar methods are well suited to examining
specific outbreaks and populations for many diseases and
phylogenetic inference could be used to accurately portray the
clonal expansion of a specific outbreak. But when an accurate
overall phylogeny and evolutionary tree is needed for a particular
species and its relatives these methods are often confounded by
homoplasy, homologous recombination and lateral gene transfer
(Achtman and Wagner, 2008) and would likely benefit from the
inclusion of more data (Turner et al., 2007).
@article{achtman_microbial_2008,
title = {Microbial diversity and the genetic nature of microbial species},
volume = {6},
issn = {1740-1534},
lccn = {0091},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18461076},
doi = {10.1038/nrmicro1872},
abstract = {The earth contains a huge number of largely uncharacterized Bacteria and Archaea. Microbiologists are struggling to summarize their genetic diversity and classify them, which has resulted in heated debates on methods for defining species, mechanisms that lead to speciation and whether microbial species even exist. This Review proposes that decisions on the existence of species and methods to define them should be guided by a method-free species concept that is based on cohesive evolutionary forces. It summarizes current approaches to defining species and the problems of these approaches, and presents selected examples of the population genetic patterns at and below the species level.},
number = {6},
urldate = {2011-01-19},
journal = {Nature Reviews. Microbiology},
author = {Achtman, Mark and Wagner, Michael},
month = jun,
year = {2008},
note = {{PMID:} 18461076},
keywords = {Archaea, Bacteria, Ecosystem, Environmental Microbiology, Evolution, Molecular, Gene Transfer, Horizontal, Genetic Speciation, Genetic Variation, Genetics, Microbial, Models, Genetic, Selection, Genetic},
pages = {431--440}
}
% MLVA+CGF-like 2-step genotyping;
@article{xiao_novel_2011,
title = {A novel genotyping scheme for \emph{{Vibrio parahaemolyticus}} with combined use of large variably-presented gene clusters {(LVPCs)} and variable-number tandem repeats {(VNTRs)}},
volume = {149},
issn = {0168-1605},
url = {http://www.sciencedirect.com/science/article/pii/S0168160511003515},
doi = {10.1016/j.ijfoodmicro.2011.06.014},
abstract = {A total of 18 variably-presented gene clusters {(LVPCs)} and nine previously characterized variable-number tandem repeats {(VNTRs)}, and all known virulence markers were screened for their frequency and/or copy number in 251 global strains of Vibrio parahaemolyticus using {PCR} and gel or capillary electrophoresis. A two-step genotyping approach combining the use of {LVPCs} and {VNTRs} was established accordingly. The frequency profiles of {LVPCs} and virulence markers were primarily used to group the strains into six distinct complexes with different potential pathogenicity natures. The strains from each of these complexes were further analyzed with {VNTRs} to give a much more detailed discrimination of the strains. A genetic fingerprint-like database of a large collection of strains established with this two-stage approach would be very useful for identification, genotyping, origin tracing, and risk estimation of V. parahaemolyticus.},
number = {2},
urldate = {2012-11-20},
journal = {International Journal of Food Microbiology},
author = {Xiao, Xiao and Yan, Yanfeng and Zhang, Yiquan and Wang, Li and Liu, Xia and Yang, Lin and Tan, Yafang and Guo, Zhaobiao and Yang, Ruifu and Zhou, Dongsheng},
month = sep,
year = {2011},
keywords = {Genotyping, {LVPC}, Vibrio parahaemolyticus, {VNTR}},
pages = {143--151}
}
% describe using wgs to type Mycobacterium tuberculosis
@article{schurch_dna_2012,
title = {{DNA} fingerprinting of \emph{{Mycobacterium tuberculosis}}: From phage typing to whole-genome sequencing},
volume = {12},
issn = {1567-1348},
shorttitle = {Special Issue on Molecular evolution, epidemiology and pathogenesis of Mycobacterium tuberculosis and other mycobacteria},
url = {http://www.sciencedirect.com/science/article/pii/S1567134811003790},
doi = {10.1016/j.meegid.2011.08.032},
abstract = {Current typing methods for Mycobacterium tuberculosis complex evolved from simple phenotypic approaches like phage typing and drug susceptibility profiling to {DNA-based} strain typing methods, such as {IS6110-restriction} fragment length polymorphisms {(RFLP)} and variable number of tandem repeats {(VNTR)} typing. Examples of the usefulness of molecular typing are source case finding and epidemiological linkage of tuberculosis {(TB)} cases, international transmission of {MDR/XDR-TB}, the discrimination between endogenous reactivation and exogenous re-infection as a cause of relapses after curative treatment of tuberculosis, the evidence of multiple M. tuberculosis infections, and the disclosure of laboratory cross-contaminations. Simultaneously, phylogenetic analyses were developed based on single nucleotide polymorphisms {(SNPs)}, genomic deletions usually referred to as regions of difference {(RDs)} and spoligotyping which served both strain typing and phylogenetic analysis. National and international initiatives that rely on the application of these typing methods have brought significant insight into the molecular epidemiology of tuberculosis. However, current {DNA} fingerprinting methods have important limitations. They can often not distinguish between genetically closely related strains and the turn-over of these markers is variable. Moreover, the suitability of most {DNA} typing methods for phylogenetic reconstruction is limited as they show a high propensity of convergent evolution or misinfer genetic distances. In order to fully explore the possibilities of genotyping in the molecular epidemiology of tuberculosis and to study the phylogeny of the causative bacteria reliably, the application of whole-genome sequencing {(WGS)} analysis for all M. tuberculosis isolates is the optimal, although currently still a costly solution. In the last years {WGS} for typing of pathogens has been explored and yielded important additional information on strain diversity in comparison to the classical {DNA} typing methods. With the ongoing cost reduction of {DNA} sequencing it is possible that {WGS} will become the sole diagnostic tool in the secondary laboratory diagnosis of tuberculosis for identification, drug susceptibility testing and genetic characterization.},
number = {4},
urldate = {2012-11-19},
journal = {Infection, Genetics and Evolution},
author = {Sch\"urch, Anita C. and van Soolingen, Dick},
month = jun,
year = {2012},
keywords = {Bacterial typing, {DNA} Fingerprinting, Mycobacterium tuberculosis, Variable number of tandem repeats, Whole genome sequencing},
pages = {602--609}
}
@article{dewaele_molecular_2012,
title = {Molecular Characterization of Salmonella Enteritidis: Comparison of an Optimized Multi-Locus Variable-Number of Tandem Repeat Analysis {(MLVA)} and Pulsed-Field Gel Electrophoresis},
volume = {9},
issn = {1535-3141, 1556-7125},
shorttitle = {Molecular Characterization of Salmonella Enteritidis},
url = {http://online.liebertpub.com/doi/abs/10.1089/fpd.2012.1199},
doi = {10.1089/fpd.2012.1199},
number = {10},
urldate = {2012-11-16},
journal = {Foodborne Pathogens and Disease},
author = {Dewaele, Isabelle and Rasschaert, Geertrui and Bertrand, Sophie and Wildemauwe, Christa and Wattiau, Pierre and Imberechts, Hein and Herman, Lieve and Ducatelle, Richard and De Reu, Koen and Heyndrickx, Marc},
month = oct,
year = {2012},
pages = {885--895}
}
@article{comas_genotyping_2009,
title = {Genotyping of Genetically Monomorphic Bacteria: {DNA} Sequencing in \emph{{Mycobacterium tuberculosis}} Highlights the Limitations of Current Methodologies},
volume = {4},
shorttitle = {Genotyping of Genetically Monomorphic Bacteria},
url = {http://dx.doi.org/10.1371/journal.pone.0007815},
doi = {10.1371/journal.pone.0007815},
abstract = {Because genetically monomorphic bacterial pathogens harbour little {DNA} sequence diversity, most current genotyping techniques used to study the epidemiology of these organisms are based on mobile or repetitive genetic elements. Molecular markers commonly used in these bacteria include Clustered Regulatory Short Palindromic Repeats {(CRISPR)} and Variable Number Tandem Repeats {(VNTR).} These methods are also increasingly being applied to phylogenetic and population genetic studies. Using the Mycobacterium tuberculosis complex {(MTBC)} as a model, we evaluated the phylogenetic accuracy of {CRISPR-} and {VNTR-based} genotyping, which in {MTBC} are known as spoligotyping and Mycobacterial Interspersed Repetitive Units {(MIRU)-VNTR-typing}, respectively. We used as a gold standard the complete {DNA} sequences of 89 coding genes from a global strain collection. Our results showed that phylogenetic trees derived from these multilocus sequence data were highly congruent and statistically robust, irrespective of the phylogenetic methods used. By contrast, corresponding phylogenies inferred from spoligotyping or 15-loci-{MIRU-VNTR} were incongruent with respect to the sequence-based trees. Although 24-loci-{MIRU-VNTR} performed better, it was still unable to detect all strain lineages. The {DNA} sequence data showed virtually no homoplasy, but the opposite was true for spoligotyping and {MIRU-VNTR}, which was consistent with high rates of convergent evolution and the low statistical support obtained for phylogenetic groupings defined by these markers. Our results also revealed that the discriminatory power of the standard 24 {MIRU-VNTR} loci varied by strain lineage. Taken together, our findings suggest strain lineages in {MTBC} should be defined based on phylogenetically robust markers such as single nucleotide polymorphisms or large sequence polymorphisms, and that for epidemiological purposes, {MIRU-VNTR} loci should be used in a lineage-dependent manner. Our findings have implications for strain typing in other genetically monomorphic bacteria.},
number = {11},
urldate = {2012-11-16},
journal = {{PLoS} {ONE}},
author = {Comas, Iñaki and Homolka, Susanne and Niemann, Stefan and Gagneux, Sebastien},
month = nov,
year = {2009},
pages = {e7815}
}
@article{kimura_simple_1980,
title = {A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences},
volume = {16},
issn = {0022-2844},
abstract = {Some simple formulae were obtained which enable us to estimate evolutionary distances in terms of the number of nucleotide substitutions (and, also, the evolutionary rates when the divergence times are known). In comparing a pair of nucleotide sequences, we distinguish two types of differences; if homologous sites are occupied by different nucleotide bases but both are purines or both pyrimidines, the difference is called type I (or "transition" type), while, if one of the two is a purine and the other is a pyrimidine, the difference is called type {II} (or "transversion" type). Letting P and Q be respectively the fractions of nucleotide sites showing type I and type {II} differences between two sequences compared, then the evolutionary distance per site is K = -(1/2) ln [(1-{2P-Q)} square root of 1-{2Q].} The evolutionary rate per year is then given by k = {K/(2T)}, where T is the time since the divergence of the two sequences. If only the third codon positions are compared, the synonymous component of the evolutionary base substitutions per site is estimated by {K'S} = -(1/2) ln (1-{2P-Q).} Also, formulae for standard errors were obtained. Some examples were worked out using reported globin sequences to show that synonymous substitutions occur at much higher rates than amino acid-altering substitutions in evolution.},
number = {2},
journal = {Journal of Molecular Evolution},
author = {Kimura, M},
month = dec,
year = {1980},
note = {{PMID:} 7463489},
keywords = {Animals, Base Sequence, Biological Evolution, {DNA}, Humans, Mathematics, Models, Biological, Mutation, Probability, Proteins, Species Specificity},
pages = {111--120}
}
@article{li_orthomcl_2003,
title = {{OrthoMCL:} Identification of Ortholog Groups for Eukaryotic Genomes},
volume = {13},
issn = {1088-9051},
shorttitle = {{OrthoMCL}},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC403725/},
doi = {10.1101/gr.1224503},
abstract = {The identification of orthologous groups is useful for genome annotation, studies on gene/protein evolution, comparative genomics, and the identification of taxonomically restricted sequences. Methods successfully exploited for prokaryotic genome analysis have proved difficult to apply to eukaryotes, however, as larger genomes may contain multiple paralogous genes, and sequence information is often incomplete. {OrthoMCL} provides a scalable method for constructing orthologous groups across multiple eukaryotic taxa, using a Markov Cluster algorithm to group (putative) orthologs and paralogs. This method performs similarly to the {INPARANOID} algorithm when applied to two genomes, but can be extended to cluster orthologs from multiple species. {OrthoMCL} clusters are coherent with groups identified by {EGO}, but improved recognition of “recent” paralogs permits overlapping {EGO} groups representing the same gene to be merged. Comparison with previously assigned {EC} annotations suggests a high degree of reliability, implying utility for automated eukaryotic genome annotation. {OrthoMCL} has been applied to the proteome data set from seven publicly available genomes (human, fly, worm, yeast, Arabidopsis, the malaria parasite Plasmodium falciparum, and Escherichia coli). A Web interface allows queries based on individual genes or user-defined phylogenetic patterns (http://www.cbil.upenn.edu/gene-family). Analysis of clusters incorporating P. falciparum genes identifies numerous enzymes that were incompletely annotated in first-pass annotation of the parasite genome.},
number = {9},
urldate = {2012-11-08},
journal = {Genome Research},
author = {Li, Li and Stoeckert, Christian J. and Roos, David S.},
month = sep,
year = {2003},
note = {{PMID:} 12952885
{PMCID:} {PMC403725}},
pages = {2178--2189}
}
% jackknife resampling for defining confidence intervals
@article{severiano_evaluation_2011,
title = {Evaluation of Jackknife and Bootstrap for Defining Confidence Intervals for Pairwise Agreement Measures},
volume = {6},
url = {http://dx.doi.org/10.1371/journal.pone.0019539},
doi = {10.1371/journal.pone.0019539},
abstract = {Several research fields frequently deal with the analysis of diverse classification results of the same entities. This should imply an objective detection of overlaps and divergences between the formed clusters. The congruence between classifications can be quantified by clustering agreement measures, including pairwise agreement measures. Several measures have been proposed and the importance of obtaining confidence intervals for the point estimate in the comparison of these measures has been highlighted. A broad range of methods can be used for the estimation of confidence intervals. However, evidence is lacking about what are the appropriate methods for the calculation of confidence intervals for most clustering agreement measures. Here we evaluate the resampling techniques of bootstrap and jackknife for the calculation of the confidence intervals for clustering agreement measures. Contrary to what has been shown for some statistics, simulations showed that the jackknife performs better than the bootstrap at accurately estimating confidence intervals for pairwise agreement measures, especially when the agreement between partitions is low. The coverage of the jackknife confidence interval is robust to changes in cluster number and cluster size distribution.},
number = {5},
urldate = {2012-10-16},
journal = {{PLoS} {ONE}},
author = {Severiano, Ana and Carri\,co, Jo\~ao A. and Robinson, D. Ashley and Ramirez, M\'ario and Pinto, Francisco R.},
month = may,
year = {2011},
pages = {e19539}
},
% Wallace coefficient confidence intervals
@article{pinto_confidence_2008,
title = {A Confidence Interval for the Wallace Coefficient of Concordance and Its Application to Microbial Typing Methods},
volume = {3},
url = {http://dx.doi.org/10.1371/journal.pone.0003696},
doi = {10.1371/journal.pone.0003696},
abstract = {Very diverse research fields frequently deal with the analysis of multiple clustering results, which should imply an objective detection of overlaps and divergences between the formed groupings. The congruence between these multiple results can be quantified by clustering comparison measures such as the Wallace coefficient {(W).} Since the measured congruence is dependent on the particular sample taken from the population, there is variability in the estimated values relatively to those of the true population. In the present work we propose the use of a confidence interval {(CI)} to account for this variability when W is used. The {CI} analytical formula is derived assuming a Gaussian sampling distribution and recurring to the algebraic relationship between W and the Simpson's index of diversity. This relationship also allows the estimation of the expected Wallace value under the assumption of independence of classifications. We evaluated the {CI} performance using simulated and published microbial typing data sets. The simulations showed that the {CI} has the desired 95\% coverage when the W is greater than 0.5. This behaviour is robust to changes in cluster number, cluster size distributions and sample size. The analysis of the published data sets demonstrated the usefulness of the new {CI} by objectively validating some of the previous interpretations, while showing that other conclusions lacked statistical support.},
number = {11},
urldate = {2012-10-16},
journal = {{PLoS} {ONE}},
author = {Pinto, Francisco R. and Melo-Cristino, Jos\'e and Ramirez, M\'ario},
month = nov,
year = {2008},
pages = {e3696}
}
@Article{paradis_ape_2004,
title = {A{PE}: analyses of phylogenetics and evolution in {R}
language},
author = {E. Paradis and J. Claude and K. Strimmer},
journal = {Bioinformatics},
year = {2004},
volume = {20},
pages = {289-290},
}
@article{gaulin_first_2003,
title = {First documented outbreak of \emph{{Listeria monocytogenes}} in {Quebec}, 2002},
volume = {29},
issn = {1188-4169},
url = {http://www.ncbi.nlm.nih.gov/pubmed/14603730},
number = {21},
urldate = {2012-09-24},
journal = {Canada Communicable Disease Report = Relevé Des Maladies Transmissibles Au Canada},
author = {Gaulin, C and Ramsay, D and Ringuette, L and Ismaïl, J},
month = nov,
year = {2003},
note = {{PMID:} 14603730},
keywords = {Disease Outbreaks, Humans, Listeria monocytogenes, Listeriosis, Quebec},
pages = {181--186},
annote = {heat treated soft and firm cheese
17 cases; 11 hospitalizations}
},
@article{farber_small_2000,
title = {A small outbreak of listeriosis potentially linked to the consumption of imitation crab meat},
volume = {31},
issn = {0266-8254},
url = {http://www.ncbi.nlm.nih.gov/pubmed/10972708},
abstract = {A small outbreak of listeriosis involving two previously healthy adults occurred in Ontario. Food samples obtained from the refrigerator of the patients included imitation crab meat, canned black olives, macaroni and vegetable salad, spaghetti sauce with meatballs, mayonnaise and water. All of the samples except the water contained Listeria monocytogenes. The three most heavily contaminated samples were the imitation crab meat, the olives and the salad which contained 2.1 x 109, 1.1 x 107 and 1.3 x 106 cfu g-1, respectively. L. monocytogenes serotype 1/2b was isolated from the patients, as well as from the opened and unopened imitation crab meat. Molecular typing of the isolates by both randomly amplified polymorphic {DNA} {(RAPD)} and pulsed-field gel electrophoresis {(PFGE)} typing demonstrated the imitation crab meat and clinical strains to be indistinguishable. Challenge studies performed with a pool of L. monocytogenes strains showed that imitation crab meat, but not olives, supported growth of the organism. In this study we have shown for the first time the potential involvement of imitation crab meat in a small outbreak of listeriosis. In terms of disease prevention, temperature control is critical to prevent or reduce the growth of this foodborne pathogen. In addition, with refrigerated products having a long ({\textgreater} 30 d) shelf life, additional safety factors must be used to prevent the growth of foodborne pathogens such as L. monocytogenes.},
number = {2},
urldate = {2012-09-24},
journal = {Letters in Applied Microbiology},
author = {Farber, J M and Daley, E M and {MacKie}, M T and Limerick, B},
month = aug,
year = {2000},
note = {{PMID:} 10972708},
keywords = {Animals, Bacterial Typing Techniques, Brachyura, Culture Media, Disease Outbreaks, Electrophoresis, Gel, Pulsed-Field, Female, Fish Products, Food Microbiology, Humans, Listeria monocytogenes, Listeriosis, Male, Middle Aged, Random Amplified Polymorphic {DNA} Technique},
pages = {100--104}
}
% E. coli O104:H4 outbreak Germany 2011
@article{rohde_open-source_2011,
title = {Open-source genomic analysis of {Shiga}-toxin-producing \emph{{E. coli}} {O104:H4}},
volume = {365},
issn = {1533-4406},
shorttitle = {Open-source genomic analysis of {Shiga-toxin-producing} \emph{{E. coli}} {O104}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/21793736},
doi = {10.1056/NEJMoa1107643},
abstract = {An outbreak caused by Shiga-toxin–producing Escherichia coli {O104:H4} occurred in Germany in May and June of 2011, with more than 3000 persons infected. Here, we report a cluster of cases associated with a single family and describe an open-source genomic analysis of an isolate from one member of the family. This analysis involved the use of rapid, bench-top {DNA} sequencing technology, open-source data release, and prompt crowd-sourced analyses. In less than a week, these studies revealed that the outbreak strain belonged to an enteroaggregative E. coli lineage that had acquired genes for Shiga toxin 2 and for antibiotic resistance.},
number = {8},
urldate = {2012-09-21},
journal = {The New England Journal of Medicine},
author = {Rohde, Holger and Qin, Junjie and Cui, Yujun and Li, Dongfang and Loman, Nicholas J and Hentschke, Moritz and Chen, Wentong and Pu, Fei and Peng, Yangqing and Li, Junhua and Xi, Feng and Li, Shenghui and Li, Yin and Zhang, Zhaoxi and Yang, Xianwei and Zhao, Meiru and Wang, Peng and Guan, Yuanlin and Cen, Zhong and Zhao, Xiangna and Christner, Martin and Kobbe, Robin and Loos, Sebastian and Oh, Jun and Yang, Liang and Danchin, Antoine and Gao, George F and Song, Yajun and Li, Yingrui and Yang, Huanming and Wang, Jian and Xu, Jianguo and Pallen, Mark J and Wang, Jun and Aepfelbacher, Martin and Yang, Ruifu},
month = aug,
year = {2011},
note = {{PMID:} 21793736},
keywords = {Adolescent, Bacterial Typing Techniques, Child, Diarrhea, Escherichia coli Infections, Feces, Female, Genome, Bacterial, Germany, Hemolytic-Uremic Syndrome, Humans, Male, Molecular Sequence Data, Phylogeny, Plasmids, Polymerase Chain Reaction, Sequence Analysis, {DNA}, Shiga-Toxigenic Escherichia coli},
pages = {718--724}
},
@article{rasko_origins_2011,
title = {Origins of the \emph{{E. coli}} Strain Causing an Outbreak of Hemolytic–Uremic Syndrome in {Germany}},
volume = {365},
issn = {0028-4793},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3168948/},
doi = {10.1056/NEJMoa1106920},
abstract = {{BACKGROUND}
A large outbreak of diarrhea and the hemolytic–uremic syndrome caused by an unusual serotype of Shiga-toxin–producing Escherichia coli {(O104:H4)} began in Germany in May 2011. As of July 22, a large number of cases of diarrhea caused by Shiga-toxin–producing E. coli have been reported — 3167 without the hemolytic–uremic syndrome (16 deaths) and 908 with the hemolytic–uremic syndrome (34 deaths) — indicating that this strain is notably more virulent than most of the Shiga-toxin–producing E. coli strains. Preliminary genetic characterization of the outbreak strain suggested that, unlike most of these strains, it should be classified within the enteroaggregative pathotype of E. coli.
{METHODS}
We used third-generation, single-molecule, real-time {DNA} sequencing to determine the complete genome sequence of the German outbreak strain, as well as the genome sequences of seven diarrhea-associated enteroaggregative E. coli serotype {O104:H4} strains from Africa and four enteroaggregative E. coli reference strains belonging to other serotypes. Genomewide comparisons were performed with the use of these enteroaggregative E. coli genomes, as well as those of 40 previously sequenced E. coli isolates.
{RESULTS}
The enteroaggregative E. coli {O104:H4} strains are closely related and form a distinct clade among E. coli and enteroaggregative E. coli strains. However, the genome of the German outbreak strain can be distinguished from those of other {O104:H4} strains because it contains a prophage encoding Shiga toxin 2 and a distinct set of additional virulence and antibiotic-resistance factors.
{CONCLUSIONS}
Our findings suggest that horizontal genetic exchange allowed for the emergence of the highly virulent Shiga-toxin–producing enteroaggregative E. coli {O104:H4} strain that caused the German outbreak. More broadly, these findings highlight the way in which the plasticity of bacterial genomes facilitates the emergence of new pathogens.},
number = {8},
urldate = {2012-09-21},
journal = {The New England Journal of Medicine},
author = {Rasko, David A. and Webster, Dale R. and Sahl, Jason W. and Bashir, Ali and Boisen, Nadia and Scheutz, Flemming and Paxinos, Ellen E. and Sebra, Robert and Chin, Chen-Shan and Iliopoulos, Dimitris and Klammer, Aaron and Peluso, Paul and Lee, Lawrence and Kislyuk, Andrey O. and Bullard, James and Kasarskis, Andrew and Wang, Susanna and Eid, John and Rank, David and Redman, Julia C. and Steyert, Susan R. and Frimodt-Møller, Jakob and Struve, Carsten and Petersen, Andreas M. and Krogfelt, Karen A. and Nataro, James P. and Schadt, Eric E. and Waldor, Matthew K.},
month = aug,
year = {2011},
note = {{PMID:} 21793740
{PMCID:} {PMC3168948}},
pages = {709--717}
}
%end E. coli O104:H4 outbreak Germany 2011
% 2010 Cholera outbreak WGS
@article{reimer_comparative_2011,
title = {Comparative Genomics of \emph{{Vibrio cholerae}} from {Haiti}, {Asia}, and {Africa}},
volume = {17},
issn = {1080-6040},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3310578/},
doi = {10.3201/eid1711.110794},
abstract = {A strain from Haiti shares genetic ancestry with those from Asia and Africa., Cholera was absent from the island of Hispaniola at least a century before an outbreak that began in Haiti in the fall of 2010. Pulsed-field gel electrophoresis {(PFGE)} analysis of clinical isolates from the Haiti outbreak and recent global travelers returning to the United States showed indistinguishable {PFGE} fingerprints. To better explore the genetic ancestry of the Haiti outbreak strain, we acquired 23 whole-genome Vibrio
cholerae sequences: 9 isolates obtained in Haiti or the Dominican Republic, 12 {PFGE} pattern-matched isolates linked to Asia or Africa, and 2 nonmatched outliers from the Western Hemisphere. Phylogenies for whole-genome sequences and core genome single-nucleotide polymorphisms showed that the Haiti outbreak strain is genetically related to strains originating in India and Cameroon. However, because no identical genetic match was found among sequenced contemporary isolates, a definitive genetic origin for the outbreak in Haiti remains speculative.},
number = {11},
urldate = {2012-09-21},
journal = {Emerging Infectious Diseases},
author = {Reimer, Aleisha R. and Van Domselaar, Gary and Stroika, Steven and Walker, Matthew and Kent, Heather and Tarr, Cheryl and Talkington, Deborah and Rowe, Lori and Olsen-Rasmussen, Melissa and Frace, Michael and Sammons, Scott and Dahourou, Georges Anicet and Boncy, Jacques and Smith, Anthony M. and Mabon, Philip and Petkau, Aaron and Graham, Morag and Gilmour, Matthew W. and Gerner-Smidt, Peter},
month = nov,
year = {2011},
note = {{PMID:} 22099115
{PMCID:} {PMC3310578}},
pages = {2113--2121}
}
%in silico typing paper for Campylobacter
@article{carrillo_framework_2012,
title = {A Framework for Assessing the Concordance of Molecular Typing Methods and the True Strain Phylogeny of \emph{{Campylobacter jejuni}} and \emph{{C. coli}} Using Draft Genome Sequence Data},
volume = {2},
pages = {57},
issn = {2235-2988},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3417556/},
doi = {10.3389/fcimb.2012.00057},
abstract = {Tracking of sources of sporadic cases of campylobacteriosis remains challenging, as commonly used molecular typing methods have limited ability to unambiguously link genetically related strains. Genomics has become increasingly prominent in the public health response to enteric pathogens as methods enable characterization of pathogens at an unprecedented level of resolution. However, the cost of sequencing and expertise required for bioinformatic analyses remains prohibitive, and these comprehensive analyses are limited to a few priority strains. Although several molecular typing methods are currently widely used for epidemiological analysis of campylobacters, it is not clear how accurately these methods reflect true strain relationships. To address this, we have developed a framework and associated computational tools to rapidly analyze draft genome sequence data for the assessment of molecular typing methods against a “gold standard” based on the phylogenetic analysis of highly conserved core {(HCC)} genes with high sequence quality. We analyzed 104 publicly available whole genome sequences {(WGS)} of C. jejuni and C. coli. In addition to in silico determination of multi-locus sequence typing {(MLST)}, {flaA}, and {porA} type, as well as comparative genomic fingerprinting {(CGF)} type, we inferred a “reference” phylogeny based on 389 {HCC} genes. Molecular typing data were compared to the reference phylogeny for concordance using the adjusted Wallace coefficient {(AWC)} with confidence intervals. Although {MLST} targets the sequence variability in core genes and {CGF} targets insertions/deletions of accessory genes, both methods are based on multi-locus analysis and provided better estimates of true phylogeny than methods based on single loci {(porA}, {flaA).} A more comprehensive {WGS} dataset including additional genetically related strains, both epidemiologically linked and unlinked, will be necessary to more comprehensively assess the performance of subtyping methods for outbreak investigations and surveillance activities. Analyses of the strengths and weaknesses of widely used typing methodologies in inferring true strain relationships will provide guidance in the interpretation of this data for epidemiological purposes.},
urldate = {2012-09-21},
journal = {Frontiers in Cellular and Infection Microbiology},
author = {Carrillo, Catherine D. and Kruczkiewicz, Peter and Mutschall, Steven and Tudor, Andrei and Clark, Clifford and Taboada, Eduardo N.},
month = may,
year = {2012},
note = {{PMID:} 22919648
{PMCID:} {PMC3417556}}
}
% WGS for epidemiological investigations - O104 outbreak in Europe
@article{alexander_escherichia_2012,
title = {\emph{{Escherichia coli}} {O104:H4} infections and international travel},
volume = {18},
issn = {1080-6059},
shorttitle = {Escherichia coli O104},
url = {http://www.ncbi.nlm.nih.gov/pubmed/22377016},
doi = {10.3201/eid1803.111281},
abstract = {We analyzed travel-associated clinical isolates of Escherichia coli {O104:H4}, including 1 from the 2011 German outbreak and 1 from a patient who returned from the Philippines in 2010, by genome sequencing and optical mapping. Despite extensive genomic similarity between these strains, key differences included the distribution of toxin and antimicrobial drug-resistance determinants.},
number = {3},
urldate = {2012-07-17},
journal = {Emerging Infectious Diseases},
author = {Alexander, David C and Hao, Weilong and Gilmour, Matthew W and Zittermann, Sandra and Sarabia, Alicia and Melano, Roberto G and Peralta, Analyn and Lombos, Marina and Warren, Keisha and Amatnieks, Yuri and Virey, Evangeline and Ma, Jennifer H and Jamieson, Frances B and Low, Donald E and Allen, Vanessa G},
month = mar,
year = {2012},
note = {{PMID:} 22377016},
keywords = {Aged, Bacterial Proteins, Canada, Disease Outbreaks, Escherichia coli Infections, Genome, Bacterial, Humans, Infant, Male, Sequence Analysis, {DNA}, Shiga-Toxigenic Escherichia coli, Travel},
pages = {473--476}
}
%corn outbreak in northern Italy 1997, serotype 4b, febrile gastroenteritis in immunocompetent individuals
@article{aureli_outbreak_2000,
title = {An Outbreak of Febrile Gastroenteritis Associated with Corn Contaminated by \emph{{Listeria monocytogenes}}},
volume = {342},
url = {http://www.nejm.org/doi/full/10.1056/NEJM200004273421702},
doi = {10.1056/NEJM200004273421702},
number = {17},
journal = {New England Journal of Medicine},
author = {Aureli, Paolo and Fiorucci, Giovanni Carlo and Caroli, Daniela and Marchiaro, Giovanna and Novara, Oreste and Leone, Leonello and Salmaso, Stefania},
year = {2000},
pages = {1236--1241}
}
%start MLVA Listeria - showing that it doesn't suck
@article{dass_ecology_2010,
title = {Ecology and molecular typing of \emph{{L. monocytogenes}} in a processing plant for cold-smoked salmon in the \emph{{Republic of Ireland}}},
volume = {43},
issn = {0963-9969},
url = {http://www.sciencedirect.com/science/article/pii/S0963996910001481},
doi = {10.1016/j.foodres.2010.04.030},
abstract = {A cold-smoked salmon factory was surveyed for a period of 1 year (2008–2009) for the presence of Listeria monocytogenes in the processing line, processing environment, personnel, raw materials and product (cold-smoked salmon). The purpose of the study was to determine whether genetically similar strains colonise different environmental niches in the processing factory and thereby determining the possible contamination source or pathways. The processing factory was divided into four zones (1–4) based on the proximity to the samples. The overall prevalence of L. monocytogenes was 24.54\% (n = 444). The L. monocytogenes contamination pattern was identified by characterising 124 L. monocytogenes isolates (obtained from this survey) by Multiple Locus Variable number tandem repeats Analysis {(MLVA).} The isolates were divided into 8 {MLVA} types {(Lm} a, Lm b, Lm c, Lm d, Lm e, Lm f, Lm g and Lm i). The final product (cold-smoked salmon) was contaminated with two major types of L. monocytogenes; one type originating from the raw material {(Lm} a) and the other type colonising the production line {(Lm} c) in zone 1. This suggests that, in addition to the fish processing line, L. monocytogenes contaminated raw material can progress through the production chain and result in contamination of the final product. Each zone had one dominating strain type, thus leading to the hypothesis that specific L. monocytogenes strains may be better adapted to specific environmental niches in the processing factory. The results clearly indicated the problematic sites which were the raw material, cutting board, drains, floor, conveyer belt and slicer/skinner equipment. Although, these areas would be rigorously cleaned before the start of the production, there seems to be the existence of resistant L. monocytogenes strain types. In order to minimise the problem observed in this study, new cleaning and disinfection protocols should be considered.},
number = {5},
urldate = {2012-09-21},
journal = {Food Research International},
author = {Dass, Sapna Chitlapilly and Abu-Ghannam, Nissreen and Antony-Babu, Sanjay and Cummins, Enda J.},
month = jun,
year = {2010},
keywords = {Cold-smoked-salmon, Listeria monocytogenes, {MLVA}},
pages = {1529--1536}
},
@article{balandyte_ruminant_2011,
title = {Ruminant Rhombencephalitis-Associated \emph{{Listeria monocytogenes}} Alleles Linked to a Multilocus Variable-Number Tandem-Repeat Analysis Complex},
volume = {77},
issn = {0099-2240, 1098-5336},
url = {http://aem.asm.org/content/77/23/8325},
doi = {10.1128/AEM.06507-11},
abstract = {Listeria monocytogenes is among the most important food-borne pathogens and is well adapted to persist in the environment. To gain insight into the genetic relatedness and potential virulence of L. monocytogenes strains causing central nervous system {(CNS)} infections, we used multilocus variable-number tandem-repeat analysis {(MLVA)} to subtype 183 L. monocytogenes isolates, most from ruminant rhombencephalitis and some from human patients, food, and the environment. Allelic-profile-based comparisons grouped L. monocytogenes strains mainly into three clonal complexes and linked single-locus variants {(SLVs).} Clonal complex A essentially consisted of isolates from human and ruminant brain samples. All but one rhombencephalitis isolate from cattle were located in clonal complex A. In contrast, food and environmental isolates mainly clustered into clonal complex C, and none was classified as clonal complex A. Isolates of the two main clonal complexes {(A} and C) obtained by {MLVA} were analyzed by {PCR} for the presence of 11 virulence-associated genes {(prfA}, {actA}, {inlA}, {inlB}, {inlC}, {inlD}, {inlE}, {inlF}, {inlG}, {inlJ}, and {inlC2H).} Virulence gene analysis revealed significant differences in the {actA}, {inlF}, {inlG}, and {inlJ} allelic profiles between clinical isolates (complex A) and nonclinical isolates (complex C). The association of particular alleles of {actA}, {inlF}, and newly described alleles of {inlJ} with isolates from {CNS} infections (particularly rhombencephalitis) suggests that these virulence genes participate in neurovirulence of L. monocytogenes. The overall absence of {inlG} in clinical complex A and its presence in complex C isolates suggests that the {InlG} protein is more relevant for the survival of L. monocytogenes in the environment.},
language = {en},
number = {23},
urldate = {2012-09-11},
journal = {Applied and Environmental Microbiology},
author = {Balandyté, Lina and Brodard, Isabelle and Frey, Joachim and Oevermann, Anna and Abril, Carlos},
month = dec,
year = {2011},
pages = {8325--8335},
annote = {{MLVA} Sperry
Categorical coefficient - what is it?}
},
@article{vergnaud_multiple_2009,
title = {Multiple locus variable number of tandem repeats analysis},
volume = {551},
issn = {1064-3745},
url = {http://www.ncbi.nlm.nih.gov/pubmed/19521873},
doi = {10.1007/978-1-60327-999-4_12},
abstract = {Genotyping of bacteria through typing of loci containing a variable number of tandem repeats {(VNTR)} might become the gold standard for many pathogens. The development of genome sequencing has shown that such sequences were present in every species analyzed, and that polymorphism exists in at least a fraction of them. The length of these repetitions can vary from a single nucleotide to a few hundreds. This has implications for both the techniques used to measure the repeat number and the level of variability. In addition, tandem repeats can be part of coding regions or be intergenic and may play a direct role in the adaptation to the environment, thus having different observed evolution rates. For these reasons the choice of {VNTR} when setting a multiple-loci {VNTR} analysis {(MLVA)} assay is important. Although reasonable discrimination can be achieved with the typing of six to eight markers, in particular in species with high genomic diversity, it may be necessary to type 20 to 40 markers in monomorphic species or if an evolutionary meaningful assay is needed. Homoplasy (in the present context, two alleles containing the same repeat copy number in spite of a different history) is then compensated by the analysis of multiple markers. Finally, even if the underlying principles are relatively simple, quality standards must be implemented before this approach is widely accepted, and technology issues must be resolved to further lower the typing costs.},
urldate = {2012-09-11},
journal = {Methods in Molecular Biology},
author = {Vergnaud, Gilles and Pourcel, Christine},
year = {2009},
note = {{PMID:} 19521873},
keywords = {Bacteria, {DNA}, Bacterial, Electrophoresis, Agar Gel, Electrophoresis, Capillary, Genome, Bacterial, Humans, Minisatellite Repeats, Molecular Epidemiology, Polymerase Chain Reaction},
pages = {141--158},
annote = {Review of {MLVA} - pros and cons}
}
%end MLVA
%start MLST Listeria
@article{ragon_new_2008,
title = {A New Perspective on \emph{{Listeria monocytogenes}} Evolution},
volume = {4},
issn = {1553-7366},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2518857/},
doi = {10.1371/journal.ppat.1000146},
abstract = {Listeria monocytogenes is a model organism for cellular microbiology and host–pathogen interaction studies and an important food-borne pathogen widespread in the environment, thus representing an attractive model to study the evolution of virulence. The phylogenetic structure of L. monocytogenes was determined by sequencing internal portions of seven housekeeping genes (3,288 nucleotides) in 360 representative isolates. Fifty-eight of the 126 disclosed sequence types were grouped into seven well-demarcated clonal complexes (clones) that comprised almost 75\% of clinical isolates. Each clone had a unique or dominant serotype (4b for clones 1, 2 and 4, 1/2b for clones 3 and 5, 1/2a for clone 7, and 1/2c for clone 9), with no association of clones with clinical forms of human listeriosis. Homologous recombination was extremely limited (r/m{\textless}1 for nucleotides), implying long-term genetic stability of multilocus genotypes over time. Bayesian analysis based on 438 {SNPs} recovered the three previously defined lineages, plus one unclassified isolate of mixed ancestry. The phylogenetic distribution of serotypes indicated that serotype 4b evolved once from 1/2b, the likely ancestral serotype of lineage I. Serotype 1/2c derived once from 1/2a, with reference strain {EGDe} (1/2a) likely representing an intermediate evolutionary state. In contrast to housekeeping genes, the virulence factor internalin {(InlA)} evolved by localized recombination resulting in a mosaic pattern, with convergent evolution indicative of natural selection towards a truncation of {InlA} protein. This work provides a reference evolutionary framework for future studies on L. monocytogenes epidemiology, ecology, and virulence., Listeria monocytogenes is a pathogen transmitted through contaminated food and is responsible for severe infections, including meningitis and abortion in animals and humans. It is known that many distinct strains of this pathogen exist, and that they differ in their virulence and epidemic potential. Unfortunately, there is currently no standard definition of strains and no comprehensive overview of their evolution. To tackle these serious limitations to the control of listeriosis and to improve knowledge of how virulence evolves, we characterized a large collection of isolates with sequence-based genotyping methods. We were thus able to identify precisely the most prevalent clones of L. monocytogenes, i.e., groups of isolates that descend from a single ancestral bacterium, which can now be characterized further for diagnostic purposes and determination of their precise ecology and virulence potential. We also determined how these clones evolved from their common ancestor and the evolutionary history by which they acquired their phenotypic characteristics, such as antigenic structures. Finally, we show that some particular strains tend to lose a virulence factor that plays a crucial role in infection in humans. This is a rare example of evolution towards reduced virulence of pathogens, and the discovery of the selective forces behind this phenomenon may have important epidemiological and biological implications.},
number = {9},
urldate = {2012-09-19},
journal = {{PLoS} Pathogens},
author = {Ragon, Marie and Wirth, Thierry and Hollandt, Florian and Lavenir, Rachel and Lecuit, Marc and Le Monnier, Alban and Brisse, Sylvain},
month = sep,
year = {2008},
note = {{PMID:} 18773117
{PMCID:} {PMC2518857}}
},
@article{jolley_mlstdbnet_2004,
title = {{mlstdbNet} – distributed multi-locus sequence typing {(MLST)} databases},
volume = {5},
issn = {1471-2105},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC459212/},
doi = {10.1186/1471-2105-5-86},
abstract = {Background
Multi-locus sequence typing {(MLST)} is a method of typing that facilitates the discrimination of microbial isolates by comparing the sequences of housekeeping gene fragments. The {mlstdbNet} software enables the implementation of distributed web-accessible {MLST} databases that can be linked widely over the Internet.
Results
The software enables multiple isolate databases to query a single profiles database that contains allelic profile and sequence definitions. This separation enables isolate databases to be established by individual laboratories, each customised to the needs of the particular project and with appropriate access restrictions, while maintaining the benefits of a single definitive source of profile and sequence information. Databases are described by an {XML} file that is parsed by a Perl {CGI} script. The software offers a large number of ways to query the databases and to further break down and export the results generated. Additional features can be enabled by installing third-party (freely available) tools.
Conclusion
Development of a distributed structure for {MLST} databases offers scalability and flexibility, allowing participating centres to maintain ownership of their own data, without introducing duplication and data integrity issues.},
urldate = {2012-09-03},
journal = {{BMC} Bioinformatics},
author = {Jolley, Keith A and Chan, Man-Suen and Maiden, Martin {CJ}},
month = jul,
year = {2004},
note = {{PMID:} 15230973
{PMCID:} {PMC459212}},
pages = {86}
},
@article{cai_rational_2002,
title = {Rational Design of {DNA} Sequence-Based Strategies for Subtyping \emph{{Listeria monocytogenes}}},
volume = {40},
issn = {0095-1137},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC130781/},
doi = {10.1128/JCM.40.9.3319-3325.2002},
abstract = {The ability to differentiate bacteria beyond the species level is essential for identifying and tracking infectious disease outbreaks and to improve our knowledge of the population genetics, epidemiology, and ecology of bacterial pathogens. Commonly used subtyping methods, such as serotyping, phage typing, ribotyping, and pulsed-field gel electrophoresis, can yield ambiguous results that are difficult to standardize and share among laboratories. {DNA} sequence-based subtyping strategies can reduce interpretation ambiguity. We report the development of a rational approach for designing sequence-based subtyping methods. Listeria monocytogenes was selected as the model organism for testing the efficacy of this approach. Two housekeeping genes {(recA} and prs), one stress response gene {(sigB)}, two virulence genes {(actA} and {inlA)}, and two intergenic regions (hly-mpl and {plcA-hly)} were sequenced for 15 L. monocytogenes isolates. Isolates were chosen from a representative collection of more than 1,000 L. monocytogenes isolates to reflect the genetic diversity of this species. {DNA} sequences were aligned, and sliding window analyses were performed for each gene to define 600-bp-long regions that were (i) most polymorphic (using {ProSeq)} or (ii) most discriminatory (using a new algorithm implemented in {WINDOWMIN).} Complete gene sequences for {actA} (1,929 bp) and {inlA} (2,235 bp) provided the highest discrimination (identifying 15 and 14 allelic types, respectively). {WINDOWMIN} allowed identification of 600-bp regions within these genes that provided similar discriminatory power (yielding 15 and 13 allelic types, respectively). The most discriminatory 600-bp fragments identified in the housekeeping and stress response genes differentiated the isolates into 8 to 10 subtypes; intergenic region sequences yielded 8 and 12 allelic types based on 335- and 242-bp sequences for hly-mpl and {plcA-hly}, respectively. Regions identified as most polymorphic were not necessarily most discriminatory; therefore, application of the {WINDOWMIN} algorithm provided a powerful tool for determining the best target regions for {DNA} sequence-based subtyping. Our specific results also show that inclusion of virulence gene target sequences in a {DNA} sequence-based subtyping scheme for L. monocytogenes is necessary to achieve maximum subtype differentiation.},
number = {9},
urldate = {2012-09-19},
journal = {Journal of Clinical Microbiology},
author = {Cai, Steven and Kabuki, Dirce Yorika and Kuaye, Arnaldo Yoshiteru and Cargioli, Theresa Gina and Chung, Michael S. and Nielsen, Rasmus and Wiedmann, Martin},
month = sep,
year = {2002},
note = {{PMID:} 12202573
{PMCID:} {PMC130781}},
pages = {3319--3325}
},
@article{revazishvili_comparative_2004,
title = {Comparative Analysis of Multilocus Sequence Typing and Pulsed-Field Gel Electrophoresis for Characterizing \emph{{Listeria monocytogenes}} Strains Isolated from Environmental and Clinical Sources},
volume = {42},
issn = {0095-1137},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC321703/},
doi = {10.1128/JCM.42.1.276-285.2004},
abstract = {One hundred seventy-five Listeria monocytogenes strains were characterized by serotyping, pulsed-field gel electrophoresis {(PFGE)}, and multilocus sequence typing {(MLST)} based on loci in {actA}, {betL}, {hlyA}, {gyrB}, pgm, and {recA.} One hundred twenty-two sequence types {(STs)} were identified by {MLST} based on allelic profiles of the four housekeeping genes {(betL}, {gyrB}, pgm, and {recA)}, and 34 and 38 alleles were identified for {hlyA} and {actA}, respectively. Several {actA} and {hlyA} alleles appeared to be predominantly associated with clinical isolates. {MLST} differentiated most of the L. monocytogenes strains better than did {PFGE}, and the discriminating ability of {PFGE} was better than that of serotyping. Several strains with different serotypes were found, by {MLST} and {PFGE}, to have very closely related genetic backgrounds, which suggested possible “antigen switching” among them. {MLST} can be a useful typing tool for differentiating L. monocytogenes strains (including strains undistinguishable by {PFGE} typing and serotyping), and it may be of value during investigations of food-borne outbreaks of listeriosis.},
number = {1},
urldate = {2012-09-19},
journal = {Journal of Clinical Microbiology},
author = {Revazishvili, Tamara and Kotetishvili, Mamuka and Stine, O. Colin and Kreger, Arnold S. and Morris, J. Glenn and Sulakvelidze, Alexander},
month = jan,
year = {2004},
note = {{PMID:} 14715765
{PMCID:} {PMC321703}},
pages = {276--285}
},
@article{chan_database-driven_2001,
title = {Database-driven multi locus sequence typing {(MLST)} of bacterial pathogens},
volume = {17},
issn = {1367-4803},
url = {http://www.ncbi.nlm.nih.gov/pubmed/11724739},
abstract = {{MOTIVATION}
Multi Locus Sequence Typing {(MLST)} is a newly developed typing method for bacteria based on the sequence determination of internal fragments of seven house-keeping genes. It has proved useful in characterizing and monitoring disease-causing and antibiotic resistant lineages of bacteria. The strength of this approach is that unlike data obtained using most other typing methods, sequence data are unambiguous, can be held on a central database and be queried through a web server.
{RESULTS}
A database-driven software system (mlstdb) has been developed, which is used by public health laboratories and researchers globally to query their nucleotide sequence data against centrally held databases over the internet. The mlstdb system consists of a set of perl scripts for defining the database tables and generating the database management interface and dynamic web pages for querying the databases.
{AVAILABILITY}
http://www.mlst.net.},
number = {11},
urldate = {2012-09-18},
journal = {Bioinformatics},
author = {Chan, M S and Maiden, M C and Spratt, B G},
month = nov,
year = {2001},
note = {{PMID:} 11724739},
keywords = {Bacteria, Bacterial Typing Techniques, Computational Biology, Database Management Systems, Databases, Nucleic Acid, Genes, Bacterial, Internet, Sequence Analysis, {DNA}, Software, User-Computer Interface},
pages = {1077--1083}
},
@article{maiden_multilocus_1998,
title = {Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms},
volume = {95},
issn = {0027-8424},
shorttitle = {Multilocus sequence typing},
url = {http://www.ncbi.nlm.nih.gov/pubmed/9501229},
abstract = {Traditional and molecular typing schemes for the characterization of pathogenic microorganisms are poorly portable because they index variation that is difficult to compare among laboratories. To overcome these problems, we propose multilocus sequence typing {(MLST)}, which exploits the unambiguous nature and electronic portability of nucleotide sequence data for the characterization of microorganisms. To evaluate {MLST}, we determined the sequences of approximately 470-bp fragments from 11 housekeeping genes in a reference set of 107 isolates of Neisseria meningitidis from invasive disease and healthy carriers. For each locus, alleles were assigned arbitrary numbers and dendrograms were constructed from the pairwise differences in multilocus allelic profiles by cluster analysis. The strain associations obtained were consistent with clonal groupings previously determined by multilocus enzyme electrophoresis. A subset of six gene fragments was chosen that retained the resolution and congruence achieved by using all 11 loci. Most isolates from hyper-virulent lineages of serogroups A, B, and C meningococci were identical for all loci or differed from the majority type at only a single locus. {MLST} using six loci therefore reliably identified the major meningococcal lineages associated with invasive disease. {MLST} can be applied to almost all bacterial species and other haploid organisms, including those that are difficult to cultivate. The overwhelming advantage of {MLST} over other molecular typing methods is that sequence data are truly portable between laboratories, permitting one expanding global database per species to be placed on a World-Wide Web site, thus enabling exchange of molecular typing data for global epidemiology via the Internet.},
number = {6},
urldate = {2012-09-18},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
author = {Maiden, M C and Bygraves, J A and Feil, E and Morelli, G and Russell, J E and Urwin, R and Zhang, Q and Zhou, J and Zurth, K and Caugant, D A and Feavers, I M and Achtman, M and Spratt, B G},
month = mar,
year = {1998},
note = {{PMID:} 9501229},
keywords = {Bacterial Typing Techniques, Cluster Analysis, Evaluation Studies as Topic, Gene Frequency, Genes, Bacterial, Humans, Meningococcal Infections, Molecular Sequence Data, Neisseria meningitidis, Sequence Analysis, {DNA}, Virulence},
pages = {3140--3145}
},
@article{pagotto_canadian_2006,
title = {Canadian listeriosis reference service},
volume = {3},
issn = {1535-3141},
lccn = {0011},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16602988},
doi = {10.1089/fpd.2006.3.132},
abstract = {Listeria monocytogenes, a psychrotrophic organism capable of growing at refrigeration temperatures, is of major concern in extended shelf life, refrigerated foods. Considering that as much as 80-90\% of human listeriosis cases are linked to the ingestion of contaminated food, human cases are predominantly seen in high-risk individuals, including organ-transplant recipients, patients with {AIDS} and {HIV-infected} individuals, pregnant women, cancer patients, and the elderly. In 2001, the Canadian Listeriosis Reference Service {(LRS)} was created by the Bureau of Microbial Hazards {(Health} Canada) and the National Microbiology Laboratory (now part of the Public Health Agency of Canada). Major goals of the {LRS} include investigation of listeriosis cases and maintenance of a national collection of isolates. The {LRS} intends to create a comprehensive molecular epidemiological database of all isolates in Canada for use as a resource for outbreak investigations, research and other microbiological investigations. The {PFGE} profiles are being established and stored for clinical, food, environmental, and possibly animal strains of L. monocytogenes. The {LRS} pursues research activities for investigation and implementation of other molecular methods for characterizing L. monocytogenes isolates. Ribotyping, Multi-locus Sequence Typing {(MLST)}, Variable Number of Tandem Repeats {(VNTR)}, Multi-locus virulence sequence typing {(MLVA)}, microarray- based technologies and sequence-based typing schemes, are being investigated on selected diversity sets. The {LRS} has also used {PFGE} typing for outbreak investigations. The molecular epidemiological data, timely coordination and exchange of information should help to reduce the incidence of listeriosis in Canada. In Canada, listeriosis is not a national notifiable disease, except for the province of Quebec, where it has been since 1999. The {LRS}, Canadian Public Health Laboratory Network, and federal epidemiologists are currently working on making human listeriosis notifiable throughout Canada.},
number = {1},
urldate = {2012-09-15},
journal = {Foodborne Pathogens and Disease},
author = {Pagotto, Franco and Ng, Lai-King and Clark, Clifford and Farber, Jeff},
year = {2006},
note = {{PMID:} 16602988},
keywords = {Canada, Databases, Factual, Disease Notification, Food Contamination, Food Microbiology, Humans, Immunocompromised Host, Listeria monocytogenes, Listeriosis, Molecular Epidemiology, Public Health, Virulence},
pages = {132--137}
},
@article{knabel_sequence_2012,
title = {Sequence typing confirms that a predominant \emph{{Listeria monocytogenes}} clone caused human listeriosis cases and outbreaks in {Canada} from 1988 to 2010},
volume = {50},
issn = {1098-{660X}},
lccn = {0000},
url = {http://www.ncbi.nlm.nih.gov/pubmed/22337989},
doi = {10.1128/JCM.06185-11},
abstract = {Human listeriosis outbreaks in Canada have been predominantly caused by serotype 1/2a isolates with highly similar pulsed-field gel electrophoresis {(PFGE)} patterns. Multilocus sequence typing {(MLST)} and multi-virulence-locus sequence typing {(MVLST)} each identified a diverse population of Listeria monocytogenes isolates, and within that, both methods had congruent subtypes that substantiated a predominant clone (clonal complex 8; virulence type 59; proposed epidemic clone 5 {[ECV])} that has been causing human illness across Canada for more than 2 decades.},
number = {5},
urldate = {2012-09-14},
journal = {Journal of Clinical Microbiology},
author = {Knabel, Stephen J and Reimer, Aleisha and Verghese, Bindhu and Lok, Mei and Ziegler, Jennifer and Farber, Jeffrey and Pagotto, Franco and Graham, Morag and Nadon, Celine A and Gilmour, Matthew W},
month = may,
year = {2012},
note = {{PMID:} 22337989},
keywords = {Canada, Cluster Analysis, Disease Outbreaks, {DNA}, Bacterial, Humans, Listeria monocytogenes, Listeriosis, Molecular Epidemiology, Molecular Sequence Data, Molecular Typing, Sequence Analysis, {DNA}},
pages = {1748--1751}
},
@article{salcedo_development_2003,
title = {Development of a Multilocus Sequence Typing Method for Analysis of \emph{{Listeria monocytogenes}} Clones},
volume = {41},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/41/2/757},
doi = {10.1128/JCM.41.2.757-762.2003},
abstract = {This study is a first step in the development of multilocus sequence typing {(MLST)} method for Listeria monocytogenes. Nine housekeeping genes were analyzed in a set of 62 strains isolated from different sources and geographic locations in Spain. These strains were previously characterized by pulsed-field gel electrophoresis {(PFGE).} Because of low diversity, two loci were discarded from the study. The sequence analysis of the seven remaining genes showed 29 different allelic combinations, with 22 of them represented by only one strain. The results of this sequence analysis were generally consistent with those of {PFGE.} Because {MLST} allows the easy comparison and exchange of results obtained in different laboratories, the future application of this new molecular method could be a useful tool for the listeriosis surveillance systems that will allow the identification and distribution of analysis of L. monocytogenes clones in the environment.},
language = {en},
number = {2},
urldate = {2012-08-29},
journal = {Journal of Clinical Microbiology},
author = {Salcedo, C. and Arreaza, L. and Alcal\'a, B. and Fuente, L. de la and V\'azquez, J. A.},
month = feb,
year = {2003},
pages = {757--762}
},
@article{parisi_amplified_2010,
title = {Amplified Fragment Length Polymorphism and Multi-Locus Sequence Typing for high-resolution genotyping of \emph{{Listeria monocytogenes}} from foods and the environment},
volume = {27},
issn = {0740-0020},
url = {http://www.sciencedirect.com/science/article/pii/S0740002009001993},
doi = {10.1016/j.fm.2009.09.001},
abstract = {Standardized tools for typing Listeria monocytogenes isolates are required in epidemiological surveys investigating food-borne disease outbreaks and in the food-processing environment to identify the sources of contamination and routes by which the organisms are spread. In this survey Amplified Fragment Length Polymorphism {(AFLP)} and Multi-Locus Sequence Typing {(MLST)} have been used to study 103 L. monocytogenes isolates from food and environmental sources. A total of 62 {AFLP} types and 66 {MLST} Sequence Types were identified. {AFLP} and {MLST} produced similar results in terms of discriminating power. The Discrimination Index calculated for the two techniques was 0.976 for {AFLP} and 0.972 for {MLST.} These values were appreciably higher compared to serotyping (0.739). A good congruence was observed between {AFLP} and {MLST.} The present study demonstrated that {AFLP} and {MLST} subtyping are suitable tools for studying the epidemiology of L. monocytogenes. The great advantage of {MLST} over {AFLP} and other molecular typing methods based on fragment fingerprinting lies in the unambiguity of sequence data while {AFLP} is less costly and highly processive. In conclusion the two methods can be perfectly integrated for high-resolution genotyping of L. monocytogenes.},
number = {1},
urldate = {2012-08-24},
journal = {Food Microbiology},
author = {Parisi, Antonio and Latorre, Laura and Normanno, Giovanni and Miccolupo, Angela and Fraccalvieri, Rosa and Lorusso, Vanessa and Santagada, Gianfranco},
month = feb,
year = {2010},
keywords = {Amplified Fragment Length Polymorphism, {DNA} Fingerprinting, Listeria monocytogenes, Molecular Typing, Multi-Locus Sequence Typing},
pages = {101--108}
},
@article{meinersmann_multilocus_2004,
title = {Multilocus Sequence Typing of \emph{{Listeria monocytogenes}} by Use of Hypervariable Genes Reveals Clonal and Recombination Histories of Three Lineages},
volume = {70},
issn = {0099-2240},
lccn = {0046},
doi = {10.1128/AEM.70.4.2193-2203.2004},
abstract = {In an attempt to develop a method to discriminate among isolates of Listeria monocytogenes, the sequences of all of the annotated genes from the fully sequenced strain L. monocytogenes {EGD-e} (serotype 1/2a) were compared by {BLASTn} to a file of the unfinished genomic sequence of L. monocytogenes {ATCC} 19115 (serotype 4b). Approximately 7\% of the matching genes demonstrated 90\% or lower identity between the two strains, and the lowest observed identity was 80\%. Nine genes {(hisJ}, {cbiE}, {truB}, {ribC}, {comEA}, {purM}, {aroE}, {hisC}, and {addB)} in the 80 to 90\% identity group and two genes {(gyrB} and {rnhB)} with approximately 97\% identity were selected for multilocus sequence analysis in two sets of L. monocytogenes isolates (a 15-strain diversity set and a set of 19 isolates from a single food-processing plant). Based on concatenated sequences, a total of 33 allotypes were differentiated among the 34 isolates tested. Population genetics analyses revealed three lineages of L. monocytogenes that differed in their history of apparent recombination. Lineage I appeared to be completely clonal, whereas representatives of the other lineages demonstrated evidence of horizontal gene transfer and recombination. Although most of the gene sequences for lineage {II} strains were distinct from those of lineage I, a few strains with the majority of genes characteristic of lineage {II} had some that were characteristic of lineage I. Genes from lineage {III} organisms were mostly similar to lineage I genes, with instances of genes appearing to be mosaics with lineage {II} genes. Even though lineage I and lineage {II} generally demonstrated very distinct sequences, the sequences for the 11 selected genes demonstrated little discriminatory power within each lineage. In the L. monocytogenes isolate set obtained from one food-processing plant, lineage I and lineage {II} were found to be almost equally prevalent. While it appears that different lineages of L. monocytogenes can share habitats, they appear to differ in their histories of horizontal gene transfer.},
number = {4},
journal = {Applied and Environmental Microbiology},
author = {Meinersmann, Richard J. and Phillips, Robert W. and Wiedmann, Martin and Berrang, Mark E.},
month = apr,
year = {2004},
note = {{PMID:} 15066813
{PMCID:} 383165},
pages = {2193--2203}
}
%end MLST
%start ribotyping Listeria
@article{jacquet_typing_1992,
title = {Typing of \emph{{Listeria monocytogenes}} by restriction polymorphism of the ribosomal ribonucleic acid gene region},
volume = {276},
issn = {0934-8840},
url = {http://www.ncbi.nlm.nih.gov/pubmed/1349500},
abstract = {Ninety four strains of Listeria monocytogenes of different serovars and phagovars as well as of varying origins were characterized by ribosomal {RNA} gene restriction polymorphism. After digestion by {EcoRI} or {HindIII}, chromosomal {DNAs} were hybridized with a cloned {rDNA} probe from Bacillus subtilis that included the {16S} {rRNA} gene. The 94 strains were divided into 14 ribovars according to the different hybridization patterns generated by cleavage with {EcoRI.} Less important genomic heterogeneity could be detected when {DNAs} were digested by {HindIII.} {EcoRI} ribovars analysis allowed to describe a new typing scheme which did not corroborate routine typings such as serotyping and phage typing. It also confirmed a new view of this species in exhibiting a clone gathering most human strains, as first inferred from multilocus enzyme analysis {(Piffaretti} et al., 22).},
number = {3},
urldate = {2012-09-18},
journal = {Zentralblatt F\"ur Bakteriologie: International Journal of Medical Microbiology},
author = {Jacquet, C and Bille, J and Rocourt, J},
month = feb,
year = {1992},
note = {{PMID:} 1349500},
keywords = {Animals, Autoradiography, Bacteriophage Typing, Deoxyribonuclease {EcoRI}, Deoxyribonuclease {HindIII}, {DNA} Probes, {DNA}, Bacterial, Humans, Listeria monocytogenes, Nucleic Acid Hybridization, Polymorphism, Restriction Fragment Length, Restriction Mapping, {RNA}, Ribosomal, {16S}, {RNA}, Ribosomal, {23S}, Serotyping},
pages = {356--365}
},
@article{graves_comparison_1994,
title = {Comparison of ribotyping and multilocus enzyme electrophoresis for subtyping of \emph{{Listeria monocytogenes}} isolates.},
volume = {32},
issn = {0095-1137},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC264203/},
abstract = {Ribotyping was compared with multilocus enzyme electrophoresis {(MEE)} for subtyping 305 Listeria monocytogenes isolates from clinical and nonclinical sources. For ribotyping, {EcoRI-restricted} genomic {DNA} fragments of L. monocytogenes strains were separated by agarose gel electrophoresis, and Southern blots were probed with a cloned Escherichia coli {rrnB} operon (plasmid {pKK3535)} labeled with digoxigenin. The L. monocytogenes isolates were divided into 28 distinct ribotypes, while {MEE} analysis divided the same isolates into 78 electrophoretic types {(ETs).} On the basis of their ribotype profiles, the strains were divided into two subgroups. The ribotype alpha {(RT} alpha) subgroup contained serotypes 1/2a, 1/2c, and 3a, and the ribotype beta {(RT} beta) subgroup contained serotypes 1/2b, 3b, 4b, and 4ab. This division is in complete agreement with {MEE} analysis, which divides the species into two subgroups {(ET} groups A and B), with the same serotype distribution in each subgroup. Overall, {MEE} was more discriminating than ribotyping. However, in several instances ribotyping discriminated between isolates within the same {ET.} Ribotyping was more discriminating for serotypes 1/2a, 1/2c, and 3a {(Simpson's} Index for Diversity {[DI]} = 0.81) than for serotypes 1/2b and 4b {(DI} = 0.76). A substantial proportion (69\%) of serotype 1/2b and 4b strains clustered in five {ETs} and five ribotypes. These data suggest that ribotyping and {MEE} do not provide adequate discrimination between strains of serotypes 1/2b and 4b. Methods such as pulsed-field gel electrophoresis and random amplified polymorphic {DNA} analysis should be explored for further discrimination of strains of these serotypes.},
number = {12},
urldate = {2012-09-18},
journal = {Journal of Clinical Microbiology},
author = {Graves, L M and Swaminathan, B and Reeves, M W and Hunter, S B and Weaver, R E and Plikaytis, B D and Schuchat, A},
month = dec,
year = {1994},
note = {{PMID:} 7883880
{PMCID:} {PMC264203}},
pages = {2936--2943}
},
@article{de_cesare_prevalence_2007,
title = {Prevalence of \emph{{Listeria monocytogenes}} in fresh and fermented {Italian} sausages and ribotyping of contaminating strains},
volume = {120},
issn = {0168-1605},
url = {http://www.sciencedirect.com/science/article/pii/S0168160507003042},
doi = {10.1016/j.ijfoodmicro.2007.06.009},
abstract = {Listeria monocytogenes has been detected in fresh as well as dry and semidry fermented sausages, rendering preparation and consumption of these products as a potential risk to human health. The aims of this study were (1) to evaluate the L. monocytogenes prevalence in 288 fresh and 237 fermented sausages produced in northern Italy; (2) to quantify the average pathogen Most Probable Number {(MPN)} per g of sausage; (3) to evaluate the sausage strain genetic diversity by automated {PvuII} ribotyping; and (4) to predict the pathogenicity lineage of these isolates determining their {DuPont} Identification Library Codes {(DUP-IDs)} by {EcoRI} ribotyping.
The overall prevalence of L. monocytogenes in the sampled sausages was 28.2\%. The percentage of L. monocytogenes positive fresh sausages was significantly higher than that of fermented sausages (i.e. 38.9 vs 15.2\%), which had a pathogen load always lower than 10 {MPN/g.} In contrast, 16.1\% of fresh sausages were contaminated by 10 to 100 {MPN/g} and 20.5\% had more than 100 {MPN/g.}
{PvuII} successfully discriminated sausage isolates with a Simpson's numerical index of discrimination of 0.637. A total of 12 and 9 different {PvuII} ribogroups were identified among 47 fresh and 24 fermented randomly selected sausage strains, respectively. Six of those ribogroups were shared between strains contaminating both kinds of sausages. According to the evaluation of the strain {DUP-IDs}, the majority of the isolates investigated in this study were part of the type {II} L. monocytogenes pathogenicity lineage, but type I lineage strains were identified among fermented sausage isolates.
In conclusion, L. monocytogenes prevalence in Italian sausages was estimated to be around 28.2\%. However, 84.2\% of the samples were contaminated by less than 100 {MPN} of L. monocytogenes per g and the majority of L. monocytogenes contaminating strains would be classified in the type {II} pathogenicity lineage, including serotypes 1/2a, 1/2c and 3a.},
number = {1–2},
urldate = {2012-09-18},
journal = {International Journal of Food Microbiology},
author = {De Cesare, Alessandra and Mioni, Renzo and Manfreda, Gerardo},
month = nov,
year = {2007},
keywords = {Enumeration, Listeria monocytogenes, Prevalence, Ribotyping, Sausages},
pages = {124--130}
},
@article{kabuki_molecular_2004,
title = {Molecular Subtyping and Tracking of \emph{{Listeria monocytogenes}} in {Latin}-Style Fresh-Cheese Processing Plants},
volume = {87},
issn = {0022-0302},
url = {http://www.sciencedirect.com/science/article/pii/S0022030204734086},
doi = {10.3168/jds.S0022-0302(04)73408-6},
abstract = {Latin-style fresh cheeses, which have been linked to at least 2 human listeriosis outbreaks in the United States, are considered to be high-risk foods for Listeria monocytogenes contamination. We evaluated L. monocytogenes contamination patterns in 3 Latin-style fresh-cheese processing plants to gain a better understanding of L. monocytogenes contamination sources in the manufacture of these cheeses. Over a 6-mo period, 246 environmental samples were collected and analyzed for L. monocytogenes using both the Food and Drug Administration {(FDA)} method and the Biosynth L. monocytogenes detection system {(LMDS).} Finished cheese samples from the same plants (n = 111) were also analyzed by the {FDA} method, which was modified to include L. monocytogenes plating medium {(LMPM)} and the L. monocytogenes confirmatory plating medium {(LMCM)} used in the {LMDS} method. Listeria monocytogenes was detected in 6.3\% of cheese and 11.0\% of environmental samples. Crates, drains, and floor samples showed the highest contamination rates, with 55.6, 30.0, and 20.6\% L. monocytogenes positive samples, respectively. Finished products and food contact surfaces were positive in only one plant. The {FDA} method showed a higher sensitivity than the {LMDS} method for detection of L. monocytogenes from environmental samples. The addition of {LMPM} and {LMCM} media did not further enhance the performance of the {FDA} method for L. monocytogenes detection from finished products. Molecular subtyping {(PCR-based} allelic analysis of the virulence genes {actA} and hly and automated ribotyping) was used to track contamination patterns. Ribotype {DUP-1044A}, which had previously been linked to a 1998 multistate human listeriosis outbreak in the United States, was the most commonly identified subtype (20/36 isolates) and was isolated from 2 plants. This ribotype was persistent and widespread in one factory, where it was also responsible for the contamination of finished products. We hypothesize that this ribotype may represent a clonal group with a specific ability to persist in food processing environments. While previous listeriosis outbreaks were linked to Latin-style fresh cheeses made from unpasteurized milk, the presence of this organism in pasteurized cheese products illustrates that persistent environmental contamination also represents an important source of finished product contamination.},
number = {9},
urldate = {2012-09-18},
journal = {Journal of Dairy Science},
author = {Kabuki, {D.Y.} and Kuaye, {A.Y.} and Wiedmann, M. and Boor, {K.J.}},
month = sep,
year = {2004},
keywords = {Latin-style fresh cheese, Listeria monocytogenes, Molecular subtyping},
pages = {2803--2812}
},
@article{wiedmann_ribotypes_1997,
title = {Ribotypes and virulence gene polymorphisms suggest three distinct \emph{{Listeria monocytogenes}} lineages with differences in pathogenic potential.},
volume = {65},
issn = {0019-9567},
lccn = {0259},
abstract = {A total of 133 Listeria monocytogenes isolates were characterized by ribotyping and allelic analysis of the virulence genes hly, {actA}, and {inlA} to uncover linkages between independent phylogenetic and specific virulence markers. {PCR-restriction} fragment length polymorphisms revealed 8 hly, 11 inl4, and 2 {actA} alleles. The combination of these virulence gene alleles and ribotype patterns separated L. monocytogenes into three distinct lineages. While distinct hly and {inlA} alleles were generally found to cluster into these three lineages, {actA} alleles segregated independently. These three phylogenetic lineages were confirmed when 22 partial {actA} {DNA} sequences were analyzed. The clinical history of the L. monocytogenes strains showed evidence for differences in pathogenic potential among the three lineages. Lineage I contains all strains isolated during epidemic outbreaks of listeriosis, while no human isolates were found in lineage {III.} Animal isolates were found in all three lineages. We found evidence that isolates from lineages I and {III} have a higher plaquing efficiency than lineage {II} strains in a cell culture assay. Strains from lineage {III} also seem to form larger plaques than strains from lineage {II.} A distinctive ribotype fragment and unique {16S} {rRNA} gene sequences furthermore suggest that lineage {III} might represent a L. monocytogenes subspecies. None of the 20 human isolates available but 11\% of our animal isolates were grouped in this lineage, indicating that strains in this lineage might have reduced virulence for humans.},
number = {7},
journal = {Infection and Immunity},
author = {Wiedmann, M and Bruce, J L and Keating, C and Johnson, A E and {McDonough}, P L and Batt, C A},
month = jul,
year = {1997},
note = {{PMID:} 9199440
{PMCID:} 175382},
pages = {2707--2716}
}
%end ribotyping
%serotyping of Listeria
@article{palumbo_serotyping_2003,
title = {Serotyping of \emph{{Listeria monocytogenes}} by Enzyme-Linked Immunosorbent Assay and Identification of Mixed-Serotype Cultures by Colony Immunoblotting},
volume = {41},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/41/2/564},
doi = {10.1128/JCM.41.2.564-571.2003},
abstract = {Routine analysis of Listeria monocytogenes by serotyping using traditional agglutination methods is limited in use because of the expense and limited availability of commercially prepared antisera and intra- and interlaboratory discrepancies arising from differences in antiserum preparation and visual determination of agglutination. We have adapted a commercially available set of L. monocytogenes antisera to an enzyme-linked immunosorbent assay {(ELISA)} format for high-throughput, low-cost serotype determination. Rather than subjective visualization of agglutination, positive antigen and antiserum reactions were scored by a quantitative, colorimetric reaction. {ELISA} serotyping of 89 of 101 L. monocytogenes isolates agreed with slide agglutination serotyping data, and 100 previously uncharacterized isolates were serotyped unambiguously by the {ELISA} method. In addition, mixed-serotype cultures of L. monocytogenes were identified by a colony immunoblot procedure, in which serogroup 1/2 and serogroup 4 colonies were discriminated by differential staining.},
language = {en},
number = {2},
urldate = {2012-09-18},
journal = {Journal of Clinical Microbiology},
author = {Palumbo, Jeffrey D. and Borucki, Monica K. and Mandrell, Robert E. and Gorski, Lisa},
month = feb,
year = {2003},
pages = {564--571}
},
@article{doumith_new_2004,
title = {New Aspects Regarding Evolution and Virulence of \emph{{Listeria monocytogenes}} Revealed by Comparative Genomics and {DNA} Arrays},
volume = {72},
issn = {0019-9567},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC321639/},
doi = {10.1128/IAI.72.2.1072-1083.2004},
abstract = {Listeria monocytogenes is a food-borne bacterial pathogen that causes a wide spectrum of diseases, such as meningitis, septicemia, abortion, and gastroenteritis, in humans and animals. Among the 13 L. monocytogenes serovars described, invasive disease is mostly associated with serovar 4b strains. To investigate the genetic diversity of L. monocytogenes strains with different virulence potentials, we partially sequenced an epidemic serovar 4b strain and compared it with the complete sequence of the nonepidemic L. monocytogenes {EGDe} serovar 1/2a strain. We identified an unexpected genetic divergence between the two strains, as about 8\% of the sequences were serovar 4b specific. These sequences included seven genes coding for surface proteins, two of which belong to the internalin family, and three genes coding for transcriptional regulators, all of which might be important in different steps of the infectious process. Based on the sequence information, we then characterized the gene content of 113 Listeria strains by using a newly designed Listeria array containing the “flexible” part of the sequenced Listeria genomes. Hybridization results showed that all of the previously identified virulence factors of L. monocytogenes were present in the 93 L. monocytogenes strains tested. However, distinct patterns of the presence or absence of other genes were identified among the different L. monocytogenes serovars and Listeria species. These results allow new insights into the evolution of L. monocytogenes, suggesting that early divergence of the ancestral L. monocytogenes serovar 1/2c strains from the serovar 1/2b strains led to two major phylogenetic lineages, one of them including the serogroup 4 strains, which branched off the serovar 1/2b ancestral lineage, leading (mostly by gene loss) to the species Listeria innocua. The identification of 30 L. monocytogenes-specific and several serovar-specific marker genes, such as three L. monocytogenes serovar 4b-specific surface protein-coding genes, should prove powerful for the rapid tracing of listeriosis outbreaks, but it also represents a fundamental basis for the functional study of virulence differences between L. monocytogenes strains.},
number = {2},
urldate = {2012-09-18},
journal = {Infection and Immunity},
author = {Doumith, Michel and Cazalet, Christel and Simoes, Natalie and Frangeul, Lionel and Jacquet, Christine and Kunst, Frank and Martin, Paul and Cossart, Pascale and Glaser, Philippe and Buchrieser, Carmen},
month = feb,
year = {2004},
note = {{PMID:} 14742555
{PMCID:} {PMC321639}},
pages = {1072--1083},
annote = {molecular serotyping
epi investigations have to be supported by other std typing methods}
},
@article{kerouanton_evaluation_2010,
title = {Evaluation of a multiplex {PCR} assay as an alternative method for \emph{{Listeria monocytogenes}} serotyping},
volume = {80},
issn = {0167-7012},
url = {http://www.sciencedirect.com/science/article/pii/S0167701209003741},
doi = {10.1016/j.mimet.2009.11.008},
abstract = {Listeria monocytogenes serotyping is commonly used as the first level of characterisation in the epidemiological surveillance of food and clinical isolates and is therefore widely accepted. The aim of this study was to define a scheme for multiplex molecular serotyping of L. monocytogenes based on a previously described {PCR} assay and then to evaluate and compare this new procedure with conventional serotyping by agglutination. The study included 1204 Listeria strains collected from food products in France, from March 2005 to October 2006. Two multiplex {PCR} assays were designed to cluster L. monocytogenes strains into five molecular serogroups: {IIa}, {IIb}, {IIc}, {IVa}, {IVb} in agreement with the most commonly encountered serotypes. Amplification of the {prfA} gene was added to the multiplex {PCR} to check for L. monocytogenes species; forty-eight (4\%) of the isolates tested belonged to the genus Listeria but were not L. monocytogenes. Using this first multiplex {PCR}, the concordance between conventional and molecular methods was 90.6\%, 97.8\%, 100\% and 100\%, for 1/2a, 1/2c, 1/2b and 4b serotypes respectively. False results were observed for some atypical 1/2a, 3a and 1/2c strains. Therefore, this lack of specificity was resolved by using an additional {PCR} assay based on amplification of the {flaA} gene, a specific target of 1/2a and 3a strains. When applying the second {PCR} assay to {IIa} and {IIc} molecular serogroup strains, total agreement was obtained between molecular and conventional serotyping methods with a lower level of discrimination for the molecular one. This study proposes to define a strategy for molecular serotyping using both {PCR} assays: a multiplex and the {flaA} {PCR} in order to assign the atypical 1/2a, 3a and 1/2c strains. Moreover, prs gene detection was added for Listeria genus recognition as a positive control in association with {flaA} detection. Indeed, this molecular serotyping scheme could be considered as a useful and rapid method for first-level characterisation of the most frequently encountered L. monocytogenes serotypes.},
number = {2},
urldate = {2012-09-18},
journal = {Journal of Microbiological Methods},
author = {K\'{e}rouanton, Anna\"{e}lle and Marault, Muriel and Petit, Laetitia and Grout, Jo\"{e}l and Dao, Trinh Tam and Brisabois, Anne},
month = feb,
year = {2010},
keywords = {Listeria monocytogenes, Molecular serogroup, Serotyping, Subtyping},
pages = {134--137}
},
@article{paterson_antigenic_1940,
title = {The antigenic structure of organisms of the genus \emph{{Listerella}}},
volume = {51},
issn = {0368-3494, 1555-2039},
lccn = {0044},
url = {http://0-onlinelibrary.wiley.com.darius.uleth.ca/doi/10.1002/path.1700510310/abstract;jsessionid=401B59B81BBD9955EFC447406A7DA5DF.d03t04},
doi = {10.1002/path.1700510310},
number = {3},
urldate = {2012-09-18},
journal = {The Journal of Pathology and Bacteriology},
author = {Paterson, J. Stuart},
month = nov,
year = {1940},
pages = {427--436}
},
@article{seeliger_serological_1989,
title = {Serological analysis of the genus \emph{{Listeria}}. Its values and limitations},
volume = {8},
issn = {0168-1605},
lccn = {0006},
url = {http://www.sciencedirect.com/science/article/pii/0168160589900202},
doi = {10.1016/0168-1605(89)90020-2},
number = {3},
urldate = {2012-09-18},
journal = {International Journal of Food Microbiology},
author = {Seeliger, {H.P.R.} and Langer, B.},
month = jun,
year = {1989},
keywords = {Flagellar antigens, Hemolysins, Listeria, Serovars, Somatic antigens},
pages = {245--248}
},
@article{mclauchlin_distribution_1990,
title = {Distribution of serovars of \emph{{Listeria monocytogenes}} isolated from different categories of patients with listeriosis},
volume = {9},
issn = {0934-9723},
lccn = {0000},
url = {http://www.ncbi.nlm.nih.gov/pubmed/2110901},
abstract = {An analysis was made of the distribution of serovars of Listeria monocytogenes isolated from 1363 patients with listeriosis. Overall, serovar 4b was found in 64\% of cases, serovar 1/2a in 15\%, serovar 1/2b in 10\%, and serovar 1/2c in 4\%. The patients were categorised as pregnancy associated cases, non-pregnant previously healthy cases, and non-pregnant cases with severe underlying illness. The serovars were unequally distributed between these three groups of patients. Serovar 1/2b occurred most often in the non-pregnant cases with severe underlying illness, and serovar 1/2c occurred least frequently in the pregnancy associated cases. Serovar 4b occurred more often in the pregnancy associated cases than in previously healthy non-pregnant cases, and more often in the latter than in those with underlying illness. Similar distributions of the serovars between the categories of patients occurred over different time periods. These results may be interpreted as indicating an association between virulence and serological type of Listeria monocytogenes.},
number = {3},
urldate = {2012-09-18},
journal = {European Journal of Clinical Microbiology \& Infectious Diseases: Official Publication of the European Society of Clinical Microbiology},
author = {{McLauchlin}, J},
month = mar,
year = {1990},
note = {{PMID:} 2110901},
keywords = {Female, Humans, Infant, Newborn, Listeria monocytogenes, Listeriosis, Pregnancy, Pregnancy Complications, Infectious, Serotyping},
pages = {210--213}
},
@article{liu_identification_2006,
title = {Identification, subtyping and virulence determination of \emph{{Listeria monocytogenes}}, an important foodborne pathogen},
volume = {55},
issn = {0022-2615, 1473-5644},
lccn = {0108},
url = {http://jmm.sgmjournals.org/content/55/6/645},
doi = {10.1099/jmm.0.46495-0},
abstract = {Listeria monocytogenes is an opportunistic intracellular pathogen that has become an important cause of human foodborne infections worldwide. Given its close relationship to other Listeria species and its tendency to produce non-specific clinical symptoms, the availability of rapid, sensitive and specific diagnostic tests for the differentiation of L. monocytogenes from other Listeria species is helpful for selecting appropriate treatment regimens. In addition, with L. monocytogenes comprising a diversity of strains of varying pathogenicity, the ability to precisely track the strains involved in listeriosis outbreaks and speedily determine their pathogenic potential is critical for the control and prevention of further occurrences of this deadly disease. Extensive research in recent decades has revealed significant insights regarding the molecular mechanisms of L. monocytogenes infection. This in turn has facilitated the development of laboratory procedures for enhanced detection and identification of L. monocytogenes, and has also contributed to the implementation of improved control and prevention strategies against listeriosis. The purpose of this review is to summarize recent progress in the species-specific identification, subtyping and virulence determination of L. monocytogenes strains, and to discuss future research needs pertaining to these important areas of listeriosis.},
language = {en},
number = {6},
urldate = {2012-09-17},
journal = {Journal of Medical Microbiology},
author = {Liu, Dongyou},
month = jun,
year = {2006},
pages = {645--659}
},
@article{huang_observation_2011,
title = {Observation of a New Pattern in Serogroup-Related {PCR} Typing of \emph{{Listeria monocytogenes}} 4b Isolates},
volume = {49},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/49/1/426},
doi = {10.1128/JCM.01207-10},
abstract = {Molecular serogroup-related {PCR} typing has made the determination of serotypes of Listeria monocytogenes isolates easy and rapid. Amplification of selected lineage- and serotype-related genes can produce serotype patterns reflecting the four major serotypes, 1/2a, 1/2b, 1/2c, and 4b. We found that four isolates in our routine testing had a pattern with the four bands lmo0737, {ORF2110}, {ORF2819}, and prs positive, a pattern which has not been previously reported in the literature. After testing with a lineage-specific {PCR}, hybridization, and conventional agglutination serotyping, the isolates with the new pattern were considered to be serotype 4b.},
language = {en},
number = {1},
urldate = {2012-09-11},
journal = {Journal of Clinical Microbiology},
author = {Huang, Bixing and Fang, Ningxia and Dimovski, Karolina and Wang, Xian and Hogg, Geoff and Bates, John},
month = jan,
year = {2011},
pages = {426--429}
},
@article{doumith_differentiation_2004,
title = {Differentiation of the Major \emph{{Listeria monocytogenes}} Serovars by Multiplex {PCR}},
volume = {42},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/42/8/3819},
doi = {10.1128/JCM.42.8.3819-3822.2004},
abstract = {A new multiplex {PCR} assay was developed to separate the four major Listeria monocytogenes serovars isolated from food and patients (1/2a, 1/2b, 1/2c, and 4b) into distinct groups. The {PCR} test, which constitutes a rapid and practical alternative to laborious classical serotyping, was successfully evaluated with 222 Listeria strains.},
language = {en},
number = {8},
urldate = {2012-09-11},
journal = {Journal of Clinical Microbiology},
author = {Doumith, Michel and Buchrieser, Carmen and Glaser, Philippe and Jacquet, Christine and Martin, Paul},
month = aug,
year = {2004},
pages = {3819--3822},
annote = {serotyping {PCR} assay
{TABLE}  1.  Nucleotide sequences of primer sets used in this {studyGenetargetPrimer} sequence (5-3) a Productsize {(bp)Serovar} specificity b Protein encoded by thetarget genelmo0737        For: {AGGGCTTCAAGGACTTACCC} 691          L. monocytogenes serovars 1/2a, 1/2c,3a, and {3cUnknown}, no {similarityRev:} {ACGATTTCTGCTTGCCATTClmo1118}         For: {AGGGGTCTTAAATCCTGGAA} 906          L. monocytogenes serovars 1/2c and 3c Unknown, no {similarityRev:} {CGGCTTGTTCGGCATACTTAORF2819}       For: {AGCAAAATGCCAAAACTCGT} 471          L. monocytogenes serovars 1/2b, 3b, 4b,4d, and {4ePutative} transcriptional {regulatorRev:} {CATCACTAAAGCCTCCCATTGORF2110}       For: {AGTGGACAATTGATTGGTGAA} 597          L. monocytogenes serovars 4b, 4d, and 4e       Putative secreted {proteinRev:} {CATCCATCCCTTACTTTGGACprs} For: {GCTGAAGAGATTGCGAAAGAAG} 370          All Listeria species Putative phosphoribosyl pyrophos-phate synthetase Rev: {CAAAGAAACCTTGGATTTGCGG}
 
a For, forward; Rev, reverse.b For the specificity of lmo1118 gene fragment amplification within L. monocytogenes strains of serovar 1/2c or 3c, we note the exception of the serovar 1/2a {EGDestrain} in which the gene was first identified.}
},
%end serotyping
%continued utility of phage typing
@article{baggesen_phage_2010,
title = {Phage typing of \emph{{Salmonella typhimurium}} - is it still a useful tool for surveillance and outbreak investigation?},
volume = {15},
issn = {1560-7917},
url = {http://www.ncbi.nlm.nih.gov/pubmed/20122382},
abstract = {Phage typing has for decades been useful as a phenotypical, definitive method for epidemiological characterisation of Salmonella Typhimurium. The system recommended by the World Health Organization {(WHO)} Collaborative Centre for phage typing of Salmonella has, however, become rather complex, and the present study illustrates the challenges of sufficient standardisation of the interpretation of lysis results to make sure that the same strain is assigned to the same phage type in different laboratories. Even though molecular typing methods will replace phenotypic characterisation methods in the future, it is our opinion that phage typing will remain for some time a useful tool to strengthen global Salmonella surveillance. Therefore, improved standardisation and quality assurance is essential to obtain a robust and harmonized method that allows comparison of results between laboratories.},
number = {4},
urldate = {2012-09-17},
journal = {Euro Surveillance: Bulletin Européen Sur Les Maladies Transmissibles = European Communicable Disease Bulletin},
author = {Baggesen, D L and S{\o}rensen, G and Nielsen, E M and Wegener, H C},
month = jan,
year = {2010},
note = {{PMID:} 20122382},
keywords = {Bacteriophage Typing, Denmark, Disease Outbreaks, Europe, Humans, Salmonella Food Poisoning, Salmonella typhimurium, World Health Organization},
pages = {19471}
},
%phage-typing of Listeria
@article{lemaitre_optimization_1997,
title = {Optimization of the detection of bacteriophages induced from \emph{{Listeria}} sp},
volume = {24},
issn = {0266-8254},
url = {http://www.ncbi.nlm.nih.gov/pubmed/9024005},
abstract = {It is necessary to isolate new phages in order to improve the rate of typeability of Listeria monocytogenes strains. We propose a method which increases the detection of induced phages in the presence of inhibitory substances synthesized or liberated by the cells during phage production. Of the 29 phages isolated, 11 (38\%) were detected by the spot-on-the-lawn technique and 18 (62\%) were revealed by the soft-agar technique. To increase the rate of phage detection, both techniques appear useful. Listeria cultures were subjected to phage typing procedures utilizing these newly isolated phages and the French International set of phages. It appears that the newly isolated phages are good tools for the differentiation of Listeria strains. Among them, one phage seems to be complementary to the French International set.},
number = {1},
urldate = {2012-09-17},
journal = {Letters in Applied Microbiology},
author = {Lema\^{i}tre, J P and Delcourt, A and Rousset, A},
month = jan,
year = {1997},
note = {{PMID:} 9024005},
keywords = {Bacteriophage Typing, Bacteriophages, Listeria, Listeria monocytogenes, Viral Plaque Assay},
pages = {51--54}
},
@article{audurier_phage_1989,
title = {Phage typing of \emph{{Listeria monocytogenes}}},
volume = {8},
issn = {0168-1605},
url = {http://www.sciencedirect.com/science/article/pii/0168160589900226},
doi = {10.1016/0168-1605(89)90022-6},
number = {3},
urldate = {2012-09-17},
journal = {International Journal of Food Microbiology},
author = {Audurier, A. and Martin, C.},
month = jun,
year = {1989},
keywords = {Epidemiology, Listeria monocytogenes, Phage typing},
pages = {251--257}
},
@article{capita_evaluation_2002,
title = {Evaluation of the international phage typing set and some experimental phages for typing of \emph{{Listeria monocytogenes}} from poultry in {Spain}},
volume = {92},
issn = {1364-5072},
url = {http://www.ncbi.nlm.nih.gov/pubmed/11849332},
abstract = {{AIMS}
The validity of the international phage set and 13 experimental phages for subtyping Listeria monocytogenes strains isolated from poultry in Spain was investigated.
{METHODS} {AND} {RESULTS}
Ninety-six L. monocytogenes strains (52 from serogroup 1/2 and 44 from serogroup 4) were phage-typed using the international phage set, 10 experimental phages for typing serogroup 1/2 strains (seven isolated in France: 1313, 9425, 1807, 351, 881, 717 and 586-, and three from Denmark: 5775, 12682 and 6223-) and three experimental phages isolated in France for typing serogroup 4 strains (2425 A, 4286 and 197). Percentages of serogroup 1/2, serogroup 4 and total phage-typeable strains were 57.7\%, 52.3\% and 55.2\%, respectively. Important differences in the behaviour of the phages tested were found. The typeability rate, the specificity index and the percentage of strong reactions were greater in the phages of international set than in the experimental phages. The number of phage typeable strains and the number of phage types (42) were not modified by the use of experimental phages.
{CONCLUSIONS}
The phage set used was not effective for typing L. monocytogenes strains from poultry in Spain, because a low typeability rate was found.
{SIGNIFICANCE} {AND} {IMPACT} {OF} {THE} {STUDY}
Our results suggest the importance of the availability of new phages specific to a geographical area in order to improve the typeability of the system.},
number = {1},
urldate = {2012-09-17},
journal = {Journal of Applied Microbiology},
author = {Capita, R and Alonso-Calleja, C and Mereghetti, L and Moreno, B and del Camino Garc\'{i}a-Fern\'{a}ndez, M},
year = {2002},
note = {{PMID:} 11849332},
keywords = {Abattoirs, Animals, Bacteriophage Typing, Bacteriophages, Chickens, International Cooperation, Listeria monocytogenes, Listeriosis, Poultry Diseases, Spain},
pages = {90--96}
},
@article{gerner-smidt_new_1993,
title = {A new {Danish} \emph{{Listeria monocytogenes}} phage typing system},
volume = {101},
issn = {0903-4641},
url = {http://www.ncbi.nlm.nih.gov/pubmed/8489767},
abstract = {A phage typing system was developed for Listeria monocytogenes. Phages were released from clinical and from food strains of L. monocytogenes by mitomycin C induction. The system consists of two subsystems, one of which is used to type L. monocytogenes serotype 1 strains, containing 12 phages, and a second which is used to type serotype 4 strains, containing 14 other phages. For the serotype 1 subsystem, the reproducibility was {\textgreater} or = 90\%, the typability 92\%, and the discriminatory power, as judged by the discriminatory index, 80\%. The corresponding figures for the serotype 4 subsystem were: reproducibility {\textgreater} or = 94\%, typability 87\%, and discriminatory index 87\%. The performance of the whole typing system is sufficient for it to be used for screening purposes.},
number = {2},
urldate = {2012-09-17},
journal = {{APMIS:} Acta Pathologica, Microbiologica, Et Immunologica Scandinavica},
author = {Gerner-Smidt, P and Rosdahl, V T and Frederiksen, W},
month = feb,
year = {1993},
note = {{PMID:} 8489767},
keywords = {Bacteriophage Typing, Evaluation Studies as Topic, Food Microbiology, Humans, Listeria monocytogenes, Mitomycins},
pages = {160--167}
},
@article{mclauchlin_aspects_1986,
title = {Aspects of the epidemiology of human \emph{{Listeria monocytogenes}} infections in {Britain} 1967-1984; the use of serotyping and phage typing},
volume = {22},
issn = {0022-2615},
url = {http://www.ncbi.nlm.nih.gov/pubmed/3098979},
abstract = {Strains of Listeria monocytogenes from 475 cases of human listeriosis collected during 1967-1984, belonged to one of three serogroups (1/2, 3 or 4). They were phage typed with a set of 28 phages to investigate three aspects of the epidemiology of listeriosis. Three patients each had two episodes of listeriosis, 3 months to 2 years apart, with strains of the same serogroup and indistinguishable by phage typing. Ten episodes of possible cross-infection between pairs of neonates in the same hospital occurred; the first baby was ill at or within 1 day of birth, and the second baby became ill 8-12 days after contact with the first. In each pair the L. monocytogenes strains were of the same serogroup and indistinguishable by phage typing. In three clusters of cases there may have been a common source of infection. L. monocytogenes strains from 10 of 11 cases of listeriosis in the Carlisle area in Jul.-Dec. 1981 were of the same serogroup; nine strains were non-phage-typable. The second cluster involved four adults treated at one hospital and the third a pair of neonates who were ill shortly after birth. In each cluster, strains were of the same serogroup, and were indistinguishable by phage typing. These last two clusters occurred during a short period when an unusually high proportion of strains from all cases of human listeriosis in Britain were indistinguishable by phage typing from the cluster strains, suggesting the possibility of common source infection.},
number = {4},
urldate = {2012-09-17},
journal = {Journal of Medical Microbiology},
author = {{McLauchlin}, J and Audurier, A and Taylor, A G},
month = dec,
year = {1986},
note = {{PMID:} 3098979},
keywords = {Adult, Bacteriophage Typing, Cross Infection, Great Britain, Humans, Infant, Newborn, Listeria monocytogenes, Listeriosis, Meningitis, Listeria, Recurrence, Sepsis, Serotyping},
pages = {367--377}
},
@article{van_der_mee-marquet_evaluation_1997,
title = {Evaluation of seven experimental phages for inclusion in the international phage set for the epidemiological typing of \emph{{Listeria monocytogenes}}},
volume = {63},
issn = {0099-2240},
url = {http://www.ncbi.nlm.nih.gov/pubmed/9292987},
abstract = {The purpose of our study was to evaluate the inclusion of seven experimental phages into the international phage set for subtyping Listeria monocytogenes. The seven additional phages included the broad-host-range virulent Myoviridae phage A511 {(M.} J. Loessner, Appl. Environ. Microbiol. 57:1912-1918, 1991), three temperate phages from the Danish subsystem for typing serotype 1/2 strains (12682, 6223, and 5775) {(P.} Gerner-Smidt, {V.T.} Rosdahl, and W. Frederiksen, {APMIS} 101:160-167, 1993), and three temperate phages isolated by this laboratory in France (9425, 1313, and 197). A panel of 395 Listeria monocytogenes isolates (including 180 that were non-phage typeable by the international set) were used in the study for a comparison of the lytic spectra of the various bacteriophages. These results showed that the inclusion of five of the experimental phages contributed greatly to the overall typeability and discriminatory power of the system, especially for strains within serogroup 1/2.},
number = {9},
urldate = {2012-09-17},
journal = {Applied and Environmental Microbiology},
author = {van der Mee-Marquet, N and Loessner, M and Audurier, A},
month = sep,
year = {1997},
note = {{PMID:} 9292987},
keywords = {Animals, Bacteriophage Typing, Epidemiologic Methods, Evaluation Studies as Topic, Humans, Listeria monocytogenes, Listeriosis, Myoviridae, Seroepidemiologic Studies},
pages = {3374--3377}
},
@article{audurier_bacteriophage_1979,
title = {Bacteriophage typing of 823 \emph{{Listeria monocytogenes}} strains isolated in {France} from 1958 to 1978},
volume = {{130B}},
issn = {0300-5410},
url = {http://www.ncbi.nlm.nih.gov/pubmed/119457},
abstract = {This study was undertaken to establish a typing scheme for Listeria monocytogenes. A total of 823 strains, isolated in France from 1958 to 1978, were studied; 69.4\% of these belonged to serotype 4. Using a set of 20 phages, the lytic activity, frequency and specific character of these phages were estimated and phage typing carried out. We were able to define a phage typing system for L. monocytogenes using 12 principal phages and 3 secondary phages. In order to discriminate phages types within serotype 1, the phages 1, 3, 4, 5, 6 and 7 were used, and for phage types within serotype 4, the phages 10, 11, 14, 15, 16 and 17. Secondary phages 8, 9 and 20 had a weak lytic activity, but their specificity was very high. The lytic patterns obtained with the phages 9 and 20 were restricted to strains of serotype 5. We established a complete correlation between the lytic pattern of phages 1 to 8 and serotype 1, just as there was a correlation between the lytic pattern of phages 10 to 19 and serotype 4. Using the set of 20 phages we were able to type 645 of 823 strains of L. monocytogenes. Thus we were able to type 78.4\% of all the strains examined. This percentage was very different according to the serotype of the strains tested: 88\% of strains of serotype 4 and 57\% of strains of serotype 1. With this set of phages 552 of 645 typable strains could be subdivided into 8 principal phagetypes: 3 types within the serotype 1 and 5 others in serotype 4. This phage typing system can be used in some epidemiological situations, in taxonomic investigations or as bacterial markers.},
number = {2},
urldate = {2012-09-17},
journal = {Annales De Microbiologie},
author = {Audurier, A and Chatelain, R and Chalons, F and Pi\'{e}chaud, M},
month = sep,
year = {1979},
note = {{PMID:} 119457},
keywords = {Animals, Bacteriophage Typing, France, Humans, Listeria monocytogenes, Serotyping},
pages = {179--189}
},
@article{audurier_phage_1984,
title = {A phage typing system for \emph{{Listeria monocytogenes}} and its use in epidemiological studies},
volume = {7},
issn = {0147-{958X}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/6442645},
abstract = {A phage-typing system for Listeria monocytogenes is necessary to eludicate its transmission and spread. We describe the general characteristics of a phage-typing system for L. monocytogenes and its use in selected epidemiological studies. Previously 78.4\% of 823 strains of Listeria isolated in France between 1958 and 1978 were typable with a set of twenty phages isolaged from lysogenic strains. We now use twenty-seven phages; six derived from serovars 1/2a and 1/2b, eight from 4b, and thirteen from 4ab, 3c, 5, 6a and 6b. We used this system to examine 186 strains isolated during and after an outbreak in the province of Anjou which occurred during 1975 and 1976. One hundred and eight of these strains were of one phage type (octal code 000 420 000). Using this system we confirmed two cases of cross-infection in hospital neonates in England. Our results show that the reproducibility of the technique and the discrimination of the system are satisfactory for routine use. However, further testing and development of this system are underway.},
number = {4},
urldate = {2012-09-17},
journal = {Clinical and Investigative Medicine. Médecine Clinique Et Experimentale},
author = {Audurier, A and Taylor, A G and Carbonnelle, B and {McLauchlin}, J},
year = {1984},
note = {{PMID:} 6442645},
keywords = {Bacteriophage Typing, Cross Infection, France, Humans, Infant, Newborn, Listeria monocytogenes, Listeriosis},
pages = {229--232}
},
@article{ralovich_phage_1983,
title = {Phage typing of \emph{{Listeria monocytogenes}} in {Hungary}},
volume = {30},
issn = {0231-4622},
url = {http://www.ncbi.nlm.nih.gov/pubmed/6419533},
abstract = {Ninety-eight (39.6\%) out of 247 Listeria monocytogenes strains isolated from a variety of sources were typable by 27 phases. Of the 31 human strains only 3 belonged to phage types occurring in cattle, sheep and surface waters. A close correlation existed between serotype and phage type of the strains. Serotype 1/2 and 4 strains isolated in Hungary were less frequently typable than cultures originating from France. Phage typing is a useful tool for epidemiological tracing but, for a more effective differentiation, the number of phages should be increased and the method should be standardized.},
number = {2},
urldate = {2012-09-17},
journal = {Acta Microbiologica Hungarica},
author = {Ralovich, B and Audurier, A and Ortel, S and Angyal, T and Proksza, A},
year = {1983},
note = {{PMID:} 6419533},
keywords = {Animals, Bacteriophage Typing, Cattle, Cattle Diseases, Humans, Hungary, Listeria monocytogenes, Listeriosis, Serotyping, Sheep, Sheep Diseases, Water Microbiology},
pages = {103--111}
}
% at least 2 restriction endonucleases recommended for Listeria
@article{yde_use_2004,
title = {Use of {PFGE} to characterize clonal relationships among {Belgian} clinical isolates of \emph{{Listeria monocytogenes}}},
volume = {53},
issn = {0022-2615},
url = {http://www.ncbi.nlm.nih.gov/pubmed/15096548},
abstract = {The Belgian Listeria Reference Centre receives between 30 and 50 human clinical strains of Listeria monocytogenes per year. In general, epidemiological data are absent or incomplete, preventing recognition of episodes of listeriosis. However, data on a clonal relationship between strains can indirectly give an idea of the occurrence of episodes. Human isolates of L. monocytogenes from 2001 were serotyped, their arsenic-cadmium resistance profiles were determined, and they were pulsotyped with the application of pulsed-field gel electrophoresis using {AscI} and {ApaI} restriction endonucleases. On five occasions, two or more strains presented the same serovar, metal-resistance profile and pulsovar, suggesting a clonal relationship. This is the first report to identify accurately potential listeriosis episodes occurring in Belgium.},
number = {Pt 5},
urldate = {2012-09-17},
journal = {Journal of Medical Microbiology},
author = {Yde, Marc and Genicot, Annie},
month = may,
year = {2004},
note = {{PMID:} 15096548},
keywords = {Arsenic, Bacterial Typing Techniques, Belgium, Cadmium, Deoxyribonucleases, Type {II} Site-Specific, Electrophoresis, Gel, Pulsed-Field, Humans, Listeria monocytogenes, Listeriosis, Microbial Sensitivity Tests, Serotyping},
pages = {399--402}
}
% Listeria species has highest rate of synonymous mutation rates of prokaryotes
@article{novichkov_trends_2009,
title = {Trends in prokaryotic evolution revealed by comparison of closely related bacterial and archaeal genomes},
volume = {191},
issn = {1098-5530},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18978059},
doi = {10.1128/JB.01237-08},
abstract = {In order to explore microevolutionary trends in bacteria and archaea, we constructed a data set of 41 alignable tight genome clusters {(ATGCs).} We show that the ratio of the medians of nonsynonymous to synonymous substitution rates {(dN/dS)} that is used as a measure of the purifying selection pressure on protein sequences is a stable characteristic of the {ATGCs.} In agreement with previous findings, parasitic bacteria, notwithstanding the sometimes dramatic genome shrinkage caused by gene loss, are typically subjected to relatively weak purifying selection, presumably owing to relatively small effective population sizes and frequent bottlenecks. However, no evidence of genome streamlining caused by strong selective pressure was found in any of the {ATGCs.} On the contrary, a significant positive correlation between the genome size, as well as gene size, and selective pressure was observed, although a variety of free-living prokaryotes with very close selective pressures span nearly the entire range of genome sizes. In addition, we examined the connections between the sequence evolution rate and other genomic features. Although gene order changes much faster than protein sequences during the evolution of prokaryotes, a strong positive correlation was observed between the "rearrangement distance" and the amino acid distance, suggesting that at least some of the events leading to genome rearrangement are subjected to the same type of selective constraints as the evolution of amino acid sequences.},
number = {1},
urldate = {2012-09-17},
journal = {Journal of Bacteriology},
author = {Novichkov, Pavel S and Wolf, Yuri I and Dubchak, Inna and Koonin, Eugene V},
month = jan,
year = {2009},
note = {{PMID:} 18978059},
keywords = {Archaea, Bacillus anthracis, Bacteria, Escherichia coli, Evolution, Molecular, Gene Rearrangement, Genetic Variation, Genome, Archaeal, Genome, Bacterial, Population Density, Selection, Genetic, Sequence Alignment, Sequence Homology, Nucleic Acid},
pages = {65--73}
}
%trace-back investigations of implicated foods
@article{sauders_molecular_2003,
title = {Molecular subtyping to detect human listeriosis clusters},
volume = {9},
issn = {1080-6040},
url = {http://www.ncbi.nlm.nih.gov/pubmed/12781006},
doi = {10.3201/eid0906.020702},
abstract = {We analyzed the diversity {(Simpson's} Index, D) and distribution of Listeria monocytogenes in human listeriosis cases in New York State (excluding New York City) from November 1996 to June 2000 by using automated ribotyping and pulsed-field gel electrophoresis {(PFGE).} We applied a scan statistic (p{\textless}or=0.05) to detect listeriosis clusters caused by a specific Listeria monocytogenes subtype. Among 131 human isolates, 34 {(D=0.923)} ribotypes and 74 {(D=0.975)} {PFGE} types were found. Nine (31\% of cases) clusters were identified by ribotype or {PFGE;} five (18\% of cases) clusters were identified by using both methods. Two of the nine clusters (13\% of cases) corresponded with investigated multistate listeriosis outbreaks. While most human listeriosis cases are considered sporadic, highly discriminatory molecular subtyping approaches thus indicated that 13\% to 31\% of cases reported in New York State may represent single-source clusters. Listeriosis control and reduction efforts should include broad-based subtyping of human isolates and consider that a large number of cases may represent outbreaks.},
number = {6},
urldate = {2012-09-17},
journal = {Emerging Infectious Diseases},
author = {Sauders, Brian D and Fortes, Esther D and Morse, Dale L and Dumas, Nellie and Kiehlbauch, Julia A and Schukken, Ynte and Hibbs, Jonathan R and Wiedmann, Martin},
month = jun,
year = {2003},
note = {{PMID:} 12781006},
keywords = {Aged, Bacterial Typing Techniques, Cluster Analysis, Electrophoresis, Gel, Pulsed-Field, Female, Humans, Infant, Newborn, Listeria monocytogenes, Listeriosis, Male, New York, Phylogeny, Ribotyping, {RNA}, Ribosomal},
pages = {672--680}
},
@article{boerlin_subtyping_1996,
title = {Subtyping \emph{{Listeria monocytogenes}} isolates genetically related to the {Swiss} epidemic clone},
volume = {34},
issn = {0095-1137},
url = {http://www.ncbi.nlm.nih.gov/pubmed/8862575},
abstract = {Macrorestriction analysis by pulsed-field gel electrophoresis was used to assess the diversity of strains within the epidemic-associated electrophoretic type 1 {(ET1)} clone of Listeria monocytogenes. For this purpose, a total of 144 isolates from Switzerland shown by multilocus enzyme electrophoresis to belong to the {ET1} were examined. These isolates were subtyped by macrorestriction analysis using the enzymes {ApaI} and {SmaI} and field inversion gel electrophoresis. Among these 144 isolates, 45 were isolated in human listeriosis cases of the postepidemic period of 1988 to 1993 and 44 were isolated in animal listeriosis cases of the same period. Forty-seven isolates were from the epidemic period of 1983 to 1987, and eight additional isolates were from cattle from two different farms. Twenty-nine different subtypes could be identified among the 144 isolates tested. Five major subtypes were found more frequently than the others during the postepidemic period, both in humans and in animals. Two of these subtypes had been previously implicated in outbreaks of listeriosis, thus suggesting that particular pulsed-field gel electrophoresis subtypes may be frequently associated with disease in humans and animals. Two of these frequent subtypes were also suspected to be related to small clusters of listeriosis cases during the postepidemic period. The results obtained by typing epidemiologically related isolates from different animals within the same farms and from different body sites of a given patient confirmed the potential of macrorestriction analysis for epidemiological studies restricted to short periods of time and to small number of isolates. The analysis of 47 isolates related to the Swiss listeriosis epidemic period of 1983 to 1987 and the use of Southern blotting and hybridization experiments show that the interpretation of relatedness between isolates presenting slightly different macrorestriction patterns may be more complex than commonly accepted. In such cases, careful interpretation of the potential molecular mechanisms leading to the differences observed between patterns is necessary.},
number = {9},
urldate = {2012-09-17},
journal = {Journal of Clinical Microbiology},
author = {Boerlin, P and Bannerman, E and Jemmi, T and Bille, J},
month = sep,
year = {1996},
note = {{PMID:} 8862575},
keywords = {Animals, Cattle, Disease Outbreaks, Humans, Listeria monocytogenes, Listeriosis, Switzerland},
pages = {2148--2153}
}
%long-term surveillance of Listeria
@article{hjaltested_listeriosis_2002,
title = {Listeriosis in {Iceland}, 1978-2000: a description of cases and molecular epidemiology},
volume = {34},
issn = {0036-5548},
shorttitle = {Listeriosis in Iceland, 1978-2000},
url = {http://www.ncbi.nlm.nih.gov/pubmed/12477323},
abstract = {The purpose of our study was to review all cases of listeriosis in Iceland during the period 1978-2000 and to analyse the genetic relatedness of their isolates. Case records of all patients in Iceland with listeriosis during the period were reviewed and the isolates compared using serotyping and pulsed-field gel electrophoresis {(PFGE)} using {SmaI}, {AseI} and {ApaI} restriction enzymes. Forty cases of listeriosis were diagnosed during the period, resulting in a mean annual incidence of 6.9 cases per million and a case fatality rate of 33\%. In the first 5 y of the study only serotype 4b was observed; subsequently serotypes 1/2a and 1/2b appeared and serotype 4b declined in prevalence. {PFGE} yielded 24 different genotypes with 7 clusters of indistinguishable genotypes, each comprising 2-6 cases. During 1992-95 the annual incidence of listeriosis in Iceland rose to 15 cases per million. This was largely due to 2 clusters, 1 of 3 cases and the other of 6. No cases of listeriosis were diagnosed during 1998-2000. Our data show an increased number of cases within clusters in the latter half of the period. At the same time, food processing and distribution has become increasingly centralized in Iceland, suggesting an increased risk of listeriosis outbreaks.},
number = {10},
urldate = {2012-09-17},
journal = {Scandinavian Journal of Infectious Diseases},
author = {Hjaltested, Einar K and Gudmundsdóttir, Sigrún and Jónsdóttir, Kristín and Kristinsson, Karl G and Steingrímsson, Olafur and Kristjánsson, Már},
year = {2002},
note = {{PMID:} 12477323},
keywords = {Adolescent, Adult, Age Distribution, Aged, Aged, 80 and over, Child, Child, Preschool, {DNA}, Bacterial, Electrophoresis, Gel, Pulsed-Field, Female, Humans, Iceland, Incidence, Infant, Infant, Newborn, Listeria monocytogenes, Listeriosis, Male, Middle Aged, Molecular Epidemiology, Registries, Retrospective Studies, Risk Factors, Sex Distribution, Survival Rate},
pages = {735--741}
},
%long-term surveillance of Listeria
@article{lukinmaa_listeria_2003,
title = {\emph{{Listeria monocytogenes}} isolates from invasive infections: variation of sero- and genotypes during an 11-year period in {Finland}},
volume = {41},
issn = {0095-1137},
shorttitle = {Listeria monocytogenes isolates from invasive infections},
url = {http://www.ncbi.nlm.nih.gov/pubmed/12682162},
abstract = {Listeria monocytogenes strains that were isolated from 314 human listeriosis cases in Finland during an 11-year period were analyzed by {O:H} serotyping and pulsed-field gel electrophoresis {(PFGE).} Serotyping divided the isolates into five serotypes, the most common being 1/2a (53\%) and 4b (27\%). During the study period, the number of cases caused by serotype 1/2a increased from 22\% in 1990 to 67\% in 2001, and those caused by serotype 4b decreased from 61 to 27\%, respectively. {PFGE} with restriction enzyme {AscI} divided the strains into 81 {PFGE} genotypes; among strains of serotypes 1/2a and 4b, 49 and 18 {PFGE} types were seen, respectively. {PFGE} type 1 (serotype 1/2a) was the most prevalent single type (37 strains). Together with six other, closely related {PFGE} types, {PFGE} type 1 formed a group of 71 strains, representing 23\% of all 314 strains. Strains of {PFGE} type 1 have also been isolated from cold smoked fish, suggesting a source of human infections caused by this type. Moreover, {PFGE} type 24 (serotype 1/2c) was significantly associated with gender: 5\% of 180 male subjects but none of 132 female subjects {(P} = 0.012). An electronic database library was created from the {PFGE} profiles to make possible the prompt detection of new emerging profiles and the tracing of potential infection clusters in the future.},
number = {4},
urldate = {2012-09-17},
journal = {Journal of Clinical Microbiology},
author = {Lukinmaa, Susanna and Miettinen, Maria and Nakari, Ulla-Maija and Korkeala, Hannu and Siitonen, Anja},
month = apr,
year = {2003},
note = {{PMID:} 12682162},
keywords = {Adolescent, Adult, Aged, Aged, 80 and over, Bacterial Typing Techniques, Child, Child, Preschool, Electrophoresis, Gel, Pulsed-Field, Female, Finland, Genetic Variation, Genotype, Humans, Infant, Infant, Newborn, Listeria monocytogenes, Listeriosis, Male, Middle Aged, Serotyping},
pages = {1694--1700}
},
%long-term surveillance of Listeria
@article{lukinmaa_diversity_2004,
title = {Diversity of \emph{{Listeria monocytogenes}} isolates of human and food origin studied by serotyping, automated ribotyping and pulsed-field gel electrophoresis},
volume = {10},
issn = {1198-{743X}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/15191386},
doi = {10.1111/j.1469-0691.2004.00876.x},
abstract = {Automated ribotyping, pulsed-field gel electrophoresis {(PFGE)} and serotyping were evaluated for the epidemiological study of isolates of Listeria monocytogenes collected in Finland in 1997-1999 from human blood (n = 116) and the food industry (n = 72). The isolates divided into six serotypes, 23 {EcoRI} ribotypes, 54 {AscI} {PFGE} types, and 57 final subtypes if all results were combined. The discrimination index of ribotyping was lower (0.873) than that of {PFGE} (0.946). Two final subtypes dominated among human isolates, and identical subtypes were also found among food industry isolates. All {PFGE} types were serotype-specific, whereas two ribotypes included isolates of two serotypes. Isolates of serotype 3a, involved in an outbreak in Finland in 1999, matched one of these ribotypes, which also included some food industry isolates of serotype 1/2a. Ribotyping with {EcoRI} would not have been sufficient to define the outbreak in Finland caused by serotype 3a isolates. Although ribotyping is applicable as the first method in outbreak situations, human and food isolates with identical ribotypes should be investigated further by {PFGE.}},
number = {6},
urldate = {2012-09-17},
journal = {Clinical Microbiology and Infection: the Official Publication of the European Society of Clinical Microbiology and Infectious Diseases},
author = {Lukinmaa, S and Aarnisalo, K and Suihko, M-L and Siitonen, A},
month = jun,
year = {2004},
note = {{PMID:} 15191386},
keywords = {Animals, Automation, Bacterial Typing Techniques, Electrophoresis, Gel, Pulsed-Field, Finland, Food Microbiology, Humans, Listeria monocytogenes, Listeriosis, Ribotyping, Serotyping},
pages = {562--568}
},
%long-term surveillance of Listeria
@article{lyytikainen_surveillance_2006,
title = {Surveillance of listeriosis in {Finland} during 1995-2004},
volume = {11},
issn = {1560-7917},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16801696},
abstract = {We analysed the surveillance data from listeriosis cases notified to the Finnish National Infectious Diseases Register between 1995 and 2004 and describe our recent experience in investigating clusters of listeriosis cases. The number of annual cases varied between 18 and 53 but no trends in incidence were identified (average annual incidence was 7 cases per million inhabitants). Only a few cases affected pregnant women or newborns. Most of the patients were elderly people with non-malignant underlying illnesses; 25\% of them died from their infections. By routine sero- and genotyping of the listeria isolates, we detected several clusters; the vehicle for infection was only identified for two outbreaks. At least one quarter of listeriosis cases (78/315) was caused by a certain sero-genotype or closely related genotypes, which have also been found from vacuum-packed cold-smoked or cold-salted fish products. During 2000-2003, Finnish consumers were repeatedly informed about food precautions for risk groups. The information was also given to attending physicians and prenatal clinics.},
number = {6},
urldate = {2012-09-17},
journal = {Euro Surveillance: Bulletin Européen Sur Les Maladies Transmissibles = European Communicable Disease Bulletin},
author = {Lyytikäinen, O and Nakari, U M and Lukinmaa, S and Kela, E and Nguyen Tran Minh, N and Siitonen, A},
year = {2006},
note = {{PMID:} 16801696},
keywords = {Age Distribution, Aged, Cluster Analysis, Disease Outbreaks, Female, Finland, Fish Products, Genotype, Humans, Incidence, Infant, Newborn, Listeria monocytogenes, Listeriosis, Population Surveillance, Pregnancy, Registries, Serotyping},
pages = {82--85}
}
% LRS paper - PulseNet Canada
@article{pagotto_canadian_2006,
title = {Canadian listeriosis reference service},
volume = {3},
issn = {1535-3141},
lccn = {0011},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16602988},
doi = {10.1089/fpd.2006.3.132},
abstract = {Listeria monocytogenes, a psychrotrophic organism capable of growing at refrigeration temperatures, is of major concern in extended shelf life, refrigerated foods. Considering that as much as 80-90\% of human listeriosis cases are linked to the ingestion of contaminated food, human cases are predominantly seen in high-risk individuals, including organ-transplant recipients, patients with {AIDS} and {HIV-infected} individuals, pregnant women, cancer patients, and the elderly. In 2001, the Canadian Listeriosis Reference Service {(LRS)} was created by the Bureau of Microbial Hazards {(Health} Canada) and the National Microbiology Laboratory (now part of the Public Health Agency of Canada). Major goals of the {LRS} include investigation of listeriosis cases and maintenance of a national collection of isolates. The {LRS} intends to create a comprehensive molecular epidemiological database of all isolates in Canada for use as a resource for outbreak investigations, research and other microbiological investigations. The {PFGE} profiles are being established and stored for clinical, food, environmental, and possibly animal strains of L. monocytogenes. The {LRS} pursues research activities for investigation and implementation of other molecular methods for characterizing L. monocytogenes isolates. Ribotyping, Multi-locus Sequence Typing {(MLST)}, Variable Number of Tandem Repeats {(VNTR)}, Multi-locus virulence sequence typing {(MLVA)}, microarray- based technologies and sequence-based typing schemes, are being investigated on selected diversity sets. The {LRS} has also used {PFGE} typing for outbreak investigations. The molecular epidemiological data, timely coordination and exchange of information should help to reduce the incidence of listeriosis in Canada. In Canada, listeriosis is not a national notifiable disease, except for the province of Quebec, where it has been since 1999. The {LRS}, Canadian Public Health Laboratory Network, and federal epidemiologists are currently working on making human listeriosis notifiable throughout Canada.},
number = {1},
urldate = {2012-09-15},
journal = {Foodborne Pathogens and Disease},
author = {Pagotto, Franco and Ng, Lai-King and Clark, Clifford and Farber, Jeff},
year = {2006},
note = {{PMID:} 16602988},
keywords = {Canada, Databases, Factual, Disease Notification, Food Contamination, Food Microbiology, Humans, Immunocompromised Host, Listeria monocytogenes, Listeriosis, Molecular Epidemiology, Public Health, Virulence},
pages = {132--137}
},
%PFGE method paper
@article{finney_pulsed-field_2001,
title = {Pulsed-field gel electrophoresis},
volume = {Chapter 2},
issn = {1934-3647},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18265186},
doi = {10.1002/0471142727.mb0205bs51},
abstract = {{DNA} molecules longer than 25 kb are poorly resolved by standard agarose gel electrophoresis. These longer molecules can be resolved using several techniques that periodically change the direction of the electric field in the gel. This unit describes the simplest and most generally useful of the pulsed-field techniques, field inversion electrophoresis, which can be tuned to resolve molecules from 10 to 2000 kb (or more with specialized equipment). To resolve molecules beyond the range of field inversion, it is necessary to use some sort of field-angle alternation electrophoresis such as {CHEF} (contour-clamped homogeneous electric field; described in an Alternate Protocol). A method is also provided for preparing high-molecular-weight {DNA} samples and size markers embedded in agarose blocks.},
urldate = {2012-09-17},
journal = {Current Protocols in Molecular Biology / Edited By Frederick M. Ausubel ... [et Al.]},
author = {Finney, M},
month = may,
year = {2001},
note = {{PMID:} 18265186},
keywords = {Animals, {DNA}, Electrophoresis, Gel, Pulsed-Field},
pages = {Unit2.5B}
}
%first paper describing PFGE of Listeria
@article{brosch_subtyping_1991,
title = {Subtyping of \emph{{Listeria monocytogenes}} serovar 4b by use of low-frequency-cleavage restriction endonucleases and pulsed-field gel electrophoresis},
volume = {142},
issn = {0923-2508},
url = {http://www.sciencedirect.com/science/article/pii/092325089190080T},
doi = {10.1016/0923-2508(91)90080-T},
abstract = {Pulsed-field gel electrophoresis {(PFGE)} was used to compare the limited number of large restriction fragments generated by digesting {DNA} of Listeria monocytogenes strains with restriction enzymes characterized by rare recognition sequences. Sixteen macro-restriction patterns were observed with {ApaI} and {SmaI}, and 7 with Notl, among 42 strains of serovar 4b, the most important serovar in human listeriosis epidemiology. Analysis of these restriction fragment length polymorphisms enabled a rapid differentiation of genetically closely related strains, revealing differences between strains which initially appeared similar by other typings. The results of this study suggested that the {PFGE} protocol could be a useful addition to methods currently available for epidemiological analysis of human listeriosis.},
number = {6},
urldate = {2012-09-17},
journal = {Research in Microbiology},
author = {Brosch, R and Buchrieser, C and Rocourt, J},
year = {1991},
keywords = {Aliment, {DNA} restriction patterns, Electrophorèse en champ pulsé, Epidémiologie, Epidemiology, Food, Listeria monocytogenes, Listeriosis, Molecular typing, Pulsed-field gel electrophoresis, Listeria monocytogenes, Listériose, Profils de restriction {d'ADN}, Serovar, Sérovar, Typage moléculaire},
pages = {667--675}
}
%first use of PFGE for Listeria outbreak epidemiological investigation
@article{miettinen_molecular_1999,
title = {Molecular Epidemiology of an Outbreak of Febrile Gastroenteritis Caused by \emph{{Listeria monocytogenes}} in Cold-Smoked Rainbow Trout},
volume = {37},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/37/7/2358},
abstract = {Febrile gastroenteritis in five healthy persons was associated with the consumption of vacuum-packed cold-smoked rainbow trout {containingListeria} monocytogenes. L. monocytogenes isolates from the incriminated fish product lot and the stool samples were all of serotype 1/2a and were indistinguishable by pulsed-field gel electrophoresis employing {AscI} and {SmaI.}},
language = {en},
number = {7},
urldate = {2012-09-11},
journal = {Journal of Clinical Microbiology},
author = {Miettinen, M. K. and Siitonen, A. and Heiskanen, P. and Haajanen, H. and Björkroth, K. J. and Korkeala, H. J.},
month = jul,
year = {1999},
pages = {2358--2360}
},
%possible ActA paper
@article{sun_isolation_1990,
title = {Isolation of \emph{{Listeria monocytogenes}} small-plaque mutants defective for intracellular growth and cell-to-cell spread.},
volume = {58},
issn = {0019-9567, 1098-5522},
url = {http://iai.asm.org/content/58/11/3770},
abstract = {To dissect the regulatory and structural requirements for Listeria monocytogenes intracellular growth and cell-to-cell spread, we designed a protocol based on transposon mutagenesis and the isolation of mutants which form small plaques in monolayers of mouse L2 cell fibroblasts. Two different transposable elements were used to generate libraries of insertion mutants: Tn916 and a derivative of Tn917-lac, Tn917-{LTV3.} Ten classes of mutants were isolated and evaluated for growth and cell-to-cell spread in J774 mouse macrophagelike cells, Henle 407 human epithelial cells, and mouse bone marrow-derived macrophages. Mutants were also evaluated for secretion of hemolysin and phospholipase (assayed by egg yolk opacity) and association with F-actin in the cytoplasm of cells, using {NBD-phallacidin} staining. The ten classes of mutants included (i) mutants showing abortive intracellular and extracellular growth; (ii) mutants showing abortive intracellular growth; (iii) rough mutants; (iv) mutants showing greatly reduced hemolysin and phospholipase secretion but showing normal growth in cells and little or no association with F-actin; (v) mutants with mutations mapping to an open reading frame {(ORF)} adjacent to {hlyA} and referred to as {ORF} U, lacking phospholipase activity, and with 50\% normal hemolysin activity; (vi) mutants with reduced secretion of both hemolysin and phospholipase; (vii) nonhemolytic mutants with mutations mapping to the structural gene, {hlyA;} (viii) mutants with 25\% normal hemolysin secretion and absolutely no association with F-actin; (ix) mutants with mutations mapping to {ORF} U, lacking phospholipase activity, and with normal hemolysin activity; and (x) mutants showing a mixed-plaque morphology but normal for all other parameters.},
language = {en},
number = {11},
urldate = {2012-09-11},
journal = {Infection and Immunity},
author = {Sun, A. N. and Camilli, A. and Portnoy, D. A.},
month = nov,
year = {1990},
pages = {3770--3778}
}
%ActA paper
@article{tilney_actin_1989,
title = {Actin filaments and the growth, movement, and spread of the intracellular bacterial parasite, \emph{{Listeria monocytogenes}}},
volume = {109},
issn = {0021-9525, 1540-8140},
url = {http://jcb.rupress.org/content/109/4/1597},
doi = {10.1083/jcb.109.4.1597},
abstract = {Listeria monocytogenes was used as a model intracellular parasite to study stages in the entry, growth, movement, and spread of bacteria in a macrophage cell line. The first step in infection is phagocytosis of the Listeria, followed by the dissolution of the membrane surrounding the phagosome presumably mediated by hemolysin secreted by Listeria as nonhemolytic mutants remain in intact vacuoles. Within 2 h after infection, each now cytoplasmic Listeria becomes encapsulated by actin filaments, identified as such by decoration of the actin filaments with subfragment 1 of myosin. These filaments are very short. The Listeria grow and divide and the actin filaments rearrange to form a long tail (often 5 microns in length) extending from only one end of the bacterium, a "comet's tail," in which the actin filaments appear randomly oriented. The Listeria "comet" moves to the cell surface with its tail oriented towards the cell center and becomes incorporated into a cell extension with the Listeria at the tip of the process and its tail trailing into the cytoplasm behind it. This extension contacts a neighboring macrophage that phagocytoses the extension of the first macrophage. Thus, within the cytoplasm of the second macrophage is a Listeria with its actin tail surrounded by a membrane that in turn is surrounded by the phagosome membrane of the new host. Both these membranes are then solubilized by the Listeria and the cycle is repeated. Thus, once inside a host cell, the infecting Listeria and their progeny can spread from cell to cell by remaining intracellular and thus bypass the humoral immune system of the organism. To establish if actin filaments are essential for the spread of Listeria from cell to cell, we treated infected macrophages with cytochalasin D. The Listeria not only failed to spread, but most were found deep within the cytoplasm, rather than near the periphery of the cell. Thin sections revealed that the net of actin filaments is not formed nor is a "comet" tail produced.},
language = {en},
number = {4},
urldate = {2012-09-10},
journal = {The Journal of Cell Biology},
author = {Tilney, L. G. and Portnoy, D. A.},
month = oct,
year = {1989},
pages = {1597--1608}
}
%LLO paper
@article{portnoy_role_1988,
title = {Role of hemolysin for the intracellular growth of \emph{{Listeria monocytogenes}}},
volume = {167},
issn = {0022-1007, 1540-9538},
url = {http://jem.rupress.org/content/167/4/1459},
doi = {10.1084/jem.167.4.1459},
abstract = {Listeria monocytogenes insertion mutants defective in hemolysin production were generated using the conjugative transposons Tn916 and Tn1545. All of the nonhemolytic mutants (hly-) lacked a secreted 58-{kD} polypeptide, presumedly hemolysin, and were avirulent in a mouse model. An intracellular multiplication assay was established in monolayers of mouse bone marrow-derived macrophages, the J774 macrophage-like cell line, the {CL.7} embryonic mouse fibroblast cell line, and the Henle 407 human epithelial cell line. The hly+ strain grew intracellularly in all of the tissue culture cells with a doubling time of approximately 60 min. In contrast, the hly- mutants failed to grow in the murine-derived tissue culture cells, but retained the ability to grow in the human tissue culture cells examined. Hemolytic-positive revertants were selected after passage of the hly- mutants through monolayers of J774 cells. In each case, the hemolytic revertants possessed the 58-{kD} polypeptide, were capable of intracellular growth in tissue culture monolayers and were virulent for mice.},
language = {en},
number = {4},
urldate = {2012-09-10},
journal = {The Journal of Experimental Medicine},
author = {Portnoy, D. A. and Jacks, P. S. and Hinrichs, D. J.},
month = apr,
year = {1988},
pages = {1459--1471}
},
%LLO paper
@article{gaillard_vitro_1987,
title = {In vitro model of penetration and intracellular growth of \emph{{Listeria monocytogenes}} in the human enterocyte-like cell line {Caco-2}},
volume = {55},
issn = {0019-9567},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC259983/},
abstract = {Penetration and replication of Listeria monocytogenes within intestinal epithelial cells were studied by infecting the human enterocyte-like cell line Caco-2. Entry was due to directed phagocytosis, as suggested by the inhibiting effect of cytochalasin D on bacterial entry and by electron microscopy showing bacteria inside membrane-limiting vacuoles at the early stage of infection. Only bacteria from pathogenic species {(L.} monocytogenes and Listeria ivanovii) were able to induce their own phagocytosis by Caco-2 cells, as opposed to Listeria seeligeri, Listeria welshimeri, and Listeria innocua. L. monocytogenes multiplied readily within Caco-2 cells, with an apparent generation time of about 90 min. Listeriolysin O was found to be a major factor promoting intracellular growth of L. monocytogenes. After being internalized at the same rate as that of its hemolytic revertant strain, a nonhemolytic mutant from L. monocytogenes failed to replicate significantly within Caco-2 cells. Electron microscopic study demonstrated that bacteria from the nonhemolytic mutant remained inside phagosomes during cellular infection, whereas hemolytic bacteria from L. monocytogenes were released free within the cytoplasm. This indicates that disruption of vacuole membranes by listeriolysin O-producing strains of L. monocytogenes might be a key mechanism allowing bacteria to escape from phagosomes and to multiply unrestricted within cell cytoplasm.},
number = {11},
urldate = {2012-09-15},
journal = {Infection and Immunity},
author = {Gaillard, J L and Berche, P and Mounier, J and Richard, S and Sansonetti, P},
month = nov,
year = {1987},
note = {{PMID:} 3117693
{PMCID:} {PMC259983}},
pages = {2822--2829}
},
@article{stebbins_structural_2001,
title = {Structural mimicry in bacterial virulence},
volume = {412},
copyright = {© 2001 Nature Publishing Group},
issn = {0028-0836},
url = {http://0-www.nature.com.darius.uleth.ca/nature/journal/v412/n6848/full/412701a0.html},
doi = {10.1038/35089000},
abstract = {An important mechanism underlying the strategies used by microbial pathogens to manipulate cellular functions is that of functional mimicry of host activities. In some cases, mimicry is achieved through virulence factors that are direct homologues of host proteins. In others, convergent evolution has produced new effectors that, although having no obvious amino-acid sequence similarity to host factors, are revealed by structural studies to display mimicry at the molecular level.},
number = {6848},
urldate = {2012-09-14},
journal = {Nature},
author = {Stebbins, C. Erec and Galán, Jorge E.},
month = aug,
year = {2001},
keywords = {astronomy, astrophysics, biochemistry, Bioinformatics, biology, Biotechnology, cancer, Cell Cycle, cell signalling, climate change, Computational Biology, development, developmental biology, {DNA}, Drug Discovery, earth science, Ecology, environmental science, Evolution, evolutionary biology, Functional genomics, genetics, Genomics, geophysics, immunology, interdisciplinary science, life, marine biology, materials science, medical research, medicine, metabolomics, Molecular Biology, molecular interactions, nanotechnology, Nature, neurobiology, neuroscience, palaeobiology, pharmacology, physics, Proteomics, quantum physics, {RNA}, science, science news, science policy, Signal Transduction, structural biology, Systems biology, transcriptomics},
pages = {701--705}
},
@article{shen_inib-dependent_2000,
title = {{InIB-dependent} internalization of \emph{{Listeria}} is mediated by the {Met} receptor tyrosine kinase},
volume = {103},
issn = {0092-8674},
url = {http://www.ncbi.nlm.nih.gov/pubmed/11081636},
abstract = {The Listeria monocytogenes surface protein {InlB} promotes bacterial entry into mammalian cells. Here, we identify a cellular surface receptor required for {InlB-mediated} entry. Treatment of mammalian cells with {InlB} protein or infection with L. monocytogenes induces rapid tyrosine phosphorylation of Met, a receptor tyrosine kinase {(RTK)} for which the only known ligand is Hepatocyte Growth Factor {(HGF).} Like {HGF}, {InlB} binds to the extracellular domain of Met and induces "scattering" of epithelial cells. Experiments with Met-positive and Met-deficient cell lines demonstrate that Met is required for {InlB-dependent} entry of L. monocytogenes. {InlB} is a novel Met agonist that induces bacterial entry through exploitation of a host {RTK} pathway.},
number = {3},
urldate = {2012-09-15},
journal = {Cell},
author = {Shen, Y and Naujokas, M and Park, M and Ireton, K},
month = oct,
year = {2000},
note = {{PMID:} 11081636},
keywords = {Adaptor Proteins, Signal Transducing, Animals, Avian Proteins, Bacterial Proteins, Cell Aggregation, Cell Line, Cytoskeletal Proteins, Dose-Response Relationship, Drug, Endocytosis, Epithelial Cells, Gene Deletion, Hepatocytes, Humans, Kidney, Kinetics, Ligands, Listeria monocytogenes, Membrane Proteins, Phosphoproteins, Phosphorylation, Phosphotyrosine, Precipitin Tests, Protein Binding, Protein Structure, Tertiary, Proto-Oncogene Proteins, Proto-Oncogene Proteins c-cbl, Proto-Oncogene Proteins c-met, Signal Transduction, Ubiquitin-Protein Ligases},
pages = {501--510}
}
@article{lecuit_internalin_1997,
title = {Internalin of \emph{{Listeria monocytogenes}} with an intact leucine-rich repeat region is sufficient to promote internalization},
volume = {65},
issn = {0019-9567},
url = {http://www.ncbi.nlm.nih.gov/pubmed/9393831},
abstract = {Listeria monocytogenes can use two different surface proteins, internalin {(InlA)} and {InlB}, to invade mammalian cells. The exact role of these invasiveness factors in vivo remains to be determined. In cultured cells, {InlA} is necessary to promote Listeria entry into human epithelial cells, such as Caco-2 cells, whereas {InlB} is necessary to promote Listeria internalization in several other cell types, including hepatocytes, fibroblasts, and epithelioid cells, such as Vero, {HeLa}, {CHO}, or Hep-2 cells. We have recently reported that the {InlA} receptor on Caco-2 cells is the cell adhesion molecule E-cadherin and demonstrated that nonpermissive fibroblasts become permissive for internalin-mediated entry when transfected with the gene coding for {LCAM}, the chicken homolog of the human E-cadherin gene. In this study, we demonstrate for the first time that the internalin protein alone is sufficient to promote internalization into cells expressing its receptor. Indeed, internalin confers invasiveness to both Enterococcus faecalis and internalin-coated latex beads. As shown by transmission electron microscopy, these beads were phagocytosed via a "zipper" mechanism similar to that observed during the internalin-E-cadherin-mediated entry of Listeria. Moreover, a functional analysis of internalin demonstrates that its amino-terminal region, encompassing the leucine-rich repeat {(LRR)} region and the inter-repeat {(IR)} region, is necessary and sufficient to promote bacterial entry into cells expressing its receptor. Several lines of evidence suggest that the {LRR} region would interact directly with E-cadherin, whereas the {IR} region would be required for a proper folding of the {LRR} region.},
number = {12},
urldate = {2012-09-14},
journal = {Infection and Immunity},
author = {Lecuit, M and Ohayon, H and Braun, L and Mengaud, J and Cossart, P},
month = dec,
year = {1997},
note = {{PMID:} 9393831},
keywords = {Bacterial Adhesion, Bacterial Proteins, Caco-2 Cells, Humans, Leucine, Listeria monocytogenes, Listeriosis, Repetitive Sequences, Nucleic Acid},
pages = {5309--5319}
},
@article{braun_inib_1998,
title = {The {InIB} protein of \emph{{Listeria monocytogenes}} is sufficient to promote entry into mammalian cells},
volume = {27},
issn = {0950-{382X}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/9535096},
abstract = {{InIB} is one of the two Listeria monocytogenes invasion proteins required for bacterial entry into mammalian cells. Entry into human epithelial cells such as Caco-2 requires {InIA}, whereas {InIB} is needed for entry into cultured hepatocytes and some epithelial or fibroblast cell lines such as Vero, {HEp-2} and {HeLa} cells. {InIB-mediated} entry requires tyrosine phosphorylation, cytoskeletal rearrangements and activation of the host protein phosphoinositide {(PI)} 3-kinase, probably in response to engagement of a receptor. In this study, we demonstrate for the first time that {InIB} is sufficient to promote internalization. Indeed, coating of normally non-invasive bacteria or inert latex beads with {InIB} leads to internalization into mammalian cells. In addition, a soluble form of {InIB} also appears to promote uptake of non-invasive bacteria, albeit at a very low level. Similar to entry of L. monocytogenes, uptake of {InIB-coated} beads required tyrosine phosphorylation in the host cell, {PI} 3-kinase activity and cytoskeletal reorganization. Taken together, these data indicate that {InIB} is sufficient for entry of L. monocytogenes into host cells and suggest that this protein is an effector of host cell signalling pathways.},
number = {5},
urldate = {2012-09-14},
journal = {Molecular Microbiology},
author = {Braun, L and Ohayon, H and Cossart, P},
month = mar,
year = {1998},
note = {{PMID:} 9535096},
keywords = {Actins, Animals, Bacterial Proteins, Cercopithecus aethiops, Fluorescent Antibody Technique, Gentamicins, Listeria, Listeria monocytogenes, Membrane Proteins, Microscopy, Confocal, Microscopy, Electron, Microspheres, Movement, Phosphatidylinositol 3-Kinases, Phosphorylation, Phosphotyrosine, Polymers, Staphylococcus, Tumor Cells, Cultured, Vero Cells},
pages = {1077--1087}
},
@article{mengaud_e-cadherin_1996,
title = {E-cadherin is the receptor for internalin, a surface protein required for entry of \emph{{L. monocytogenes}} into epithelial cells},
volume = {84},
issn = {0092-8674},
url = {http://www.ncbi.nlm.nih.gov/pubmed/8601315},
abstract = {We report the first identification of a cellular receptor mediating entry of a gram-positive bacterium into nonphagocytotic cells. By an affinity chromatography approach, we identified E-cadherin as the ligand for internalin, an L. monocytogenes protein essential for entry into epithelial cells. Expression of the chicken homolog of E-cadherin {(L-CAM)} in transfected fibroblasts dramatically increases entry of L. monocytogenes and promotes that of a recombinant L. innocua strain expressing internalin but does not promote entry of the wild-type noninvasive L. innocua or that of an internalin-deficient mutant of L. monocytogenes. Furthermore, L-{CAM-specific} antibodies block internalin-mediated entry. In contrast to Salmonella, Listeria enters cells by a mechanism of induced phagocytosis occurring without membrane ruffling. This work reveals a novel type of heterophilic interactions for E-cadherin.},
number = {6},
urldate = {2012-09-14},
journal = {Cell},
author = {Mengaud, J and Ohayon, H and Gounon, P and Mege R-M and Cossart, P},
month = mar,
year = {1996},
note = {{PMID:} 8601315},
keywords = {Animals, Antibody Specificity, Bacterial Proteins, Caco-2 Cells, Cadherins, Cell Adhesion, Epithelial Cells, Epithelium, Humans, Ligands, Listeria monocytogenes, Mammals, Molecular Sequence Data, Receptors, Cell Surface, Salmonella, Sequence Homology, Amino Acid},
pages = {923--932}
},
@article{seveau_molecular_2007,
title = {Molecular mechanisms exploited by \emph{{Listeria monocytogenes}} during host cell invasion},
volume = {9},
issn = {1286-4579},
url = {http://www.ncbi.nlm.nih.gov/pubmed/17761447},
doi = {10.1016/j.micinf.2007.05.004},
abstract = {The facultative intracellular bacterial pathogen Listeria monocytogenes has evolved multiple strategies to invade a large panel of mammalian cells. Host cell invasion is critical for several stages of listeriosis pathology such as the initial crossing of the host intestinal barrier and the successive colonization of diverse target organs including the placenta. In this review, we address the main molecular mechanisms known to be used by L. monocytogenes during invasion of nonphagocytic cells and host tissues.},
number = {10},
urldate = {2012-09-14},
journal = {Microbes and Infection / Institut Pasteur},
author = {Seveau, Stéphanie and Pizarro-Cerda, Javier and Cossart, Pascale},
month = aug,
year = {2007},
note = {{PMID:} 17761447},
keywords = {Animals, Bacterial Proteins, Female, Host-Pathogen Interactions, Humans, Listeria monocytogenes, Listeriosis, Placenta, Pregnancy, Virulence Factors},
pages = {1167--1175}
},
@article{pizarro-cerda_subversion_2006,
title = {Subversion of cellular functions by \emph{{Listeria monocytogenes}}},
volume = {208},
issn = {0022-3417},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16362984},
doi = {10.1002/path.1888},
abstract = {Listeria monocytogenes is a Gram-positive bacterium that is able to invade and multiply within eukaryotic cells. Its intracellular life-cycle includes pathogen-induced phagocytosis, lysis of the phagocytic vacuole, movement in the cytoplasmic environment, and a cell-to-cell spread mechanism. Many L. monocytogenes virulence factors have been studied in detail, certain of which subvert specific eukaryotic cell functions in order to favour infection. During entry, the invasion protein {InlA} takes advantage of the adhesion molecule E-cadherin and the adherens junction machinery to adhere to target and invade polarized epithelial cells. Another invasion protein of the internalin family, {InlB}, subverts the signalling pathway of the hepatocyte growth factor receptor Met to induce endocytosis of the receptor and also to favour internalization of the bacteria in non-polarized epithelial cells. Once inside the cell, the haemolysin of L. monocytogenes--the listeriolysin O or {LLO--is} secreted to lyse the phagocytic vacuole, and when the bacteria is freed in the cytoplasm, the activity of the {LLO} is in part regulated by the infected cell itself, taking advantage of the {pH} sensitivity of the {LLO} that leads to its inactivation in the neutral eukaryotic cell cytoplasm. Finally, to induce bacterial movement in the cytoplasm, the L. monocytogenes surface protein {ActA} mimics the activity of the eukaryotic {WASP} family of proteins to recruit to the bacteria the actin nucleation machinery required for actin polymerization and for the formation of the actin structures (called 'actin comet tails') that propel the parasite in the cytosol and help it to invade neighbouring cells.},
number = {2},
urldate = {2012-09-14},
journal = {The Journal of Pathology},
author = {Pizarro-Cerdá, Javier and Cossart, Pascale},
month = jan,
year = {2006},
note = {{PMID:} 16362984},
keywords = {Bacterial Proteins, Bacterial Toxins, Eukaryotic Cells, Heat-Shock Proteins, Hemolysin Proteins, Humans, Hydrogen-Ion Concentration, Listeria monocytogenes, Listeriosis, Membrane Proteins, Proto-Oncogene Proteins, Proto-Oncogene Proteins c-met, Receptors, Growth Factor, Vacuoles},
pages = {215--223}
}
@article{piffaretti_genetic_1989,
title = {Genetic characterization of clones of the bacterium \emph{{Listeria monocytogenes}} causing epidemic disease},
volume = {86},
issn = {0027-8424, 1091-6490},
url = {http://www.pnas.org/content/86/10/3818},
abstract = {One hundred and seventy-five isolates of the pathogenic bacterium Listeria monocytogenes recovered from human clinical (blood and cerebrospinal fluid), animal, and environmental sources in Europe, North America, and elsewhere were analyzed electrophoretically for allelic variation at 16 genetic loci encoding metabolic enzymes. Forty-five distinctive allele profiles (electrophoretic types, {ETs)} were distinguished, among which mean genetic diversity per locus {(H)} was 0.424. Cluster analysis of a matrix of genetic distances between paired {ETs} revealed two primary phylogenetic divisions of the species separated at a distance of 0.54. {ETs} in division I were presented by strains of serotypes 4b, 1/2b, and 4a, whereas strains of {ETs} in division {II} were of serotypes 1/2a and 1/2c. Human and animal isolates did not represent distinctive subsets of {ETs.} The occurrence of linkage disequilibrium between enzyme loci and the widespread distribution of certain {ETs} indicate that the genetic structure of L. monocytogenes is clonal. One clone, marked by {ET1}, caused major epidemics of human disease in western Switzerland in the period 1983-1987 and in Los Angeles County, California, in 1985, both of which were attributed to contamination of soft cheese. {ET} 1 is closely related to the clone {(ET7)} that caused two large outbreaks of listeriosis in Massachusetts in 1979 and 1983.},
language = {en},
number = {10},
urldate = {2012-09-14},
journal = {Proceedings of the National Academy of Sciences},
author = {Piffaretti, J. C. and Kressebuch, H. and Aeschbacher, M. and Bille, J. and Bannerman, E. and Musser, J. M. and Selander, R. K. and Rocourt, J.},
month = may,
year = {1989},
pages = {3818--3822}
},
@article{chaturongakul_modulation_2008,
title = {Modulation of stress and virulence in \emph{{Listeria monocytogenes}}},
volume = {16},
issn = {0966-{842X}},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3400534/},
doi = {10.1016/j.tim.2008.05.006},
abstract = {Listeria monocytogenes can respond rapidly to changing environmental conditions, as illustrated by its ability to transition from a saprophyte to an orally transmitted facultative intracellular pathogen. Differential associations between various alternative σ factors and a core {RNA} polymerase provide a transcriptional mechanism for regulating bacterial gene expression that is crucial for survival in rapidly changing conditions. Alternative σ factors are key components of complex L. monocytogenes regulatory networks that include multiple transcriptional regulators of stress-response and virulence genes, regulation of genes encoding other regulators, and regulation of small {RNAs.} In this article, the contributions of various σ factors to L. monocytogenes stress response and virulence are described.},
number = {8},
urldate = {2012-09-14},
journal = {Trends in Microbiology},
author = {Chaturongakul, Soraya and Raengpradub, Sarita and Wiedmann, Martin and Boor, Kathryn J.},
month = aug,
year = {2008},
note = {{PMID:} 18619843
{PMCID:} {PMC3400534}},
pages = {388--396}
},
@article{srinivasan_prevalence_2005,
title = {Prevalence of antimicrobial resistance genes in \emph{{Listeria monocytogenes}} isolated from dairy farms},
volume = {2},
issn = {1535-3141},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16156701},
doi = {10.1089/fpd.2005.2.201},
abstract = {Antimicrobial resistance of Listeria monocytogenes (n = 38) isolated from the four dairy farms to 15 antimicrobial agents was evaluated. All 38 L. monocytogenes isolates from the four farms evaluated were resistant to more than one antimicrobial in different combinations. All L. monocytogenes isolates evaluated were resistant to cephalosporin C (minimum inhibitory concentration {[MIC]} {\textgreater} or = 512 {microg/mL)}, streptomycin {(MIC} {\textgreater} or = 32) and trimethoprim {(MIC} {\textgreater} or = 512). Most L. monocytogenes isolates were resistant to ampicillin (92\%, {MIC} {\textgreater} or = 2), rifampicin (84\%, {MIC} {\textgreater} or = 4), rifamycin (84\%, {MIC} {\textgreater} or = 4), and florfenicol (66\%, {MIC} {\textgreater} or = 32) and some were resistant to tetracycline (45\%, {MIC} {\textgreater} or = 16), penicillin G (40\%, {MIC} {\textgreater} or = 2) and chloramphenicol (32\%, {MIC} {\textgreater} or = 32). All L. monocytogenes isolates were susceptible to amoxicillin, erythromycin, gentamicin, kanamycin and vancomycin. Susceptibility of L. monocytogenes to the antimicrobials evaluated was quite consistent among the dairy farms evaluated. However, some variability in antimicrobial susceptibility among dairy farms was noted. Nineteen of 38 L. monocytogenes isolates contained more than one antimicrobial resistance gene sequence. A high frequency of {floR} (66\%) was found in L. monocytogenes followed by {penA} (37\%), {strA} (34\%), {tetA} (32\%), and {sulI} (16\%). Other tetracycline resistance genes {(tetB}, {tetC}, {tetD}, {tetE}, and {tetG)} and other antimicrobial resistance genes {(cmlA}, {strB}, {aadA}, {sulI}, {vanA}, {vanB}, {ampC}, {ermB}, {ereA}, and {ereB)} were not found in any of the L. monocytogenes isolates from the four dairy farms. Results of the present study demonstrated that L. monocytogenes isolated from the dairy farm environment were resistant to many antimicrobials and contained one or more antimicrobial resistance genes.},
number = {3},
urldate = {2012-09-14},
journal = {Foodborne Pathogens and Disease},
author = {Srinivasan, V and Nam, H M and Nguyen, L T and Tamilselvam, B and Murinda, S E and Oliver, S P},
year = {2005},
note = {{PMID:} 16156701},
keywords = {Animals, Anti-Bacterial Agents, Base Sequence, Cattle, Cattle Diseases, Colony Count, Microbial, Dairying, {DNA}, Bacterial, Drug Resistance, Bacterial, Drug Resistance, Multiple, Bacterial, Female, Gene Amplification, Humans, Listeria monocytogenes, Listeriosis, Microbial Sensitivity Tests, Polymerase Chain Reaction, Prevalence},
pages = {201--211}
},
@article{hansen_antibiotic_2005,
title = {Antibiotic susceptibility of \emph{{Listeria monocytogenes}} in {Denmark} 1958-2001},
volume = {113},
issn = {0903-4641},
url = {http://www.ncbi.nlm.nih.gov/pubmed/15676012},
doi = {10.1111/j.1600-0463.2005.apm1130105.x},
abstract = {In order to see whether the susceptibility of Danish Listeria monocytogenes strains has changed over the years we examined a collection of human isolates from the period 1958-2001. We, furthermore, wanted to compare L. monocytogenes susceptibility testing using a disc diffusion assay with {MIC} measurements performed by the E-test. 106 strains isolated predominantly from blood cultures and cerebrospinal fluids were examined together with three reference strains. Susceptibility to the following antibiotics was tested by the E-test and by Oxoid discs using Iso-sensitest agar: penicillin G, ampicillin, meropenem, gentamicin, sulphamethoxazole, trimethoprim, ciprofloxacin, erythromycin, vancomycin, linezolid, chloramphenicol and tetracycline. The strains were in the main sensitive to all antibiotics examined using both methods, except for ciprofloxacin, where the strains were intermediate sensitive. However, for penicillin, ampicillin and sulphamethoxazole, while the disc diffusion assay found the strains to be sensitive, {MIC} measurements generally placed the strains one dilution above the breakpoint for sensitivity in the intermediate sensitive group. Based on the {MIC} measurements, the antibiotic susceptibility of L. monocytogenes has not changed in Denmark from 1958 to 2001, and the multiresistant strains found in human infections elsewhere have not been found in Denmark.},
number = {1},
urldate = {2012-09-14},
journal = {{APMIS:} Acta Pathologica, Microbiologica, Et Immunologica Scandinavica},
author = {Hansen, Joanna M and Gerner-Smidt, Peter and Bruun, Brita},
month = jan,
year = {2005},
note = {{PMID:} 15676012},
keywords = {Biological Evolution, Denmark, Drug Resistance, Bacterial, Humans, Listeria monocytogenes, Listeriosis, Retrospective Studies},
pages = {31--36}
},
@article{vazquez-boland_listeria_2001,
title = {\emph{{Listeria}} pathogenesis and molecular virulence determinants},
volume = {14},
issn = {0893-8512},
url = {http://www.ncbi.nlm.nih.gov/pubmed/11432815},
doi = {10.1128/CMR.14.3.584-640.2001},
abstract = {The gram-positive bacterium Listeria monocytogenes is the causative agent of listeriosis, a highly fatal opportunistic foodborne infection. Pregnant women, neonates, the elderly, and debilitated or immunocompromised patients in general are predominantly affected, although the disease can also develop in normal individuals. Clinical manifestations of invasive listeriosis are usually severe and include abortion, sepsis, and meningoencephalitis. Listeriosis can also manifest as a febrile gastroenteritis syndrome. In addition to humans, L. monocytogenes affects many vertebrate species, including birds. Listeria ivanovii, a second pathogenic species of the genus, is specific for ruminants. Our current view of the pathophysiology of listeriosis derives largely from studies with the mouse infection model. Pathogenic listeriae enter the host primarily through the intestine. The liver is thought to be their first target organ after intestinal translocation. In the liver, listeriae actively multiply until the infection is controlled by a cell-mediated immune response. This initial, subclinical step of listeriosis is thought to be common due to the frequent presence of pathogenic L. monocytogenes in food. In normal individuals, the continual exposure to listerial antigens probably contributes to the maintenance of anti-Listeria memory T cells. However, in debilitated and immunocompromised patients, the unrestricted proliferation of listeriae in the liver may result in prolonged low-level bacteremia, leading to invasion of the preferred secondary target organs (the brain and the gravid uterus) and to overt clinical disease. L. monocytogenes and L. ivanovii are facultative intracellular parasites able to survive in macrophages and to invade a variety of normally nonphagocytic cells, such as epithelial cells, hepatocytes, and endothelial cells. In all these cell types, pathogenic listeriae go through an intracellular life cycle involving early escape from the phagocytic vacuole, rapid intracytoplasmic multiplication, bacterially induced actin-based motility, and direct spread to neighboring cells, in which they reinitiate the cycle. In this way, listeriae disseminate in host tissues sheltered from the humoral arm of the immune system. Over the last 15 years, a number of virulence factors involved in key steps of this intracellular life cycle have been identified. This review describes in detail the molecular determinants of Listeria virulence and their mechanism of action and summarizes the current knowledge on the pathophysiology of listeriosis and the cell biology and host cell responses to Listeria infection. This article provides an updated perspective of the development of our understanding of Listeria pathogenesis from the first molecular genetic analyses of virulence mechanisms reported in 1985 until the start of the genomic era of Listeria research.},
number = {3},
urldate = {2012-09-14},
journal = {Clinical Microbiology Reviews},
author = {V\'{a}zquez-Boland, J A and Kuhn, M and Berche, P and Chakraborty, T and Domínguez-Bernal, G and Goebel, W and González-Zorn, B and Wehland, J and Kreft, J},
month = jul,
year = {2001},
note = {{PMID:} 11432815},
keywords = {Animals, Bacterial Proteins, Humans, Listeria, Listeriosis, Virulence},
pages = {584--640}
},
@article{knabel_sequence_2012,
title = {Sequence typing confirms that a predominant \emph{{Listeria monocytogenes}} clone caused human listeriosis cases and outbreaks in {Canada} from 1988 to 2010},
volume = {50},
issn = {1098-{660X}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/22337989},
doi = {10.1128/JCM.06185-11},
abstract = {Human listeriosis outbreaks in Canada have been predominantly caused by serotype 1/2a isolates with highly similar pulsed-field gel electrophoresis {(PFGE)} patterns. Multilocus sequence typing {(MLST)} and multi-virulence-locus sequence typing {(MVLST)} each identified a diverse population of Listeria monocytogenes isolates, and within that, both methods had congruent subtypes that substantiated a predominant clone (clonal complex 8; virulence type 59; proposed epidemic clone 5 {[ECV])} that has been causing human illness across Canada for more than 2 decades.},
number = {5},
urldate = {2012-09-14},
journal = {Journal of Clinical Microbiology},
author = {Knabel, Stephen J and Reimer, Aleisha and Verghese, Bindhu and Lok, Mei and Ziegler, Jennifer and Farber, Jeffrey and Pagotto, Franco and Graham, Morag and Nadon, Celine A and Gilmour, Matthew W},
month = may,
year = {2012},
note = {{PMID:} 22337989},
keywords = {Canada, Cluster Analysis, Disease Outbreaks, {DNA}, Bacterial, Humans, Listeria monocytogenes, Listeriosis, Molecular Epidemiology, Molecular Sequence Data, Molecular Typing, Sequence Analysis, {DNA}},
pages = {1748--1751}
},
@article{gilmour_high-throughput_2010,
title = {High-throughput genome sequencing of two \emph{{Listeria monocytogenes}} clinical isolates during a large foodborne outbreak},
volume = {11},
copyright = {2010 Gilmour et al; licensee {BioMed} Central Ltd.},
issn = {1471-2164},
url = {http://www.biomedcentral.com/1471-2164/11/120/abstract},
doi = {10.1186/1471-2164-11-120},
abstract = {A large, multi-province outbreak of listeriosis associated with ready-to-eat meat products contaminated with Listeria monocytogenes serotype 1/2a occurred in Canada in 2008. Subtyping of outbreak-associated isolates using pulsed-field gel electrophoresis {(PFGE)} revealed two similar but distinct {AscI} {PFGE} patterns. High-throughput pyrosequencing of two L. monocytogenes isolates was used to rapidly provide the genome sequence of the primary outbreak strain and to investigate the extent of genetic diversity associated with a change of a single restriction enzyme fragment during {PFGE.}},
language = {en},
number = {1},
urldate = {2012-09-14},
journal = {{BMC} Genomics},
author = {Gilmour, Matthew W. and Graham, Morag and Domselaar, Gary Van and Tyler, Shaun and Kent, Heather and Trout-Yakel, Keri M. and Larios, Oscar and Allen, Vanessa and Lee, Barbara and Nadon, Celine},
month = feb,
year = {2010},
pages = {120}
},
@article{swaminathan_amplification_1995,
title = {Amplification methods for epidemiologic investigations of infectious diseases},
volume = {23},
issn = {0167-7012},
url = {http://www.sciencedirect.com/science/article/pii/016770129500021C},
doi = {10.1016/0167-7012(95)00021-C},
abstract = {{DNA} restriction fragment length polymorphisms {(RFLP)} are extremely valuable tools for laboratory-based evaluation of hypotheses generated by epidemiologic investigations of infectious disease outbreaks. Recently, polymerase chain reaction {(PCR)-based} {DNA} amplification methods have been used to index differences between suspected etiologic agents isolated from cases and suspected source. These methods are attractive because they require minute amounts of target {DNA}, and can be completed in a very short time. Two types of {PCR-based} subtyping methods are available. The {PCR-RFLP} method involves the amplification of previously characterized or phylogenetically conserved targets followed by restriction endonuclease analysis to evaluate polymorphisms within the amplified sequences. The Random Amplified Polymorphic {DNA} {(RAPD)} and Arbitrarily Primed {PCR} {(AP-PCR)} methods require no prior knowledge of {DNA} sequences of test organisms because they rely on random amplification of target {DNA} by arbitrarily chosen primers. {RAPD} and {AP-PCR} do not require any restriction analysis of amplified {DNA.} The {PCR-RFLP} methods are organism-dependent and do not always provide adequate discrimination between unrelated isolates. {RAPD} methods often suffer from poor reproducibility because the amplification is performed by using crude target {DNA} under nonstringent conditions.},
number = {1},
urldate = {2012-09-11},
journal = {Journal of Microbiological Methods},
author = {Swaminathan, Bala and Barrett, Timothy J.},
month = jul,
year = {1995},
keywords = {{AP-PCR}, Epidemiology, {PCR}, {PCR-RFLP}, {RAPD}, Subtyping},
pages = {129--139}
},
@article{graves_pulsenet_2001,
title = {{PulseNet} standardized protocol for subtyping \emph{{Listeria monocytogenes}} by macrorestriction and pulsed-field gel electrophoresis},
volume = {65},
issn = {0168-1605},
url = {http://www.sciencedirect.com/science/article/pii/S0168160500005018},
doi = {10.1016/S0168-1605(00)00501-8},
abstract = {{PulseNet} is a national network of pubic health and food regulatory laboratories established in the {US} to detect clusters of foodborne disease and respond quickly to foodborne outbreak investigations. {PulseNet} laboratories currently subtype Escherichia coli {O157:H7}, non-typhoidal Salmonella, and Shigella isolates by a highly standardized 1-day pulsed-field gel electrophoresis {(PFGE)}, and exchange normalized {DNA} “fingerprint” patterns via the Internet. We describe a standardized molecular subtyping protocol for subtyping Listeria monocytogenes that was recently added to {PulseNet.} The subtyping can be completed within 30 h from the time a pure culture of the bacteria is obtained.},
number = {1–2},
urldate = {2012-09-11},
journal = {International Journal of Food Microbiology},
author = {Graves, Lewis M. and Swaminathan, Bala},
month = apr,
year = {2001},
keywords = {Epidemiology, Listeria monocytogenes, Pulsed-field gel electrophoresis, {PulseNet}, Subtyping},
pages = {55--62}
},
@article{swaminathan_pulsenet:_2001,
title = {{PulseNet:} the molecular subtyping network for foodborne bacterial disease surveillance, {United States}},
volume = {7},
issn = {1080-6040},
shorttitle = {{PulseNet}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/11384513},
abstract = {{PulseNet}, the national molecular subtyping network for foodborne disease surveillance, was established by the Centers for Disease Control and Prevention and several state health department laboratories to facilitate subtyping bacterial foodborne pathogens for epidemiologic purposes. {PulseNet}, which began in 1996 with 10 laboratories typing a single pathogen {(Escherichia} coli {O157:H7)}, now includes 46 state and 2 local public health laboratories and the food safety laboratories of the {U.S.} Food and Drug Administration and the {U.S.} Department of Agriculture. Four foodborne pathogens {(E.} coli {O157:H7;} nontyphoidal Salmonella serotypes, Listeria monocytogenes and Shigella) are being subtyped, and other bacterial, viral, and parasitic organisms will be added soon.},
number = {3},
urldate = {2011-08-09},
journal = {Emerging Infectious Diseases},
author = {Swaminathan, B and Barrett, T J and Hunter, S B and Tauxe, R V},
month = jun,
year = {2001},
note = {{PMID:} 11384513},
keywords = {Bacterial Typing Techniques, Cost-Benefit Analysis, Databases as Topic, Disease Outbreaks, Electrophoresis, Gel, Pulsed-Field, Food Microbiology, Information Services, Quality Control, Terminology as Topic},
pages = {382--389}
},
@misc{government_of_canada_lessons_2009,
title = {Lessons Learned: {Public Health Agency of Canada}'s Response to the 2008 Listeriosis Outbreak - {Public Health Agency of Canada}},
shorttitle = {Lessons Learned},
url = {http://www.phac-aspc.gc.ca/fs-sa/listeria/2008-lessons-lecons-eng.php},
language = {eng},
urldate = {2012-09-14},
author = {Government of Canada, Public Health Agency of Canada},
month = mar,
year = {2009},
note = {Presents a general overview to the Agency’s senior management of what worked well during the outbreak, and what needs further refinement, in order for the Agency to be better prepared for future outbreaks.},
keywords = {Emergency preparedness, Foodborne Diseases, Policy development, Public Health},
howpublished = {http://www.phac-aspc.gc.ca/fs-sa/listeria/2008-lessons-lecons-eng.php}
},
@misc{government_of_canada_link_2008,
title = {Link between listeriosis outbreak strain and Maple Leaf Foods products confirmed},
url = {http://www.phac-aspc.gc.ca/media/nr-rp/2008/2008_13-eng.php},
language = {eng},
urldate = {2012-09-14},
author = {Government of Canada, Public Health Agency of Canada},
month = aug,
year = {2008},
note = {The Public Health Agency of Canada and the Canadian Food Inspection Agency have received laboratory results from Health Canada that establish a link between meat products recalled by Maple Leaf Foods from their plant in Toronto and an outbreak of listeriosis in four provinces. To date, 21 cases of listeriosis have been confirmed, and the same strain has been detected in four people who have died. A further 30 cases remain under investigation},
keywords = {Public Health},
howpublished = {http://www.phac-aspc.gc.ca/media/nr-rp/2008/2008\_13-eng.php}
},
@article{fleming_pasteurized_1985,
title = {Pasteurized milk as a vehicle of infection in an outbreak of listeriosis},
volume = {312},
issn = {0028-4793},
url = {http://www.ncbi.nlm.nih.gov/pubmed/3918263},
doi = {10.1056/NEJM198502143120704},
abstract = {Between June 30th and August 30th, 1983, 49 patients in Massachusetts acquired listeriosis. Seven cases occurred in fetuses or infants and 42 in immunosuppressed adults; 14 patients (29 per cent) died. Of 40 Listeria monocytogenes isolates available for testing, 32 were serotype 4b. Two case-control studies, one matching for neighborhood of residence and the other for underlying disease, revealed that the illness was strongly associated with drinking a specific brand of pasteurized whole or 2 per cent milk (odds ratio = 9, P less than 0.01 for the neighborhood-matched study; odds ratio = 11.5, P less than 0.001 for the illness-matched study). The association with milk was further substantiated by four additional analyses that suggested the presence of a dose-response effect, demonstrated a protective effect of skim milk, associated cases with the same product in an independent study in another state, and linked a specific phage type with the disease associated with milk. The milk associated with disease came from a group of farms on which listeriosis in dairy cows was known to have occurred at the time of the outbreak. Multiple serotypes of L. monocytogenes were isolated from raw milk obtained from these farms after the outbreak. At the plant where the milk was processed, inspections revealed no evidence of improper pasteurization. These results support the hypothesis that human listeriosis can be a foodborne disease and raise questions about the ability of pasteurization to eradicate a large inoculum of L. monocytogenes from contaminated raw milk.},
number = {7},
urldate = {2012-09-13},
journal = {The New England Journal of Medicine},
author = {Fleming, D W and Cochi, S L and {MacDonald}, K L and Brondum, J and Hayes, P S and Plikaytis, B D and Holmes, M B and Audurier, A and Broome, C V and Reingold, A L},
month = feb,
year = {1985},
note = {{PMID:} 3918263},
keywords = {Adult, Aged, Animals, Cattle, Cattle Diseases, Connecticut, Disease Outbreaks, Epidemiologic Methods, Female, Food Contamination, Food Microbiology, Humans, Infant, Newborn, Listeria monocytogenes, Listeriosis, Male, Massachusetts, Middle Aged, Milk, Pregnancy, Sterilization},
pages = {404--407}
},
@article{ho_outbreak_1986,
title = {An outbreak of type 4b \emph{{Listeria monocytogenes}} infection involving patients from eight {Boston} hospitals},
volume = {146},
issn = {0003-9926},
url = {http://www.ncbi.nlm.nih.gov/pubmed/3954524},
abstract = {During September and October 1979, 23 patients admitted to hospitals in the Boston area had systemic Listeria monocytogenes infection. Twenty (87\%) of these isolates were L monocytogenes type 4b, whereas only nine (33\%) of the isolates serotyped during the preceding 26 months had been 4b. Patients with type 4b Listeria infection during the epidemic period (case patients) differed from patients with sporadic Listeria infection in the preceding two years in that more of the case patients had hospital-acquired infection (15/20 vs 4/18), had received antacids or cimetidine before the onset of listeriosis (12/20 vs 3/18), and had gastrointestinal tract symptoms that began at the same time as fever (17/20 vs 4/18). In addition, more case patients took antacids or cimetidine compared with patients matched for age, sex, and date of hospitalization (12/20 vs 10/40). Three foods were preferred by case patients more frequently than by control patients: tuna fish, chicken salad, and cheese. However, the only common feature appeared to be the serving of these foods with raw celery, tomatoes, and lettuce. The raw vegetables may have been contaminated with Listeria, which was able to survive ingestion because of gastric acid neutralization and subsequently to cause enteritis, bacteremia, and meningitis in susceptible hosts. However, we cannot exclude pasteurized milk as a source of this outbreak.},
number = {3},
urldate = {2012-09-13},
journal = {Archives of Internal Medicine},
author = {Ho, J L and Shands, K N and Friedland, G and Eckind, P and Fraser, D W},
month = mar,
year = {1986},
note = {{PMID:} 3954524},
keywords = {Aged, Antacids, Boston, Cimetidine, Cross Infection, Disease Outbreaks, Epidemiologic Methods, Female, Food Preferences, Gastric Acid, Hospitalization, Humans, Listeriosis, Male, Middle Aged, Questionnaires, Sepsis},
pages = {520--524}
},
@article{conly_listeria:_2008,
title = {Listeria: A persistent food-borne pathogen},
volume = {19},
issn = {1712-9532},
shorttitle = {Listeria},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2606629/},
number = {5},
urldate = {2012-09-13},
journal = {The Canadian Journal of Infectious Diseases \& Medical Microbiology},
author = {Conly, {JM} and Johnston, {BL}},
month = sep,
year = {2008},
note = {{PMID:} 19436470
{PMCID:} {PMC2606629}},
pages = {327--328}
}
@article{pouillot_relative_2012,
title = {Relative Risk of Listeriosis in Foodborne Diseases Active Surveillance Network {(FoodNet)} Sites According to Age, Pregnancy, and Ethnicity},
volume = {54},
issn = {1058-4838, 1537-6591},
url = {http://cid.oxfordjournals.org/content/54/suppl_5/S405.abstract},
doi = {10.1093/cid/cis269},
number = {suppl 5},
urldate = {2012-09-13},
journal = {Clinical Infectious Diseases},
author = {Pouillot, R. and Hoelzer, K. and Jackson, K. A. and Henao, O. L. and Silk, B. J.},
month = may,
year = {2012},
pages = {S405--S410}
},
@Article{silver_listeriosis_1998,
AUTHOR = {Silver, H M},
TITLE = {Listeriosis during pregnancy.},
JOURNAL = {Obstet Gynecol Surv},
VOLUME = {53},
YEAR = {1998},
NUMBER = {12},
PAGES = {737-40},
URL = {http://www.biomedsearch.com/nih/Listeriosis-during-pregnancy/9870235.html},
PubMedID = {9870235},
ISSN = {0029-7828}
},
@article{ferreira_diverse_2011,
title = {Diverse Geno- and Phenotypes of Persistent \emph{{Listeria monocytogenes}} Isolates from Fermented Meat Sausage Production Facilities in {Portugal}},
volume = {77},
issn = {0099-2240, 1098-5336},
url = {http://aem.asm.org/content/77/8/2701},
doi = {10.1128/AEM.02553-10},
abstract = {The persistence of \emph{{Listeria monocytogenes}} in food-associated environments represents a key factor in transmission of this pathogen. To identify persistent and transient strains associated with production of fermented meat sausages in northern Portugal, 1,723 \emph{{L. monocytogenes}} isolates from raw material and finished products from 11 processors were initially characterized by random amplification of polymorphic {DNA} {(RAPD)}, {PCR-based} molecular serotyping, and epidemic clone characterization, as well as cadmium, arsenic, and tetracycline resistance typing. Pulsed-field gel electrophoresis {(PFGE)} typing of 240 representative isolates provided evidence for persistence of \emph{{L. monocytogenes}} for periods of time ranging from 10 to 32 months for all seven processors for which isolates from different production dates were available. Among 50 \emph{{L. monocytogenes}} isolates that included one representative for each {PFGE} pattern obtained from a given sample, 12 isolates showed reduced invasion efficiency in Caco-2 cells, including 8 isolates with premature stop codons in {inlA.} Among 41 isolates representing sporadic and persistent {PFGE} types, 22 isolates represented lysogens. Neither strains with reduced invasion nor lysogens were overrepresented among persistent isolates. While the susceptibility of isolates to lysogenic phages also did not correlate with persistence, it appeared to be associated with molecular serotype. Our data show the following. (i) {RAPD} may not be suitable for analysis of large sets of \emph{{L. monocytogenes}} isolates. (ii) While a large diversity of \emph{{L. monocytogenes}} subtypes is found in Portuguese fermented meat sausages, persistence of \emph{{L. monocytogenes}} in this food chain is common. (iii) Persistent \emph{{L. monocytogenes}} strains are diverse and do not appear to be characterized by unique genetic or phenotypic characteristics.},
language = {en},
number = {8},
urldate = {2012-09-11},
journal = {Applied and Environmental Microbiology},
author = {Ferreira, V. and Barbosa, J. and Stasiewicz, M. and Vongkamjan, K. and Switt, A. Moreno and Hogg, T. and Gibbs, P. and Teixeira, P. and Wiedmann, M.},
month = apr,
year = {2011},
pages = {2701--2715},
annote = {used {PFGE} to show long term persistence of Listeria in food processing environments}
},
@article{ratani_heavy_2012,
title = {Heavy Metal and Disinfectant Resistance of \emph{{Listeria monocytogenes}} from Foods and Food Processing Plants},
volume = {78},
issn = {0099-2240, 1098-5336},
url = {http://aem.asm.org/content/78/19/6938},
doi = {10.1128/AEM.01553-12},
abstract = {The persistence of \emph{{Listeria monocytogenes}} in food processing plants and other ecosystems reflects its ability to adapt to numerous stresses. In this study, we investigated 138 isolates from foods and food processing plants for resistance to the quaternary ammonium disinfectant benzalkonium chloride {(BC)} and to heavy metals (cadmium and arsenic). We also determined the prevalence of distinct cadmium resistance determinants {(cadA1}, {cadA2}, and {cadA3)} among cadmium-resistant isolates. Most {BC-resistant} isolates were resistant to cadmium as well. Arsenic resistance was encountered primarily in serotype 4b and was an attribute of most isolates of the serotype 4b epidemic clonal group {ECIa.} Prevalence of the known cadmium resistance determinants was serotype associated: {cadA1} was more common in isolates of serotypes 1/2a and 1/2b than 4b, while {cadA2} was more common in those of serotype 4b. A subset (15/77 [19\%]) of the cadmium-resistant isolates lacked the known cadmium resistance determinants. Most of these isolates were of serotype 4b and were also resistant to arsenic, suggesting novel determinants that may confer resistance to both cadmium and arsenic in these serotype 4b strains. The findings may reflect previously unrecognized components of the ecological history of different serotypes and clonal groups of \emph{{L. monocytogenes,}} including exposures to heavy metals and disinfectants.},
language = {en},
number = {19},
urldate = {2012-09-11},
journal = {Applied and Environmental Microbiology},
author = {Ratani, Shakir S. and Siletzky, Robin M. and Dutta, Vikrant and Yildirim, Suleyman and Osborne, Jason A. and Lin, Wen and Hitchins, Anthony D. and Ward, Todd J. and Kathariou, Sophia},
month = oct,
year = {2012},
pages = {6938--6945}
},
@article{blackman_growth_1996,
title = {Growth of \emph{{Listeria monocytogenes}} as a Biofilm on Various Food-Processing Surfaces},
volume = {59},
abstract = {The objective of this research was to determine the ability of \emph{{Listeria monocytogenes}} to grow as a biofilm on various food-processing surfaces including stainless steel, Teflon®, nylon, and polyester floor sealant. Each of these surfaces was able to support biofilm formation when incubation was at {21°C} in Trypticase soy broth {(TSB).} Biofilm formation was greatest on polyester floor sealant (40\% of surface area covered after 7 days of incubation) and least on nylon (3\% coverage). The use of chemically defined minimal medium resulted in a lack of biofilm formation on polyester floor sealant, and reduced biofilm levels on stainless steel. Biofilm formation was reduced with incubation at {10°C}, but Teflon® and stainless steel still allowed 23 to 24\% coverage after incubation in {TSB} for 18 days. Biofilm growth of \emph{{L. monocytogenes}} was sufficient to provide a substantial risk of this pathogen contaminating the food-processing plant environment if wet surfaces are not maintained in a sanitary condition.},
number = {8},
journal = {Journal of Food Protection},
author = {Blackman, Isabel C. and Frank, Joseph F.},
year = {1996},
keywords = {Biofilm, Epifluorescence Microscopy, Food Processing, \emph{{Listeria monocytogenes,}} Sem},
pages = {827--831}
},
@article{todd_surveillance_2011,
title = {Surveillance of listeriosis and its causative pathogen, \emph{{Listeria monocytogenes}}},
volume = {22},
issn = {0956-7135},
url = {http://www.sciencedirect.com/science/article/pii/S0956713510002422},
doi = {10.1016/j.foodcont.2010.07.021},
abstract = {To manage the problem of foodborne listeriosis requires an understanding of the burden of the disease on a worldwide scale as foods that are prone to contamination are eaten widely domestically and many are traded globally. Surveillance of the disease, caused by \emph{{Listeria monocytogenes,}} is typically restricted to developed countries, but many of these do not consider listeriosis as a notifiable disease and estimate the numbers by other means. Incidence rates range from 0.3 to 1.3 per 100,000, but most are in the 0.3–0.5 range, irrespective of the regulatory system and industry control programmes that have been in place. Ready-to-eat foods are the vehicle for transmission of the Listeria through contamination somewhere in the food chain. Meat, poultry and dairy products have been most frequently implicated, but other foods including produce may also have been vehicles of transmission. Large outbreaks are usually linked to errors in food processing plants, such as contaminated slicing machines, followed by opportunities for growth of the pathogen. Less is known about home-generated illnesses but incorrect use of refrigerators can allow cross-contamination and growth of the pathogen to levels that can cause infections. In the {U.S.}, door-to-door salesmen have sold contaminated Hispanic soft cheeses that have led to outbreaks and stillbirths. In addition to outbreak investigation, case-control studies, and the use of experts, risk assessments, and food attribution studies can help focus on areas of greatest risk for prevention and control measures throughout the food chain.},
number = {9},
urldate = {2012-09-11},
journal = {Food Control},
author = {Todd, {E.C.D.} and Notermans, S.},
month = sep,
year = {2011},
keywords = {Food attribution, \emph{{Listeria monocytogenes,}} Listeriosis incidence, Management options, Outbreaks, Risk, Surveillance},
pages = {1484--1490}
},
@article{belessi_efficiency_2011,
title = {Efficiency of different sanitation methods on \emph{{Listeria monocytogenes}} biofilms formed under various environmental conditions},
volume = {145 Suppl 1},
issn = {1879-3460},
url = {http://www.ncbi.nlm.nih.gov/pubmed/21093085},
doi = {10.1016/j.ijfoodmicro.2010.10.020},
abstract = {The resistance of \emph{{Listeria monocytogenes}} biofilms formed under food processing conditions, against various sanitizing agents and disinfection procedures was evaluated in the present study. The first sanitation procedure included biofilm formation on stainless steel coupons {(SS)} placed in tryptic soy broth supplemented with 0.6\% yeast extract {(TSBYE)} of various concentrations of {NaCl} (0.5, 7.5 and 9.5\%) at different temperatures (5 and 20 {°C).} The biofilms formed were exposed to warm (60 {°C)} water for 20 min, or to peroxyacetic acid (2\% {PAA)} for 1, 2, 3 and 6 min. Treatment with warm water caused no significant {(P} ≥ 0.05) reductions in the attached populations. Conversely, surviving bacteria on {SS} coupons decreased as the exposure time to 2\% {PAA} increased and could not be detected by culture after 6 min of exposure. Biofilms formed at {20°C} were more resistant to {PAA} than biofilms formed at 5 {°C.} Salt concentration in the growth medium had no marked impact on the resistance to {PAA.} The second sanitation procedure included biofilm formation of nonadapted {(NA)} and acid-adapted {(AA)} cells in {TSBYE} of {pH} 5.0 and 7.0 (i.e., {NA-5.0}, {NA-7.0} and {AA-5.0}, {AA-7.0)} at 4 {°C.} Coupons bearing attached cells of \emph{{L. monocytogenes}} were periodically exposed to chlorine (0.465\% Cl(-)), quaternary ammonium compound (1\% {QAC)} and 2\% {PAA.} The resistance of attached cells to {QAC}, {PAA} and Cl(-) followed the order: {AA-5.0{\textgreater}NA-7.0} ≥ {AA-7.0{\textgreater}NA-5.0.} The most effective sanitizer was {QAC} followed by {PAA} and Cl(-). The results can lead to the development of efficient sanitation strategies in order to eliminate \emph{{L. monocytogenes}} from the processing environment. Furthermore, such results may explain the presence of \emph{{L. monocytogenes}} after sanitation as a result of cell attachment history.},
urldate = {2012-09-10},
journal = {International Journal of Food Microbiology},
author = {Belessi, Charalambia-Eirini A and Gounadaki, Antonia S and Psomas, Antonios N and Skandamis, Panagiotis N},
month = mar,
year = {2011},
note = {{PMID:} 21093085},
keywords = {Biofilms, Chlorine, Disinfectants, Disinfection, Environment, Food Handling, \emph{{Listeria monocytogenes,}} Peracetic Acid, Quaternary Ammonium Compounds, Sodium Chloride, Stainless Steel, Temperature, Water},
pages = {S46--52}
},
@article{pan_resistance_2006,
title = {Resistance of \emph{{Listeria monocytogenes}} Biofilms to Sanitizing Agents in a Simulated Food Processing Environment},
volume = {72},
issn = {0099-2240},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1694257/},
doi = {10.1128/AEM.01065-06},
abstract = {The objective of this study was to evaluate the resistance of biofilms of \emph{{Listeria monocytogenes}} to sanitizing agents under laboratory conditions simulating a food processing environment. Biofilms were initially formed on stainless steel and Teflon coupons using a five-strain mixture of \emph{{L. monocytogenes.}} The coupons were then subjected to repeated 24-h daily cycles. Each cycle consisted of three sequential steps: (i) a brief (60 s) exposure of the coupons to a sanitizing agent (a mixture of peroxides) or saline as a control treatment, (ii) storage of the coupons in sterile plastic tubes without any nutrients or water for 15 h, (iii) and incubation of the coupons in diluted growth medium for 8 h. This regimen was repeated daily for up to 3 weeks and was designed to represent stresses encountered by bacteria in a food processing environment. The bacteria on the coupons were reduced in number during the first week of the simulated food processing {(SFP)} regimen, but then adapted to the stressful conditions and increased in number. Biofilms repeatedly exposed the peroxide sanitizer in the {SFP} regimen developed resistance to the peroxide sanitizer as well as other sanitizers (quaternary ammonium compounds and chlorine). Interestingly, cells that were removed from the biofilms on peroxide-treated and control coupons were not significantly different in their resistance to sanitizing agents. These data suggest that the resistance of the treated biofilms to sanitizing agents may be due to attributes of extracellular polymeric substances and is not an intrinsic attribute of the cells in the biofilm.},
number = {12},
urldate = {2012-09-10},
journal = {Applied and Environmental Microbiology},
author = {Pan, Y. and Breidt, F. and Kathariou, S.},
month = dec,
year = {2006},
note = {{PMID:} 17012587
{PMCID:} {PMC1694257}},
pages = {7711--7717}
},
%abstract = {During January-June 2010, a total of 14 cases of laboratory-confirmed invasive listeriosis were reported to the Louisiana Office of Public Health {(OPH).} Isolates of \emph{{Listeria monocytogenes}} from the blood samples of eight patients were identified as serotype 1/2a and had pulsed-field gel electrophoresis {(PFGE)} pattern combinations that were indistinguishable from one another. The detection of this cluster prompted an investigation in coordination with {CDC}, the Louisiana Department of Agriculture and Forestry {(LDAF)}, and the {U.S.} Department of Agriculture's Food Safety and Inspection Service {(USDA-FSIS).} In-depth epidemiologic and environmental investigations of the cluster were initiated on July 26, including food history interviews of four patients. Three patients reported eating hog head cheese (a meat jelly made from swine heads and feet); the product was purchased at two grocery stores in Louisiana. A traceback investigation determined that a single brand of hog head cheese was common between the two grocery stores. \emph{{L. monocytogenes}} serotype 1/2a was cultured from one of three product samples and from two of 16 environmental samples collected by {LDAF} at the processing establishment; the product and one of the two environmental samples yielded isolates with {PFGE} pattern combinations that were indistinguishable from the patient isolates. On August 14, {LDAF} coordinated a voluntary recall of approximately 500,000 pounds of hog head cheese and sausage because of possible contamination with \emph{{L. monocytogenes.}} This is the first published report of an invasive listeriosis outbreak associated with hog head cheese, which is a ready-to-eat {(RTE)} meat. {USDA-FSIS} has a "zero tolerance" policy for \emph{{L. monocytogenes}} contamination of {RTE} food products, requesting recall of such products at any detectable level of \emph{{L. monocytogenes}} contamination. {LDAF} imposes and enforces equivalent requirements in state-inspected establishments.},
@article{hogheadcheese_outbreak_2010,
title = {Outbreak of invasive listeriosis associated with the consumption of hog head cheese -- {Louisiana}, 2010},
volume = {60},
issn = {1545-{861X}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/21471946},
number = {13},
urldate = {2012-09-05},
journal = {{MMWR.} Morbidity and Mortality Weekly Report},
author = {CDC},
month = apr,
year = {2011},
note = {{PMID:} 21471946},
keywords = {Adult, Aged, Aged, 80 and over, Animals, Disease Outbreaks, Female, Food Contamination, Foodborne Diseases, Humans, \emph{{Listeria monocytogenes}}, Listeriosis, Louisiana, Male, Meat Products, Middle Aged, Swine},
pages = {401--405}
},
@article{carpentier_review_2011,
title = {Review -- Persistence of \emph{{Listeria monocytogenes}} in food industry equipment and premises},
volume = {145},
issn = {0168-1605},
url = {http://www.sciencedirect.com/science/article/pii/S0168160511000122},
doi = {10.1016/j.ijfoodmicro.2011.01.005},
abstract = {To understand why \emph{{Listeria monocytogenes}} may persist in food industry equipment and premises, notably at low temperature, scientific studies have so far focused on adhesion potential, biofilm forming ability, resistance to desiccation, acid and heat, tolerance to increased sublethal concentration of disinfectants or resistance to lethal concentrations. Evidence from studies in processing plants shows that the factors associated with the presence of \emph{{L. monocytogenes}} are those that favor growth. Interestingly, most conditions promoting bacterial growth were shown, in laboratory assays, to decrease adhesion of \emph{{L. monocytogenes}} cells. Good growth conditions can be found in so-called harborage sites, i.e. shelters due to unhygienic design of equipment and premises or unhygienic or damaged materials. These sites are hard to eliminate. A conceptual model of persistence/no persistence based on the relative weight of growth vs. outcome of cleaning and disinfection is suggested. It shows that a minimum initial bacterial load is necessary for bacteria to persist in a harborage site and that when a low initial bacterial charge is applied, early cleaning and disinfection is the only way to avoid persistence. We conclude by proposing that there are no strains of \emph{{L. monocytogenes}} with unique properties that lead to persistence, but harborage sites in food industry premises and equipment where \emph{{L. monocytogenes}} can persist.},
number = {1},
urldate = {2012-08-21},
journal = {International Journal of Food Microbiology},
author = {Carpentier, Brigitte and Cerf, Olivier},
month = jan,
year = {2011},
keywords = {Food Industry, \emph{{Listeria monocytogenes,}} Persistence},
pages = {1--8}
}
@book{ryser_listeria_2007,
title = {Listeria, Listeriosis, and Food Safety, Third Edition},
isbn = {9780824757502},
abstract = {Since the second edition of Listeria, Listeriosis, and Food Safetywas published in 1999, the United States has seen a 40 percent decline in the incidence of listeriosis, with the current annual rate of illness rapidly approaching the 2010 target of 2.5 cases per million. Research on this food-borne pathogen, however, has continued unabated, concentrating in the last five years on establishing risk assessments to focus limited financial resources on certain high-risk foods. Listeria, Listeriosis, and Food Safety, Third Edition summarizes much of the newly published literature and integrates this information with earlier knowledge to present readers with a complete and current overview of foodborne listeriosis. Two completely new chapters have been added to this third edition. The first deals with risk assessment, cost of foodborne listeriosis outbreaks, and regulatory control of the Listeria problem in various countries. The second identifies specific data gaps and directions for future research efforts. All of the chapters from the second edition have been revised, many by new authors, to include updated information on listeriosis in animals and humans, pathogenesis and characteristics of \emph{{Listeria monocytogenes,}} methods of detection, and subtyping. The text covers the incidence and behavior of \emph{{Listeria monocytogenes}} in many high-risk foods including, fermented and unfermented dairy products, meat, poultry, and egg products, fish and seafood products, and products of plant origin. Upholding the standard of the first two editions, Listeria, Listeriosis, and Food Safety, Third Edition provides the most current information to food scientists, microbiologists, researchers, and public health practitioners.},
language = {en},
publisher = {{CRC} Press},
author = {Ryser, Elliot T. and Marth, Elmer H.},
month = mar,
year = {2007},
pages = {157--213},
keywords = {Technology \& Engineering / Food Science},
annote = {survive low water activity e.g. high salt conc
multiply from -1 to 45 C
pp 157-213
 }
},
@article{phan-thanh_physiological_1998,
title = {Physiological and biochemical aspects of the acid survival of \emph{{Listeria monocytogenes}}},
volume = {44},
abstract = {The physiological aspects of the response to acidic conditions and the correlated protein synthesis were studied by using \emph{{Listeria monocytogenes}} grown in a chemically defined synthetic medium. This growth was greatly affected by {pH} of the medium. It decreased when {pH} declined and was arrested at {pH} 4. When {pH} went under 4, the bacteria began to die. If the bacteria had been adapted to an intermediary sublethal {pH} before imposition of lethal {pH} stress, they would have resisted better lethal {pH.} A prolonged treatment at intermediary {pH}, however, rendered the bacteria more sensitive to subsequent lethal {pH.} Organic volatile acids exerted a more deleterious effect on \emph{{L. monocytogenes}} than inorganic acids at the same stressing {pH.} The acquired acid tolerance was conserved after several weeks of storage of the adapted bacteria at {4°C.} Acid stress and acid adaptation (tolerance) affected the synthesis patterns of bacterial proteins: Many proteins were repressed and several others increased in expression level. These acid-induced proteins were separated by two-dimensional {(2D-)} electrophoresis and analyzed by a computer-aided {2D-gel} analysis system. The results obtained suggested that acid tolerance and acid stress responses require the synthesis of a certain number of shared proteins and that additional acid-induced proteins are needed when the bacteria must face more severe acidic {pH.}},
number = {3},
journal = {The Journal of General and Applied Microbiology},
author = {Phan-Thanh, Luu and Montagne, Annick},
year = {1998},
keywords = {acid adaptation, acid stress, acid survival, acid tolerance, acid-induced proteins, Listeria monocytogenes},
pages = {183--191}
},
@article{petran_study_1989,
title = {A Study of Factors Affecting Growth and Recovery of \emph{{Listeria monocytogenes}} {Scott A}},
volume = {54},
issn = {1750-3841},
url = {http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2621.1989.tb03105.x/abstract},
doi = {10.1111/j.1365-2621.1989.tb03105.x},
abstract = {The growth parameters for \emph{{Listeria monocytogenes}} Scott A at various temperatures, {pH} values, water activity values, and in different carbohydrates were assessed. Growth was seen from {4°C} through {45°C} and at {pH} values from 4.7 through 9.2. Generation times were calculated for each parameter at which growth was observed. Optimum growth was defined as shortest generation time. \emph{{L. monocytogenes}} grew optimally over the temperature range {30–37°C.} The optimum {pH} was 7.0. Growth was demonstrated in solutions of up to 39.4\% sucrose (aw of 0.92). Carbohydrate fermentation was variable. Further studies involved examination of growth at optimal water activities (0.97) with suboptimal temperatures and {pH} values, and at 7.0, with suboptimal temperatures and water activities. Growth was seen when these parameters were combined.},
language = {en},
number = {2},
urldate = {2012-09-11},
journal = {Journal of Food Science},
author = {Petran, R. L. and Zottola, E. A.},
year = {1989},
pages = {458--460}
},
@article{charlier_listeria_2012,
title = {\emph{{Listeria monocytogenes}}--Associated Joint and Bone Infections: A Study of 43 Consecutive Cases},
volume = {54},
issn = {1058-4838, 1537-6591},
shorttitle = {Listeria {monocytogenes–Associated} Joint and Bone Infections},
url = {http://cid.oxfordjournals.org/content/54/2/240},
doi = {10.1093/cid/cir803},
abstract = {Background. Little is known about \emph{{Listeria monocytogenes–associated}} bone and joint infections. Only case reports of this infection have been published.
Methods. Retrospective study of culture-proven bone and joint cases reported to the French National Reference Center for Listeria from 1992 to 2010.
Results. Forty-three patients were studied: 61\% were men, and the median age was 72 (range, 16–89); 24 patients exhibited comorbidities (56\%). Thirty-six patients (84\%) had orthopedic implant devices: prosthetic joints (n = 34) or internal fixation (n = 2); the median time after insertion was 9 years (0.1–22). Subacute infection was more frequent (median, 4 weeks [range, 2–100], 74\%) than acute infection ({\textless}7 days, 23\%), with nonspecific clinical features; 45\% of patients had no fever. Blood cultures were positive in 3 of 19 cases. Isolate polymerase chain reaction genogrouping revealed 4 patterns: {IVb} (21 of 42, 50\%), {IIa} (17 of 42, 40\%), {IIb} (2 of 42, 5\%), and {IIc} (2 of 42, 5\%). Five groups of strains with similar pulsotype patterns were identified without an epidemiological link. Antibiotics, primarily amoxicillin (80\%) with aminoglycosides (48\%), were prescribed for a median duration of 15 weeks (range, 2–88). Eighteen patients (50\%) underwent prosthesis replacement; all were successful after median follow-up of 10 months (range, 1–75). Five of 13 patients for whom material was not removed had protracted infection despite prolonged antibiotherapy; 3 of these patients later underwent prosthesis replacement with sustained recovery.
Conclusions. Osteoarticular listeriosis primarily involves prosthetic joints and occurs in immunocompromised patients. It requires intensive treatment with antibiotherapy and usually requires implant removal or replacement for cure.},
language = {en},
number = {2},
urldate = {2012-09-11},
journal = {Clinical Infectious Diseases},
author = {Charlier, Caroline and Leclercq, Alexandre and Cazenave, Benoît and Desplaces, Nicole and Travier, Laetitia and Cantinelli, Thomas and Lortholary, Olivier and Goulet, Véronique and Monnier, Alban Le and Lecuit, Marc},
month = jan,
year = {2012},
pages = {240--248}
},
@article{scallan_foodborne_2011,
title = {Foodborne illness acquired in the {United States}--major pathogens},
volume = {17},
issn = {1080-6059},
url = {http://www.ncbi.nlm.nih.gov/pubmed/21192848},
doi = {10.3201/eid1701.091101p1},
abstract = {Estimates of foodborne illness can be used to direct food safety policy and interventions. We used data from active and passive surveillance and other sources to estimate that each year 31 major pathogens acquired in the United States caused 9.4 million episodes of foodborne illness (90\% credible interval {[CrI]} 6.6-12.7 million), 55,961 hospitalizations (90\% {CrI} 39,534-75,741), and 1,351 deaths (90\% {CrI} 712-2,268). Most (58\%) illnesses were caused by norovirus, followed by nontyphoidal Salmonella spp. (11\%), Clostridium perfringens (10\%), and Campylobacter spp. (9\%). Leading causes of hospitalization were nontyphoidal Salmonella spp. (35\%), norovirus (26\%), Campylobacter spp. (15\%), and Toxoplasma gondii (8\%). Leading causes of death were nontyphoidal Salmonella spp. (28\%), T. gondii (24\%), \emph{{Listeria monocytogenes}} (19\%), and norovirus (11\%). These estimates cannot be compared with prior (1999) estimates to assess trends because different methods were used. Additional data and more refined methods can improve future estimates.},
number = {1},
urldate = {2012-09-11},
journal = {Emerging Infectious Diseases},
author = {Scallan, Elaine and Hoekstra, Robert M and Angulo, Frederick J and Tauxe, Robert V and Widdowson, Marc-Alain and Roy, Sharon L and Jones, Jeffery L and Griffin, Patricia M},
month = jan,
year = {2011},
note = {{PMID:} 21192848},
keywords = {Campylobacter, Clostridium perfringens, Food Microbiology, Food Safety, Foodborne Diseases, Hospitalization, Humans, Norovirus, Population Surveillance, Salmonella, Toxoplasma, United States},
pages = {7--15}
},
@article{lee_atypical_2012,
title = {Atypical \emph{{Listeria monocytogenes}} Serotype 4b Strains Harboring a Lineage {II}-Specific Gene Cassette},
volume = {78},
issn = {0099-2240, 1098-5336},
url = {http://aem.asm.org/content/78/3/660},
doi = {10.1128/AEM.06378-11},
abstract = {Listeria monocytogenes is the etiological agent of listeriosis, a severe food-borne illness. The population of \emph{{L. monocytogenes}} is divided into four lineages {(I} to {IV)}, and serotype 4b in lineage I has been involved in numerous outbreaks. Several serotype 4b epidemic-associated clonal groups {(ECI}, -{II}, and -Ia) have been identified. In this study, we characterized a panel of strains of serotype 4b that produced atypical results with a serotype-specific multiplex {PCR} and possessed the lmo0734 to lmo0739 gene cassette that had been thought to be specific to lineage {II.} The cassette was harbored in a genomically syntenic locus in these isolates and in lineage {II} strains. Three distinct clonal groups (groups 1 to 3) were identified among these isolates based on single-nucleotide polymorphism-based multilocus genotyping {(MLGT)} and {DNA} hybridization data. Groups 1 and 2 had {MLGT} haplotypes previously encountered among clinical isolates and were composed of clinical isolates from multiple states in the United States. In contrast, group 3 consisted of clinical and environmental isolates solely from North Carolina and exhibited a novel haplotype. In addition, all group 3 isolates had {DNA} that was resistant to {MboI}, suggesting methylation of adenines at {GATC} sites. Sequence analysis of the lmo0734 to lmo0739 gene cassette from two strains (group 1 and group 3) revealed that the genes were highly conserved ({\textgreater}99\% identity). The data suggest relatively recent horizontal gene transfer from lineage {II} \emph{{L. monocytogenes}} into \emph{{L. monocytogenes}} serotype 4b and subsequent dissemination among at least three distinct clonal groups of \emph{{L. monocytogenes}} serotype 4b, one of which exhibits restrictions in regional distribution.},
language = {en},
number = {3},
urldate = {2012-09-11},
journal = {Applied and Environmental Microbiology},
author = {Lee, Sangmi and Ward, Todd J. and Graves, Lewis M. and Wolf, Leslie A. and Sperry, Kate and Siletzky, Robin M. and Kathariou, Sophia},
month = feb,
year = {2012},
pages = {660--667}
},
@article{schlech_epidemic_1983,
title = {Epidemic Listeriosis — Evidence for Transmission by Food},
volume = {308},
url = {http://www.nejm.org/doi/full/10.1056/NEJM198301273080407},
doi = {10.1056/NEJM198301273080407},
number = {4},
journal = {New England Journal of Medicine},
author = {Schlech, Walter F. and Lavigne, Pierre M. and Bortolussi, Robert A. and Allen, Alexander C. and Haldane, E. Vanora and Wort, A. John and Hightower, Allen W. and Johnson, Scott E. and King, Stanley H. and Nicholls, Eric S. and Broome, Claire V.},
year = {1983},
pages = {203--206}
},
@article{dalton_outbreak_1997,
title = {An Outbreak of Gastroenteritis and Fever Due to \emph{{Listeria monocytogenes}} in Milk},
volume = {336},
url = {http://www.nejm.org/doi/full/10.1056/NEJM199701093360204},
doi = {10.1056/NEJM199701093360204},
number = {2},
journal = {New England Journal of Medicine},
author = {Dalton, Craig B. and Austin, Constance C. and Sobel, Jeremy and Hayes, Peggy S. and Bibb, William F. and Graves, Lewis M. and Swaminathan, Bala and Proctor, Mary E. and Griffin, Patricia M.},
year = {1997},
pages = {100--106}
},
@article{linnan_epidemic_1988,
title = {Epidemic Listeriosis Associated with {Mexican}-Style Cheese},
volume = {319},
url = {http://www.nejm.org/doi/full/10.1056/NEJM198809293191303},
doi = {10.1056/NEJM198809293191303},
number = {13},
journal = {New England Journal of Medicine},
author = {Linnan, Michael J. and Mascola, Laurene and Lou, Xiao Dong and Goulet, Veronique and May, Susana and Salminen, Carol and Hird, David W. and Yonekura, M. Lynn and Hayes, Peggy and Weaver, Robert and Audurier, Andre and Plikaytis, Brian D. and Fannin, Shirley L. and Kleks, Abraham and Broome, Claire V.},
year = {1988},
pages = {823--828}
},
@article{swaminathan_epidemiology_2007,
title = {The epidemiology of human listeriosis},
volume = {9},
issn = {1286-4579},
url = {http://www.sciencedirect.com/science/article/pii/S1286457907001876},
doi = {10.1016/j.micinf.2007.05.011},
abstract = {Listeriosis is a serious invasive disease that primarily afflicts pregnant women, neonates and immunocompromised adults. The causative organism, \emph{{Listeria monocytogenes,}} is primarily transmitted to humans through contaminated foods. Outbreaks of listeriosis have been reported in North America, Europe and Japan. Soft cheeses made from raw milk and ready-to-eat meats are high risk foods for susceptible individuals. Efforts by food processors and food regulatory agencies to aggressively control \emph{{L. monocytogenes}} in the high risk foods have resulted in significant decreases in the incidence of sporadic listeriosis.},
number = {10},
urldate = {2012-09-11},
journal = {Microbes and Infection},
author = {Swaminathan, Bala and Gerner-Smidt, Peter},
month = aug,
year = {2007},
keywords = {Epidemiology, \emph{{Listeria monocytogenes,}} Listeriosis},
pages = {1236--1243}
},
@article{farber_listeria_1991,
title = {\emph{{Listeria monocytogenes}}, a food-borne pathogen.},
volume = {55},
issn = {0146-0749},
url = {http://www.ncbi.nlm.nih.gov/pmc/articles/PMC372831/},
abstract = {The gram-positive bacterium \emph{{Listeria monocytogenes}} is an ubiquitous, intracellular pathogen which has been implicated within the past decade as the causative organism in several outbreaks of foodborne disease. Listeriosis, with a mortality rate of about 24\%, is found mainly among pregnant women, their fetuses, and immunocompromised persons, with symptoms of abortion, neonatal death, septicemia, and meningitis. Epidemiological investigations can make use of strain-typing procedures such as {DNA} restriction enzyme analysis or electrophoretic enzyme typing. The organism has a multifactorial virulence system, with the thiol-activated hemolysin, listeriolysin O, being identified as playing a crucial role in the organism's ability to multiply within host phagocytic cells and to spread from cell to cell. The organism occurs widely in food, with the highest incidences being found in meat, poultry, and seafood products. Improved methods for detecting and enumerating the organism in foodstuffs are now available, including those based on the use of monoclonal antibodies, {DNA} probes, or the polymerase chain reaction. As knowledge of the molecular and applied biology of \emph{{L. monocytogenes}} increases, progress can be made in the prevention and control of human infection.},
number = {3},
urldate = {2012-09-10},
journal = {Microbiological Reviews},
author = {Farber, J M and Peterkin, P I},
month = sep,
year = {1991},
note = {{PMID:} 1943998
{PMCID:} {PMC372831}},
pages = {476--511}
},
@article{elliot_risk_2000,
title = {Risk assessment used to evaluate the {US} position on \emph{{Listeria monocytogenes}} in seafood},
volume = {62},
issn = {0168-1605},
url = {http://www.sciencedirect.com/science/article/pii/S0168160500003445},
doi = {10.1016/S0168-1605(00)00344-5},
abstract = {Human listeriosis has been associated with consumption of food including seafood. Surveillance information on the presence of \emph{{Listeria monocytogenes}} in seafood products is presented as a background for steps that are being taken to inform risk managers of risks associated with particular food products. United States policy for \emph{{L. monocytogenes}} in food has been shaped by our increasing knowledge of the epidemiology of outbreaks and sporadic cases of human listeriosis, the potentially severe public health consequences, and the characteristics of the organism. A quantitative risk assessment of the scientific knowledge we have about the organism and the epidemiology of listeriosis should be the basis for changes in this policy. Risk assessment uses quantitative scientific and epidemiological information in a structured format to determine the risks associated with particular hazards. A quantitative risk assessment is being performed using currently available data by the {US} Food and Drug Administration, in collaboration with the {US} Food Safety and Inspection Service, to determine the risk of listeriosis from various foods, including seafood, for specific intervention methods, and for general and at-risk population groups. The questions being considered include those on level of consumption, epidemiology, dose response, and the virulence, biology, and ecology of the organism. Risk managers can use the resulting information to form a defendable science-based policy on \emph{{L. monocytogenes}} in food.},
number = {3},
urldate = {2012-09-11},
journal = {International Journal of Food Microbiology},
author = {Elliot, Elisa L and Kvenberg, John E},
month = dec,
year = {2000},
keywords = {Listeria monocytogenes, Regulatory policy, Risk Assessment, Seafood},
pages = {253--260}
},
@article{dalton_milkoutbreak_1997,
author = {Dalton, Craig B. and Austin, Constance C. and Sobel, Jeremy and Hayes, Peggy S. and Bibb, William F. and Graves, Lewis M. and Swaminathan, Bala and Proctor, Mary E. and Griffin, Patricia M.},
title = {An Outbreak of Gastroenteritis and Fever Due to \emph{{Listeria monocytogenes}} in Milk},
journal = {New England Journal of Medicine},
volume = {336},
number = {2},
pages = {100-106},
year = {1997},
doi = {10.1056/NEJM199701093360204},
URL = {http://www.nejm.org/doi/full/10.1056/NEJM199701093360204},
eprint = {http://www.nejm.org/doi/pdf/10.1056/NEJM199701093360204}
},
@article{kato-maeda_comparing_2001,
title = {Comparing genomes within the species \emph{{Mycobacterium tuberculosis}}},
volume = {11},
issn = {1088-9051},
url = {http://www.ncbi.nlm.nih.gov/pubmed/11282970},
doi = {10.1101/gr166401},
abstract = {The study of genetic variability within natural populations of pathogens may provide insight into their evolution and pathogenesis. We used a Mycobacterium tuberculosis high-density oligonucleotide microarray to detect small-scale genomic deletions among 19 clinically and epidemiologically well-characterized isolates of M. tuberculosis. The pattern of deletions detected was identical within mycobacterial clones but differed between different clones, suggesting that this is a suitable genotyping system for epidemiologic studies. An analysis of genomic deletions among an extant population of pathogenic bacteria provided a novel perspective on genomic organization and evolution. Deletions are likely to contain ancestral genes whose functions are no longer essential for the organism's survival, whereas genes that are never deleted constitute the minimal mycobacterial genome. As the amount of genomic deletion increased, the likelihood that the bacteria will cause pulmonary cavitation decreased, suggesting that the accumulation of mutations tends to diminish their pathogenicity. Array-based comparative genomics is a promising approach to exploring molecular epidemiology, microbial evolution, and pathogenesis.},
number = {4},
urldate = {2012-09-04},
journal = {Genome Research},
author = {Kato-Maeda, M and Rhee, J T and Gingeras, T R and Salamon, H and Drenkow, J and Smittipat, N and Small, P M},
month = apr,
year = {2001},
note = {{PMID:} 11282970},
keywords = {Evolution, Molecular, Genome, Bacterial, Humans, Mycobacterium tuberculosis, Oligonucleotide Array Sequence Analysis, San Francisco, Sequence Deletion, Species Specificity, Tuberculosis},
pages = {547--554}
},
@book{krause_taxicab_1987,
title = {Taxicab Geometry: An Adventure in Non-Euclidean Geometry},
isbn = {0486252027},
shorttitle = {Taxicab Geometry},
publisher = {Dover Publications},
author = {Krause, Eugene F.},
month = jan,
year = {1987}
},
@article{salcedo_development_2003,
title = {Development of a Multilocus Sequence Typing Method for Analysis of \emph{{Listeria monocytogenes}} Clones},
volume = {41},
issn = {0095-1137, 1098-{660X}},
url = {http://jcm.asm.org/content/41/2/757},
doi = {10.1128/JCM.41.2.757-762.2003},
abstract = {This study is a first step in the development of multilocus sequence typing {(MLST)} method for \emph{{Listeria monocytogenes}}. Nine housekeeping genes were analyzed in a set of 62 strains isolated from different sources and geographic locations in Spain. These strains were previously characterized by pulsed-field gel electrophoresis {(PFGE).} Because of low diversity, two loci were discarded from the study. The sequence analysis of the seven remaining genes showed 29 different allelic combinations, with 22 of them represented by only one strain. The results of this sequence analysis were generally consistent with those of {PFGE.} Because {MLST} allows the easy comparison and exchange of results obtained in different laboratories, the future application of this new molecular method could be a useful tool for the listeriosis surveillance systems that will allow the identification and distribution of analysis of \emph{{L. monocytogenes}} clones in the environment.},
number = {2},
journal = {Journal of Clinical Microbiology},
author = {Salcedo, C. and Arreaza, L. and Alcal\'{a}, B. and Fuente, L. de la and V\'{a}zquez, J. A.},
month = feb,
year = {2003},
pages = {757--762}
},
@article{kaplinski_multiplx:_2005,
title = {{MultiPLX:} automatic grouping and evaluation of {PCR} primers},
volume = {21},
issn = {1367-4803, 1460-2059},
shorttitle = {{MultiPLX}},
url = {http://bioinformatics.oxfordjournals.org/content/21/8/1701},
doi = {10.1093/bioinformatics/bti219},
abstract = {Summary: {MultiPLX} is a new program for automatic grouping of {PCR} primers. It can use many different parameters to estimate the compatibility of primers, such as primer–primer interactions, primer–product interactions, difference in melting temperatures, difference in product length and the risk of generating alternative products from the template. A unique feature of the {MultiPLX} is the ability to perform automatic grouping of large number (thousands) of primer pairs.
Availability: Binaries for Windows, Linux and Solaris are available from http://bioinfo.ebc.ee/download/. A graphical version with limited capabilities can be used through a web interface at http://bioinfo.ebc.ee/multiplx/. The source code of the program is available on request for academic users.
Contact: maido.remm@ut.ee},
number = {8},
journal = {Bioinformatics},
author = {Kaplinski, Lauris and Andreson, Reidar and Puurand, Tarmo and Remm, Maido},
month = apr,
year = {2005},
pages = {1701--1702}
},
@article{rozen_primer3_2000,
title = {Primer3 on the {WWW} for general users and for biologist programmers},
volume = {132},
issn = {1064-3745},
url = {http://www.ncbi.nlm.nih.gov/pubmed/10547847},
journal = {Methods in Molecular Biology {(Clifton}, {N.J.)}},
author = {Rozen, S and Skaletsky, H},
year = {2000},
note = {{PMID:} 10547847},
keywords = {Base Sequence, Database Management Systems, {DNA} Primers, Internet, Molecular Sequence Data, Polymerase Chain Reaction, Sequence Homology, Nucleic Acid, User-Computer Interface},
pages = {365--386}
},
@article{simpson_diversity_1949,
added-at = {2012-04-06T18:59:43.000+0200},
author = {Simpson, E.H.},
biburl = {http://www.bibsonomy.org/bibtex/2f7ae40323d65979da804d41dfb33f3b0/s-boutry},
groups = {private},
interhash = {da05cec7ed137594537004085194c0d6},
intrahash = {f7ae40323d65979da804d41dfb33f3b0},
journal = {Nature},
keywords = {jabref:noKeywordAssigned},
number = 4148,
pages = 688,
publisher = {Nature Publishing Group},
timestamp = {2012-04-06T18:59:43.000+0200},
title = {Measurement of diversity},
username = {s-boutry},
volume = 163,
year = 1949
},
@article{robinson_comparison_1981,
title = {Comparison of phylogenetic trees},
volume = {53},
issn = {0025-5564},
url = {http://www.sciencedirect.com/science/article/B6VHX-45F633S-10/2/4f48e7845ed373b5259ac20b666f6364},
doi = {10.1016/0025-5564(81)90043-2},
abstract = {A metric on general phylogenetic trees is presented. This extends the work of most previous authors, who constructed metrics for binary trees. The metric presented in this paper makes possible the comparison of the many nonbinary phylogenetic trees appearing in the literature. This provides an objective procedure for comparing the different methods for constructing phylogenetic trees. The metric is based on elementary operations which transform one tree into another. Various results obtained in applying these operations are given. They enable the distance between any pair of trees to be calculated efficiently. This generalizes previous work by Bourque to the case where interior vertices can be labeled, and labels may contain more than one element or may be empty.},
number = {1-2},
journal = {Mathematical Biosciences},
author = {Robinson, D. F. and Foulds, L. R.},
month = feb,
year = {1981},
pages = {131--147}
},
@inproceedings{sul_hashrf_2008,
author = {Sul, Seung-Jin and Brammer, Grant and Williams, Tiffani L.},
title = {Efficiently Computing Arbitrarily-Sized {Robinson-Foulds} Distance Matrices},
booktitle = {Proceedings of the 8th international workshop on Algorithms in Bioinformatics},
series = {WABI '08},
year = {2008},
isbn = {978-3-540-87360-0},
location = {Karlsruhe, Germany},
pages = {123--134},
numpages = {12},
url = {http://dx.doi.org/10.1007/978-3-540-87361-7_11},
doi = {10.1007/978-3-540-87361-7_11},
acmid = {1433576},
publisher = {Springer-Verlag},
address = {Berlin, Heidelberg},
keywords = {Robinson-Foulds distance, clustering, performance analysis, phylogenetic trees}
},
@article{sheneman_clearcut:_2006,
title = {Clearcut: a fast implementation of relaxed neighbor joining},
volume = {22},
issn = {1367-4803, 1460-2059},
shorttitle = {Clearcut},
url = {http://bioinformatics.oxfordjournals.org/content/22/22/2823},
doi = {10.1093/bioinformatics/btl478},
abstract = {Summary: Clearcut is an open source implementation for the relaxed neighbor joining {(RNJ)} algorithm. While traditional neighbor joining {(NJ)} remains a popular method for distance-based phylogenetic tree reconstruction, it suffers from a {O(N3)} time complexity, where N represents the number of taxa in the input. Due to this steep asymptotic time complexity, {NJ} cannot reasonably handle very large datasets. In contrast, {RNJ} realizes a typical-case time complexity on the order of {N2logN} without any significant qualitative difference in output. {RNJ} is particularly useful when inferring a very large tree or a large number of trees. In addition, {RNJ} retains the desirable property that it will always reconstruct the true tree given a matrix of additive pairwise distances. Clearcut implements {RNJ} as a C program, which takes either a set of aligned sequences or a pre-computed distance matrix as input and produces a phylogenetic tree. Alternatively, Clearcut can reconstruct phylogenies using an extremely fast standard {NJ} implementation.
Availability: Clearcut source code is available for download at: http://bioinformatics.hungry.com/clearcut
Contact:sheneman@hungry.com
Supplementary information:http://bioinformatics.hungry.com/clearcut},
number = {22},
journal = {Bioinformatics},
author = {Sheneman, Luke and Evans, Jason and Foster, James A.},
month = nov,
year = {2006},
pages = {2823--2824}
},
@misc{r_core_rlang_2012,
title = {R: A Language and Environment for Statistical Computing},
lccn = {{ISBN} 3-900051-07-0},
url = {http://www.R-project.org},
publisher = {R Foundation for Statistical Computing, Vienna, Austria},
author = {{{R} Core Team}},
year = {2012}
},
@article{saitou_neighbor_joining_1987,
title = {The neighbor-joining method: a new method for reconstructing phylogenetic trees},
volume = {4},
issn = {0737-4038},
shorttitle = {The neighbor-joining method},
url = {http://www.ncbi.nlm.nih.gov/pubmed/3447015},
abstract = {A new method called the neighbor-joining method is proposed for reconstructing phylogenetic trees from evolutionary distance data. The principle of this method is to find pairs of operational taxonomic units {(OTUs} [= neighbors]) that minimize the total branch length at each stage of clustering of {OTUs} starting with a starlike tree. The branch lengths as well as the topology of a parsimonious tree can quickly be obtained by using this method. Using computer simulation, we studied the efficiency of this method in obtaining the correct unrooted tree in comparison with that of five other tree-making methods: the unweighted pair group method of analysis, Farris's method, Sattath and Tversky's method, \emph{{Li's method,}} and Tateno et al.'s modified Farris method. The new, neighbor-joining method and Sattath and Tversky's method are shown to be generally better than the other methods.},
number = {4},
journal = {Molecular Biology and Evolution},
author = {Saitou, N and Nei, M},
month = jul,
year = {1987},
note = {{PMID:} 3447015},
keywords = {Animals, Biometry, Evolution, Models, Genetic, Phylogeny, Ranidae},
pages = {406--425}
},
@article{aziz_rast_2008,
title = {The {RAST} Server: rapid annotations using subsystems technology},
volume = {9},
issn = {1471-2164},
shorttitle = {The {RAST} Server},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18261238},
doi = {10.1186/1471-2164-9-75},
abstract = {{BACKGROUND}
The number of prokaryotic genome sequences becoming available is growing steadily and is growing faster than our ability to accurately annotate them.
{DESCRIPTION}
We describe a fully automated service for annotating bacterial and archaeal genomes. The service identifies protein-encoding, {rRNA} and {tRNA} genes, assigns functions to the genes, predicts which subsystems are represented in the genome, uses this information to reconstruct the metabolic network and makes the output easily downloadable for the user. In addition, the annotated genome can be browsed in an environment that supports comparative analysis with the annotated genomes maintained in the {SEED} environment. The service normally makes the annotated genome available within 12-24 hours of submission, but ultimately the quality of such a service will be judged in terms of accuracy, consistency, and completeness of the produced annotations. We summarize our attempts to address these issues and discuss plans for incrementally enhancing the service.
{CONCLUSION}
By providing accurate, rapid annotation freely to the community we have created an important community resource. The service has now been utilized by over 120 external users annotating over 350 distinct genomes.},
journal = {{BMC} Genomics},
author = {Aziz, Ramy K and Bartels, Daniela and Best, Aaron A and {DeJongh}, Matthew and Disz, Terrence and Edwards, Robert A and Formsma, Kevin and Gerdes, Svetlana and Glass, Elizabeth M and Kubal, Michael and Meyer, Folker and Olsen, Gary J and Olson, Robert and Osterman, Andrei L and Overbeek, Ross A and {McNeil}, Leslie K and Paarmann, Daniel and Paczian, Tobias and Parrello, Bruce and Pusch, Gordon D and Reich, Claudia and Stevens, Rick and Vassieva, Olga and Vonstein, Veronika and Wilke, Andreas and Zagnitko, Olga},
year = {2008},
note = {{PMID:} 18261238},
keywords = {Computational Biology, Databases, Nucleic Acid, Genes, {rRNA}, Genome, Archaeal, Genome, Bacterial, Open Reading Frames, Phylogeny, Proteins, Reproducibility of Results, {RNA}, Transfer, Sensitivity and Specificity, Time Factors, User-Computer Interface},
pages = {75}
},
@article{hall_pan-genome_2010,
title = {Pan-genome analysis provides much higher strain typing resolution than multi-locus sequence typing},
volume = {156},
issn = {1465-2080},
url = {http://www.ncbi.nlm.nih.gov/pubmed/20019077},
doi = {10.1099/mic.0.035188-0},
abstract = {The most widely used {DNA-based} method for bacterial strain typing, multi-locus sequence typing {(MLST)}, lacks sufficient resolution to distinguish among many bacterial strains within a species. Here, we show that strain typing based on the presence or absence of distributed genes is able to resolve all completely sequenced genomes of six bacterial species. This was accomplished by the development of a clustering method, neighbour grouping, which is completely consistent with the lower-resolution {MLST} method, but provides far greater resolving power. Because the presence/absence of distributed genes can be determined by low-cost microarray analyses, it offers a practical, high-resolution alternative to {MLST} that could provide valuable diagnostic and prognostic information for pathogenic bacterial species.},
number = {Pt 4},
journal = {Microbiology {(Reading}, England)},
author = {Hall, Barry G and Ehrlich, Garth D and Hu, Fen Z},
month = apr,
year = {2010},
note = {{PMID:} 20019077},
keywords = {Bacteria, Bacterial Typing Techniques, Genome, Bacterial, Molecular Sequence Data, Sequence Analysis, {DNA}},
pages = {1060--1068}
},
@ARTICLE{alcaraz_understanding_2010,
author = {Alcaraz, Luis David and Moreno-Hagelsieb, Gabriel and Eguiarte, Luis
E and Souza, Valeria and Herrera-Estrella, Luis and Olmedo, Gabriela},
title = {Understanding the evolutionary relationships and major traits of
\emph{Bacillus} through comparative genomics},
journal = {{BMC} Genomics},
year = {2010},
volume = {11},
pages = {332},
note = {{PMID:} 20504335},
abstract = {{BACKGROUND:} The presence of Bacillus in very diverse environments
reflects the versatile metabolic capabilities of a widely distributed
genus. Traditional phylogenetic analysis based on limited gene sampling
is not adequate for resolving the genus evolutionary relationships.
By distinguishing between core and pan-genome, we determined the
evolutionary and functional relationships of known Bacillus. {RESULTS:}
Our analysis is based upon twenty complete and draft Bacillus genomes,
including a newly sequenced Bacillus isolate from an aquatic environment
that we report for the first time here. Using a core genome, we were
able to determine the phylogeny of known Bacilli, including aquatic
strains whose position in the phylogenetic tree could not be unambiguously
determined in the past. Using the pan-genome from the sequenced Bacillus,
we identified functional differences, such as carbohydrate utilization
and genes involved in signal transduction, which distinguished the
taxonomic groups. We also assessed the genetic architecture of the
defining traits of Bacillus, such as sporulation and competence,
and showed that less than one third of the B. subtilis genes are
conserved across other Bacilli. Most variation was shown to occur
in genes that are needed to respond to environmental cues, suggesting
that Bacilli have genetically specialized to allow for the occupation
of diverse habitats and niches. {CONCLUSIONS:} The aquatic Bacilli
are defined here for the first time as a group through the phylogenetic
analysis of 814 genes that comprise the core genome. Our data distinguished
between genomic components, especially core vs. pan-genome to provide
insight into phylogeny and function that would otherwise be difficult
to achieve. A phylogeny may mask the diversity of functions, which
we tried to uncover in our approach. The diversity of sporulation
and competence genes across the Bacilli was unexpected based on previous
studies of the B. subtilis model alone. The challenge of uncovering
the novelties and variations among genes of the non-subtilis groups
still remains. This task will be best accomplished by directing efforts
toward understanding phylogenetic groups with similar ecological
niches.},
doi = {10.1186/1471-2164-11-332},
issn = {1471-2164},
keywords = {Bacillus, Evolution, Molecular, Genomics, Spores, Bacterial},
url = {http://www.ncbi.nlm.nih.gov/pubmed/20504335}
}
@ARTICLE{alm_genomic-sequence_1999,
author = {Alm, Richard A. and Ling, Lo-See L. and Moir, Donald T. and King,
Benjamin L. and Brown, Eric D. and Doig, Peter C. and Smith, Douglas
R. and Noonan, Brian and Guild, Braydon C. and {deJonge}, Boudewijn
L. and Carmel, Gilles and Tummino, Peter J. and Caruso, Anthony and
Uria-Nickelsen, Maria and Mills, Debra M. and Ives, Cameron and Gibson,
Rene and Merberg, David and Mills, Scott D. and Jiang, Qin and Taylor,
Diane E. and Vovis, Gerald F. and Trust, Trevor J.},
title = {Genomic-sequence comparison of two unrelated isolates of the human
gastric pathogen \emph{{Helicobacter pylori}}},
journal = {Nature},
year = {1999},
volume = {397},
pages = {176--180},
number = {6715},
month = jan,
doi = {10.1038/16495},
issn = {0028-0836},
url = {http://dx.doi.org/10.1038/16495}
}
@ARTICLE{altschul_basic_1990,
author = {Altschul, Stephen F. and Gish, Warren and Miller, Webb and Myers,
Eugene W. and Lipman, David J.},
title = {Basic local alignment search tool},
journal = {Journal of Molecular Biology},
year = {1990},
volume = {215},
pages = {403--410},
number = {3},
month = oct,
abstract = {A new approach to rapid sequence comparison, basic local alignment
search tool {(BLAST)}, directly approximates alignments that optimize
a measure of local similarity, the maximal segment pair {(MSP)} score.
Recent mathematical results on the stochastic properties of {MSP}
scores allow an analysis of the performance of this method as well
as the statistical significance of alignments it generates. The basic
algorithm is simple and robust; it can be implemented in a number
of ways and applied in a variety of contexts including straight-forward
{DNA} and protein sequence database searches, motif searches, gene
identification searches, and in the analysis of multiple regions
of similarity in long {DNA} sequences. In addition to its flexibility
and tractability to mathematical analysis, {BLAST} is an order of
magnitude faster than existing sequence comparison tools of comparable
sensitivity.},
annote = {{BLAST} paper},
doi = {10.1016/S0022-2836(05)80360-2},
issn = {0022-2836},
url = {http://www.sciencedirect.com/science/article/B6WK7-4N0J174-8/2/37c69feb1cd9b63368705c2f5f099c5b}
}
@ARTICLE{altschul_gapped_1997,
author = {Altschul, Stephen F. and Madden, Thomas L. and Sch\"{a}ffer, Alejandro
A. and Zhang, Jinghui and Zhang, Zheng and Miller, Webb and Lipman,
David J.},
title = {Gapped {BLAST} and {PSI-BLAST:} a new generation of protein database
search programs},
journal = {Nucleic Acids Research},
year = {1997},
volume = {25},
pages = {3389 --3402},
number = {17},
abstract = {The {BLAST} programs are widely used tools for searching protein and
{DNA} databases for sequence similarities. For protein comparisons,
a variety of definitional, algorithmic and statistical refinements
described here permits the execution time of the {BLAST} programs
to be decreased substantially while enhancing their sensitivity to
weak similarities. A new criterion for triggering the extension of
word hits, combined with a new heuristic for generating gapped alignments,
yields a gapped {BLAST} program that runs at approximately three
times the speed of the original. In addition, a method is introduced
for automatically combining statistically significant alignments
produced by {BLAST} into a position-specific score matrix, and searching
the database using this matrix. The resulting Position-Specific Iterated
{BLAST} {(PSIBLAST)} program runs at approximately the same speed
per iteration as gapped {BLAST}, but in many cases is much more sensitive
to weak but biologically relevant sequence similarities. {PSI-BLAST}
is used to uncover several new and interesting members of the {BRCT}
superfamily.},
doi = {10.1093/nar/25.17.3389},
shorttitle = {Gapped {BLAST} and {PSI-BLAST}},
url = {http://nar.oxfordjournals.org/content/25/17/3389.abstract}
}
@ARTICLE{arakawa_g-language_2003,
author = {Arakawa, K and Mori, K and Ikeda, K and Matsuzaki, T and Kobayashi,
Y and Tomita, M},
title = {G-language Genome Analysis Environment: a workbench for nucleotide
sequence data mining},
journal = {Bioinformatics {(Oxford}, England)},
year = {2003},
volume = {19},
pages = {305--306},
number = {2},
month = jan,
note = {{PMID:} 12538262},
abstract = {{SUMMARY:} G-language Genome Analysis Environment {(G-language} {GAE)}
is an open source generic software package aimed for higher efficiency
in bioinformatics analysis. G-language {GAE} has an interface as
a set of Perl libraries for software development, and a graphical
user interface for easy manipulation. Both Windows and Linux versions
are available. {AVAILABILITY:} From http://www.g-language.org/ under
{GNU} General Public License. {CD-ROMs} are distributed freely in
major conferences.},
issn = {1367-4803},
keywords = {Database Management Systems, Databases, Nucleic Acid, Genome, Hypermedia,
Information Storage and Retrieval, Sequence Alignment, Sequence Analysis,
{DNA}, Software, User-Computer Interface},
shorttitle = {G-language Genome Analysis Environment},
url = {http://www.ncbi.nlm.nih.gov/pubmed/12538262}
}
@ARTICLE{atherton_h._1998,
author = {Atherton, John C},
title = {\emph{{H. pylori}} virulence factors},
journal = {British Medical Bulletin},
year = {1998},
volume = {54},
pages = {105 --120},
number = {1},
month = jan,
abstract = {Among people infected with \emph{{Helicobacter pylori}}, the virulence of the
infecting strain is a major determinant of who develops disease.
Strains producing vacuolating cytotoxin activity are more commonly
isolated from people with peptic ulcers than without. The gene encoding
the toxin, {vacA} varies between strains, especially in its signal
sequence and mid regions. {vacA} genotype influences cytotoxin activity,
and signal sequence type correlates closely with peptic ulceration.
Infection with strains possessing {cagA} (cytotoxin associated gene
A) is more common among people with peptic ulceration or gastric
adenocarcinoma than without. {cagA} is a marker for the cag pathogenicity
island, which includes genes necessary for the enhanced inflammation
induced by pathogenic strains. Serological detection of infection
with {cagA+} strains is at present the best practical test for virulence.
However, before a strategy of screening and selective treatment can
be considered, it is important to assess whether {cagA-} strains
are entirely non-pathogenic.},
url = {http://bmb.oxfordjournals.org/content/54/1/105.abstract}
}
@ARTICLE{den_bakker_population_2010,
author = {den Bakker, Henk C and Bundrant, Brittany N and Fortes, Esther D
and Orsi, Renato H and Wiedmann, Martin},
title = {A population genetics-based and phylogenetic approach to understanding
the evolution of virulence in the genus \emph{{Listeria}}},
journal = {Applied and Environmental Microbiology},
year = {2010},
volume = {76},
pages = {6085--6100},
number = {18},
month = sep,
note = {{PMID:} 20656873},
abstract = {The genus \emph{{Listeria}} includes (i) the opportunistic pathogens \emph{{L. monocytogenes}}
and L. ivanovii, (ii) the saprotrophs L. innocua, \emph{{L. marthii,}} and
L. welshimeri, and (iii) L. seeligeri, an apparent saprotroph that
nevertheless typically contains the {prfA} virulence gene cluster.
A novel 10-loci multilocus sequence typing scheme was developed and
used to characterize 67 isolates representing six \emph{{Listeria}} spp. (excluding
L. grayi) in order to (i) provide an improved understanding of the
phylogeny and evolution of the genus \emph{{Listeria}} and (ii) use \emph{{Listeria}}
as a model to study the evolution of pathogenicity in opportunistic
environmental pathogens. Phylogenetic analyses identified six well-supported
Listeria species that group into two main subdivisions, with each
subdivision containing strains with and without the {prfA} virulence
gene cluster. Stochastic character mapping and phylogenetic analysis
of hly, a gene in the {prfA} cluster, suggest that the common ancestor
of the genus \emph{{Listeria}} contained the {prfA} virulence gene cluster
and that this cluster was lost at least five times during the evolution
of \emph{{Listeria}}, yielding multiple distinct saprotrophic clades. L. welshimeri,
which appears to represent the most ancient clade that arose from
an ancestor with a {prfA} cluster deletion, shows a considerably
lower average sequence divergence than other \emph{{Listeria}} species, suggesting
a population bottleneck and a putatively different ecology than other
saprotrophic \emph{{Listeria}} species. Overall, our data suggest that, for
some pathogens, loss of virulence genes may represent a selective
advantage, possibly by facilitating adaptation to a specific ecological
niche.},
doi = {10.1128/AEM.00447-10},
issn = {1098-5336},
lccn = {0000},
url = {http://www.ncbi.nlm.nih.gov/pubmed/20656873}
}
@ARTICLE{den_bakker_comparative_2010,
author = {den Bakker, Henk C and Cummings, Craig A and Ferreira, Vania and
Vatta, Paolo and Orsi, Renato H and Degoricija, Lovorka and Barker,
Melissa and Petrauskene, Olga and Furtado, Manohar R and Wiedmann,
Martin},
title = {Comparative genomics of the bacterial genus \emph{{Listeria}}: Genome evolution
is characterized by limited gene acquisition and limited gene loss},
journal = {{BMC} Genomics},
year = {2010},
volume = {11},
pages = {688},
note = {{PMID:} 21126366},
abstract = {{{\textless}AbstractText} {Label="BACKGROUND"} {NlmCategory="BACKGROUND"{\textgreater}The}
bacterial genus \emph{{Listeria}} contains pathogenic and non-pathogenic species,
including the pathogens \emph{{L. monocytogenes}} and L. ivanovii, both of
which carry homologous virulence gene clusters such as the {prfA}
cluster and clusters of internalin genes. Initial evidence for multiple
deletions of the {prfA} cluster during the evolution of \emph{{Listeria}}
indicates that this genus provides an interesting model for studying
the evolution of virulence and also presents practical challenges
with regard to definition of pathogenic {strains.{\textless}/AbstractText{\textgreater}}
{{\textless}AbstractText} {Label="RESULTS"} {NlmCategory="RESULTS"{\textgreater}To}
better understand genome evolution and evolution of virulence characteristics
in \emph{{Listeria}}, we used a next generation sequencing approach to generate
draft genomes for seven strains representing \emph{{Listeria}} species or
clades for which genome sequences were not available. Comparative
analyses of these draft genomes and six publicly available genomes,
which together represent the main \emph{{Listeria}} species, showed evidence
for (i) a pangenome with 2,032 core and 2,918 accessory genes identified
to date, (ii) a critical role of gene loss events in transition of
Listeria species from facultative pathogen to saprotroph, even though
a consistent pattern of gene loss seemed to be absent, and a number
of isolates representing non-pathogenic species still carried some
virulence associated genes, and (iii) divergence of modern pathogenic
and non-pathogenic \emph{{Listeria}} species and strains, most likely circa
47 million years ago, from a pathogenic common ancestor that contained
key virulence {genes.{\textless}/AbstractText{\textgreater}} {{\textless}AbstractText}
{Label="CONCLUSIONS"} {NlmCategory="CONCLUSIONS"{\textgreater}Genome}
evolution in \emph{{Listeria}} involved limited gene loss and acquisition
as supported by (i) a relatively high coverage of the predicted pan-genome
by the observed pan-genome, (ii) conserved genome size (between 2.8
and 3.2 Mb), and (iii) a highly syntenic genome. Limited gene loss
in \emph{{Listeria}} did include loss of virulence associated genes, likely
associated with multiple transitions to a saprotrophic lifestyle.
The genus \emph{{Listeria}} thus provides an example of a group of bacteria
that appears to evolve through a loss of virulence rather than acquisition
of virulence characteristics. While \emph{{Listeria}} includes a number of
species-like clades, many of these putative species include clades
or strains with atypical virulence associated characteristics. This
information will allow for the development of genetic and genomic
criteria for pathogenic strains, including development of assays
that specifically detect pathogenic \emph{{Listeria}} {strains.{\textless}/AbstractText{\textgreater}}},
doi = {10.1186/1471-2164-11-688},
issn = {1471-2164},
keywords = {Bacterial Proteins, Base Sequence, Bayes Theorem, Biological Clocks,
Caco-2 Cells, Chromosomes, Bacterial, Evolution, Molecular, Genes,
Bacterial, Genomics, Humans, \emph{{Listeria}}, Multigene Family, Phylogeny,
Plasmids, Polymorphism, Single Nucleotide, Reproducibility of Results,
Species Specificity, Virulence},
lccn = {0000},
shorttitle = {Comparative genomics of the bacterial genus \emph{{Listeria}}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/21126366}
}
@ARTICLE{den_bakker_lineage_2008,
author = {den Bakker, Henk C and Didelot, Xavier and Fortes, Esther D and Nightingale,
Kendra K and Wiedmann, Martin},
title = {Lineage specific recombination rates and microevolution in \emph{{Listeria
monocytogenes}}},
journal = {{BMC} Evolutionary Biology},
year = {2008},
volume = {8},
pages = {277},
note = {{PMID:} 18842152},
abstract = {{BACKGROUND:} The bacterium \emph{{Listeria monocytogenes}} is a saprotroph
as well as an opportunistic human foodborne pathogen, which has previously
been shown to consist of at least two widespread lineages (termed
lineages I and {II)} and an uncommon lineage (lineage {III).} While
some \emph{{L. monocytogenes}} strains show evidence for considerable diversification
by homologous recombination, our understanding of the contribution
of recombination to \emph{{L. monocytogenes}} evolution is still limited.
We therefore used {STRUCTURE} and {ClonalFrame}, two programs that
model the effect of recombination, to make inferences about the population
structure and different aspects of the recombination process in \emph{{L.
monocytogenes.}} Analyses were performed using sequences for seven
loci (including the house-keeping genes gap, prs, {purM} and {ribC},
the stress response gene {sigB}, and the virulence genes {actA} and
{inlA)} for 195 \emph{{L. monocytogenes}} isolates. {RESULTS:} Sequence analyses
with {ClonalFrame} and the Sawyer's test showed that recombination
is more prevalent in lineage {II} than lineage I and is most frequent
in two house-keeping genes {(ribC} and {purM)} and the two virulence
genes {(actA} and {inlA).} The relative occurrence of recombination
versus point mutation is about six times higher in lineage {II} than
in lineage I, which causes a higher genetic variability in lineage
{II.} Unlike lineage I, lineage {II} represents a genetically heterogeneous
population with a relatively high proportion (30\% average) of genetic
material imported from external sources. Phylograms, constructed
with correcting for recombination, as well as Tajima's D data suggest
that both lineages I and {II} have suffered a population bottleneck.
{CONCLUSION:} Our study shows that evolutionary lineages within a
single bacterial species can differ considerably in the relative
contributions of recombination to genetic diversification. Accounting
for recombination in phylogenetic studies is critical, and new evolutionary
models that account for the possibility of changes in the rate of
recombination would be required. While previous studies suggested
that only \emph{{L. monocytogenes}} lineage I has experienced a recent bottleneck,
our analyses clearly show that lineage {II} experienced a bottleneck
at about the same time, which was subsequently obscured by abundant
homologous recombination after the lineage {II} bottleneck. While
lineage I and lineage {II} should be considered separate species
from an evolutionary viewpoint, maintaining single species name may
be warranted since both lineages cause the same type of human disease.},
doi = {10.1186/1471-2148-8-277},
issn = {1471-2148},
keywords = {Animals, Bacterial Typing Techniques, Base Sequence, Computational
Biology, {DNA}, Bacterial, Evolution, Molecular, Genes, Bacterial,
Genetic Variation, Genetics, Population, Humans, \emph{{Listeria monocytogenes}},
Models, Genetic, Molecular Sequence Data, Phylogeny, Recombination,
Genetic, Sequence Analysis, {DNA}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18842152}
}
@ARTICLE{bakker_comparative_2010,
author = {Bakker, Henk C. den and Cummings, Craig A. and Ferreira, Vania and
Vatta, Paolo and Orsi, Renato H. and Degoricija, Lovorka and Barker,
Melissa and Petrauskene, Olga and Furtado, Manohar R. and Wiedmann,
Martin},
title = {Comparative genomics of the bacterial genus \emph{{Listeria}}: Genome evolution
is characterized by limited gene acquisition and limited gene loss},
journal = {{BMC} Genomics},
year = {2010},
volume = {11},
pages = {688},
number = {1},
month = dec,
abstract = {The bacterial genus \emph{{Listeria}} contains pathogenic and non-pathogenic
species, including the pathogens \emph{{L. monocytogenes}} and L. ivanovii,
both of which carry homologous virulence gene clusters such as the
{prfA} cluster and clusters of internalin genes. Initial evidence
for multiple deletions of the {prfA} cluster during the evolution
of \emph{{Listeria}} indicates that this genus provides an interesting model
for studying the evolution of virulence and also presents practical
challenges with regard to definition of pathogenic strains.},
copyright = {2010 den Bakker et al; licensee {BioMed} Central Ltd.},
doi = {10.1186/1471-2164-11-688},
issn = {1471-2164},
shorttitle = {Comparative genomics of the bacterial genus \emph{{Listeria}}},
url = {http://www.biomedcentral.com/1471-2164/11/688/abstract}
}
@ARTICLE{bennett_solexa_2004,
author = {Bennett, Simon},
title = {Solexa Ltd},
journal = {Pharmacogenomics},
year = {2004},
volume = {5},
pages = {433--438},
number = {4},
month = jun,
doi = {10.1517/14622416.5.4.433},
issn = {1462-2416},
url = {http://www.futuremedicine.com/doi/abs/10.1517/14622416.5.4.433}
}
@ARTICLE{bennett_toward_2005,
author = {Bennett, Simon T and Barnes, Colin and Cox, Anthony and Davies, Lisa
and Brown, Clive},
title = {Toward the \$1000 human genome},
journal = {Pharmacogenomics},
year = {2005},
volume = {6},
pages = {373--382},
number = {4},
month = jul,
doi = {10.1517/14622416.6.4.373},
issn = {1462-2416},
url = {http://www.futuremedicine.com/doi/abs/10.1517/14622416.6.4.373}
}
@ARTICLE{bentley_whole-genome_2006,
author = {Bentley, David R},
title = {Whole-genome re-sequencing},
journal = {Current Opinion in Genetics \& Development},
year = {2006},
volume = {16},
pages = {545--552},
number = {6},
month = dec,
abstract = {{DNA} sequencing can be used to gain important information on genes,
genetic variation and gene function for biological and medical studies.
The growing collection of publicly available reference genome sequences
will underpin a new era of whole genome re-sequencing, but sequencing
costs need to fall and throughput needs to rise by several orders
of magnitude. Novel technologies are being developed to meet this
need by generating massive amounts of sequence that can be aligned
to the reference sequence. The challenge is to maintain the high
standards of accuracy and completeness that are hallmarks of the
previous genome projects. One or more new sequencing technologies
are expected to become the mainstay of future research, and to make
{DNA} sequencing centre stage as a routine tool in genetic research
in the coming years.},
doi = {10.1016/j.gde.2006.10.009},
issn = {0959-{437X}},
url = {http://www.sciencedirect.com/science/article/B6VS0-4M4TNKN-1/2/1a34a6fe470a9150fc567aed39647f3b}
}
@ARTICLE{bentley_accurate_2008,
author = {Bentley, David R and Balasubramanian, Shankar and Swerdlow, Harold
P and Smith, Geoffrey P and Milton, John and Brown, Clive G and Hall,
Kevin P and Evers, Dirk J and Barnes, Colin L and Bignell, Helen
R and Boutell, Jonathan M and Bryant, Jason and Carter, Richard J
and Keira Cheetham, R and Cox, Anthony J and Ellis, Darren J and
Flatbush, Michael R and Gormley, Niall A and Humphray, Sean J and
Irving, Leslie J and Karbelashvili, Mirian S and Kirk, Scott M and
Li, Heng and Liu, Xiaohai and Maisinger, Klaus S and Murray, Lisa
J and Obradovic, Bojan and Ost, Tobias and Parkinson, Michael L and
Pratt, Mark R and Rasolonjatovo, Isabelle M J and Reed, Mark T and
Rigatti, Roberto and Rodighiero, Chiara and Ross, Mark T and Sabot,
Andrea and Sankar, Subramanian V and Scally, Aylwyn and Schroth,
Gary P and Smith, Mark E and Smith, Vincent P and Spiridou, Anastassia
and Torrance, Peta E and Tzonev, Svilen S and Vermaas, Eric H and
Walter, Klaudia and Wu, Xiaolin and Zhang, Lu and Alam, Mohammed
D and Anastasi, Carole and Aniebo, Ify C and Bailey, David M D and
Bancarz, Iain R and Banerjee, Saibal and Barbour, Selena G and Baybayan,
Primo A and Benoit, Vincent A and Benson, Kevin F and Bevis, Claire
and Black, Phillip J and Boodhun, Asha and Brennan, Joe S and Bridgham,
John A and Brown, Rob C and Brown, Andrew A and Buermann, Dale H
and Bundu, Abass A and Burrows, James C and Carter, Nigel P and Castillo,
Nestor and Chiara E Catenazzi, Maria and Chang, Simon and Neil Cooley,
R and Crake, Natasha R and Dada, Olubunmi O and Diakoumakos, Konstantinos
D and Dominguez-Fernandez, Belen and Earnshaw, David J and Egbujor,
Ugonna C and Elmore, David W and Etchin, Sergey S and Ewan, Mark
R and Fedurco, Milan and Fraser, Louise J and Fuentes Fajardo, Karin
V and Scott Furey, W and George, David and Gietzen, Kimberley J and
Goddard, Colin P and Golda, George S and Granieri, Philip A and Green,
David E and Gustafson, David L and Hansen, Nancy F and Harnish, Kevin
and Haudenschild, Christian D and Heyer, Narinder I and Hims, Matthew
M and Ho, Johnny T and Horgan, Adrian M and Hoschler, Katya and Hurwitz,
Steve and Ivanov, Denis V and Johnson, Maria Q and James, Terena
and Huw Jones, T A and Kang, Gyoung-Dong and Kerelska, Tzvetana H
and Kersey, Alan D and Khrebtukova, Irina and Kindwall, Alex P and
Kingsbury, Zoya and Kokko-Gonzales, Paula I and Kumar, Anil and Laurent,
Marc A and Lawley, Cynthia T and Lee, Sarah E and Lee, Xavier and
Liao, Arnold K and Loch, Jennifer A and Lok, Mitch and Luo, Shujun
and Mammen, Radhika M and Martin, John W and {McCauley}, Patrick
G and {McNitt}, Paul and Mehta, Parul and Moon, Keith W and Mullens,
Joe W and Newington, Taksina and Ning, Zemin and Ling Ng, Bee and
Novo, Sonia M and {O'Neill}, Michael J and Osborne, Mark A and Osnowski,
Andrew and Ostadan, Omead and Paraschos, Lambros L and Pickering,
Lea and Pike, Andrew C and Pike, Alger C and Chris Pinkard, D and
Pliskin, Daniel P and Podhasky, Joe and Quijano, Victor J and Raczy,
Come and Rae, Vicki H and Rawlings, Stephen R and Chiva Rodriguez,
Ana and Roe, Phyllida M and Rogers, John and Rogert Bacigalupo, Maria
C and Romanov, Nikolai and Romieu, Anthony and Roth, Rithy K and
Rourke, Natalie J and Ruediger, Silke T and Rusman, Eli and Sanches-Kuiper,
Raquel M and Schenker, Martin R and Seoane, Josefina M and Shaw,
Richard J and Shiver, Mitch K and Short, Steven W and Sizto, Ning
L and Sluis, Johannes P and Smith, Melanie A and Ernest Sohna Sohna,
Jean and Spence, Eric J and Stevens, Kim and Sutton, Neil and Szajkowski,
Lukasz and Tregidgo, Carolyn L and Turcatti, Gerardo and Vandevondele,
Stephanie and Verhovsky, Yuli and Virk, Selene M and Wakelin, Suzanne
and Walcott, Gregory C and Wang, Jingwen and Worsley, Graham J and
Yan, Juying and Yau, Ling and Zuerlein, Mike and Rogers, Jane and
Mullikin, James C and Hurles, Matthew E and {McCooke}, Nick J and
West, John S and Oaks, Frank L and Lundberg, Peter L and Klenerman,
David and Durbin, Richard and Smith, Anthony J},
title = {Accurate whole human genome sequencing using reversible terminator
chemistry},
journal = {Nature},
year = {2008},
volume = {456},
pages = {53--59},
number = {7218},
month = nov,
note = {{PMID:} 18987734},
abstract = {{DNA} sequence information underpins genetic research, enabling discoveries
of important biological or medical benefit. Sequencing projects have
traditionally used long (400-800 base pair) reads, but the existence
of reference sequences for the human and many other genomes makes
it possible to develop new, fast approaches to re-sequencing, whereby
shorter reads are compared to a reference to identify intraspecies
genetic variation. Here we report an approach that generates several
billion bases of accurate nucleotide sequence per experiment at low
cost. Single molecules of {DNA} are attached to a flat surface, amplified
in situ and used as templates for synthetic sequencing with fluorescent
reversible terminator deoxyribonucleotides. Images of the surface
are analysed to generate high-quality sequence. We demonstrate application
of this approach to human genome sequencing on flow-sorted X chromosomes
and then scale the approach to determine the genome sequence of a
male Yoruba from Ibadan, Nigeria. We build an accurate consensus
sequence from {\textgreater}30x average depth of paired 35-base reads.
We characterize four million single-nucleotide polymorphisms and
four hundred thousand structural variants, many of which were previously
unknown. Our approach is effective for accurate, rapid and economical
whole-genome re-sequencing and many other biomedical applications.},
annote = {illumina sequencing paper},
doi = {10.1038/nature07517},
issn = {1476-4687},
keywords = {Chromosomes, Human, X, Consensus Sequence, Genome, Human, Genomics,
Genotype, Humans, Male, Nigeria, Polymorphism, Single Nucleotide,
Sensitivity and Specificity, Sequence Analysis, {DNA}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18987734}
}
@ARTICLE{borucki_suspension_2005,
author = {Borucki, Monica K. and Reynolds, James and Call, Douglas R. and Ward,
Todd J. and Page, Brent and Kadushin, James},
title = {Suspension Microarray with Dendrimer Signal Amplification Allows
Direct and High-Throughput Subtyping of \emph{{Listeria monocytogenes}} from
Genomic {DNA}},
journal = {Journal of Clinical Microbiology},
year = {2005},
volume = {43},
pages = {3255--3259},
number = {7},
month = jul,
note = {{PMID:} 16000444 {PMCID:} 1169114},
abstract = {\emph{{Listeria monocytogenes}} is a significant cause of food-borne disease
and mortality; therefore, epidemiological investigations of this
pathogen require subtyping methods that are rapid, discriminatory,
and reproducible. Although conventional microarray subtyping analysis
has been shown to be both high resolution and genetically informative,
it is still relatively low throughput and technically challenging.
Suspension microarray technology eliminates the technical issues
associated with planar microarrays and allows high-throughput subtyping
of \emph{{L. monocytogenes}} strains. In this study, a suspension array assay
using dendrimer signal amplification allowed rapid and accurate serovar
identification of \emph{{L. monocytogenes}} strains using genomic {DNA} as
a target. The ability to subtype genomic {DNA} without {PCR} amplification
allows probes to be designed for many different regions within the
bacterial genome and should allow high-resolution subtyping not possible
with multiplex {PCR.}},
doi = {10.1128/JCM.43.7.3255-3259.2005},
issn = {0095-1137},
lccn = {0033}
}
@ARTICLE{briers_genome_2011,
author = {Briers, Yves and Klumpp, Jochen and Schuppler, Markus and Loessner,
Martin J},
title = {Genome sequence of \emph{{Listeria monocytogenes}} Scott A, a clinical isolate
from a food-borne listeriosis outbreak},
journal = {Journal of Bacteriology},
year = {2011},
volume = {193},
pages = {4284--4285},
number = {16},
month = aug,
note = {{PMID:} 21685277},
abstract = {\emph{{Listeria monocytogenes}} is an opportunistic food-borne pathogen and
the causative agent of listeriosis in animals and humans. We present
the genome sequence of \emph{{Listeria monocytogenes}} Scott A, a widely distributed
and frequently used serovar 4b clinical isolate from the 1983 listeriosis
outbreak in Massachusetts.},
doi = {10.1128/JB.05328-11},
issn = {1098-5530},
keywords = {Disease Outbreaks, Food Microbiology, Genome, Bacterial, Humans, \emph{{Listeria}}
monocytogenes, Listeriosis, Massachusetts, Molecular Sequence Data},
url = {http://www.ncbi.nlm.nih.gov/pubmed/21685277}
}
@ARTICLE{camacho_blast+:_2009,
author = {Camacho, Christiam and Coulouris, George and Avagyan, Vahram and
Ma, Ning and Papadopoulos, Jason and Bealer, Kevin and Madden, Thomas
L},
title = {{BLAST+:} architecture and applications},
journal = {{BMC} Bioinformatics},
year = {2009},
volume = {10},
pages = {421},
note = {{PMID:} 20003500},
abstract = {{BACKGROUND}
Sequence similarity searching is a very important bioinformatics task.
While Basic Local Alignment Search Tool {(BLAST)} outperforms exact
methods through its use of heuristics, the speed of the current {BLAST}
software is suboptimal for very long queries or database sequences.
There are also some shortcomings in the user-interface of the current
command-line applications.
{RESULTS}
We describe features and improvements of rewritten {BLAST} software
and introduce new command-line applications. Long query sequences
are broken into chunks for processing, in some cases leading to dramatically
shorter run times. For long database sequences, it is possible to
retrieve only the relevant parts of the sequence, reducing {CPU}
time and memory usage for searches of short queries against databases
of contigs or chromosomes. The program can now retrieve masking information
for database sequences from the {BLAST} databases. A new modular
software library can now access subject sequence data from arbitrary
data sources. We introduce several new features, including strategy
files that allow a user to save and reuse their favorite set of options.
The strategy files can be uploaded to and downloaded from the {NCBI}
{BLAST} web site.
{CONCLUSION}
The new {BLAST} command-line applications, compared to the current
{BLAST} tools, demonstrate substantial speed improvements for long
queries as well as chromosome length database sequences. We have
also improved the user interface of the command-line applications.},
doi = {10.1186/1471-2105-10-421},
issn = {1471-2105},
keywords = {Computational Biology, Databases, Genetic, Sequence Alignment, Software},
lccn = {0094},
shorttitle = {{BLAST+}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/20003500}
}
@ARTICLE{carpentier_review_2011,
author = {Carpentier, Brigitte and Cerf, Olivier},
title = {Review - Persistence of \emph{{Listeria monocytogenes}} in food industry
equipment and premises},
journal = {International Journal of Food Microbiology},
year = {2011},
volume = {145},
pages = {1--8},
number = {1},
month = jan,
abstract = {To understand why \emph{{Listeria monocytogenes}} may persist in food industry
equipment and premises, notably at low temperature, scientific studies
have so far focused on adhesion potential, biofilm forming ability,
resistance to desiccation, acid and heat, tolerance to increased
sublethal concentration of disinfectants or resistance to lethal
concentrations. Evidence from studies in processing plants shows
that the factors associated with the presence of \emph{{L. monocytogenes}}
are those that favor growth. Interestingly, most conditions promoting
bacterial growth were shown, in laboratory assays, to decrease adhesion
of \emph{{L. monocytogenes}} cells. Good growth conditions can be found in
so-called harborage sites, i.e. shelters due to unhygienic design
of equipment and premises or unhygienic or damaged materials. These
sites are hard to eliminate. A conceptual model of persistence/no
persistence based on the relative weight of growth vs. outcome of
cleaning and disinfection is suggested. It shows that a minimum initial
bacterial load is necessary for bacteria to persist in a harborage
site and that when a low initial bacterial charge is applied, early
cleaning and disinfection is the only way to avoid persistence. We
conclude by proposing that there are no strains of \emph{{L. monocytogenes}}
with unique properties that lead to persistence, but harborage sites
in food industry premises and equipment where \emph{{L. monocytogenes}} can
persist.},
doi = {10.1016/j.ijfoodmicro.2011.01.005},
issn = {0168-1605},
keywords = {Food Industry, \emph{{Listeria monocytogenes}}, Persistence},
url = {http://www.sciencedirect.com/science/article/pii/S0168160511000122}
}
@ARTICLE{carrico_illustration_2006,
author = {Carri\c{c}o, J. A. and Silva-Costa, C. and Melo-Cristino, J. and Pinto,
F. R. and de Lencastre, H. and Almeida, J. S. and Ramirez, M.},
title = {Illustration of a Common Framework for Relating Multiple Typing Methods
by Application to Macrolide-Resistant \emph{{Streptococcus pyogenes}}},
journal = {Journal of Clinical Microbiology},
year = {2006},
volume = {44},
pages = {2524--2532},
number = {7},
month = jul,
abstract = {The studies that correlate the results obtained by different typing
methodologies rely solely on qualitative comparisons of the groups
defined by each methodology. We propose a framework of measures for
the quantitative assessment of correspondences between different
typing methods as a first step to the global mapping of type equivalences.
A collection of 325 macrolide-resistant Streptococcus pyogenes isolates
associated with pharyngitis cases in Portugal was used to benchmark
the proposed measures. All isolates were characterized by macrolide
resistance phenotyping, T serotyping, emm sequence typing, and pulsed-field
gel electrophoresis {(PFGE)}, using {SmaI} or {Cfr9I} and {SfiI.}
A subset of 41 isolates, representing each {PFGE} cluster, was also
characterized by multilocus sequence typing {(MLST).} The application
of Adjusted Rand and Wallace indices allowed the evaluation of the
strength and the directionality of the correspondences between the
various typing methods and showed that if {PFGE} or {MLST} data are
available one can confidently predict the emm type {(Wallace} coefficients
of 0.952 for both methods). In contrast, emm typing was a poor predictor
of {PFGE} cluster or {MLST} sequence type {(Wallace} coefficients
of 0.803 and 0.655, respectively). This was confirmed by the analysis
of the larger data set available from http://spyogenes.mlst.net and
underscores the necessity of performing {PFGE} or {MLST} to unambiguously
define clones in S. pyogenes.},
doi = {10.1128/JCM.02536-05},
keywords = {Anti-Bacterial Agents, Antigens, Bacterial, Bacterial Outer Membrane
Proteins, Bacterial Typing Techniques, Carrier Proteins, Cluster
Analysis, Deoxyribonucleases, Type {II} Site-Specific, {DNA} Fingerprinting,
{DNA}, Bacterial, Drug Resistance, Bacterial, Electrophoresis, Gel,
Pulsed-Field, Humans, Macrolides, Microbial Sensitivity Tests, Pharyngitis,
Portugal, Sequence Analysis, {DNA}, Serotyping, Streptococcal Infections,
Streptococcus pyogenes},
lccn = {0037},
url = {http://jcm.asm.org/cgi/content/abstract/44/7/2524}
}
@ARTICLE{clark_surveillance_2010,
author = {Clark, C G and Farber, J and Pagotto, F and Ciampa, N and Dor\'{e},
K and Nadon, C and Bernard, K and Ng, L-K},
title = {Surveillance for \emph{{Listeria monocytogenes}} and listeriosis, 1995-2004},
journal = {Epidemiology and Infection},
year = {2010},
volume = {138},
pages = {559--572},
number = {4},
month = apr,
note = {{PMID:} 19818199},
abstract = {Canadian cases and outbreaks of illness caused by \emph{{Listeria monocytogenes}}
between 1995 and 2004 were assessed. Isolates (722 total) were characterized
by serotyping, and pulsed-field gel electrophoresis {(PFGE)} was
performed to provide a means of detecting case clusters. Rates of
listeriosis remained fairly consistent during the period of study,
and patient characteristics were similar to those seen in studies
of other populations. Most isolates were obtained from blood and
cerebrospinal fluid, although during some outbreak investigations
isolates were also obtained from stools. Serotype 1/2a predominated
in isolates from patients in Canada, followed by serotypes 4b and
1/2b. Outbreaks caused by \emph{{L. monocytogenes}} that occurred during the
period of study were caused by isolates with serotypes 1/2a and 4b.
A retrospective analysis of {PFGE} data uncovered several clusters
that might have represented undetected outbreaks, suggesting that
comprehensive prospective {PFGE} analysis coupled with prompt epidemiological
investigations might lead to improved outbreak detection and control.},
doi = {10.1017/S0950268809990914},
issn = {1469-4409},
keywords = {Adolescent, Adult, Aged, Aged, 80 and over, Bacterial Typing Techniques,
Blood, Canada, Cerebrospinal Fluid, Child, Child, Preschool, Cluster
Analysis, Disease Outbreaks, {DNA} Fingerprinting, Electrophoresis,
Gel, Pulsed-Field, Female, Genotype, Humans, Incidence, \emph{{Listeria}}
monocytogenes, Listeriosis, Male, Middle Aged, Retrospective Studies,
Serotyping, Young Adult},
lccn = {0002},
url = {http://www.ncbi.nlm.nih.gov/pubmed/19818199}
}
@ARTICLE{deng_probing_2010,
author = {Deng, Xiangyu and Phillippy, Adam M. and Li, Zengxin and Salzberg,
Steven L. and Zhang, Wei},
title = {Probing the pan-genome of \emph{{Listeria monocytogenes}}: new insights into
intraspecific niche expansion and genomic diversification},
journal = {{BMC} Genomics},
year = {2010},
volume = {11},
pages = {500},
number = {1},
month = sep,
abstract = {Bacterial pathogens often show significant intraspecific variations
in ecological fitness, host preference and pathogenic potential to
cause infectious disease. The species of \emph{{Listeria monocytogenes}},
a facultative intracellular pathogen and the causative agent of human
listeriosis, consists of at least three distinct genetic lineages.
Two of these lineages predominantly cause human sporadic and epidemic
infections, whereas the third lineage has never been implicated in
human disease outbreaks despite its overall conservation of many
known virulence factors.},
copyright = {2010 Deng et al; licensee {BioMed} Central Ltd.},
doi = {10.1186/1471-2164-11-500},
issn = {1471-2164},
shorttitle = {Probing the pan-genome of \emph{{Listeria monocytogenes}}},
url = {http://www.biomedcentral.com/1471-2164/11/500/abstract}
}
@ARTICLE{doumith_new_2004,
author = {Doumith, Michel and Cazalet, Christel and Simoes, Natalie and Frangeul,
Lionel and Jacquet, Christine and Kunst, Frank and Martin, Paul and
Cossart, Pascale and Glaser, Philippe and Buchrieser, Carmen},
title = {New Aspects Regarding Evolution and Virulence of \emph{{Listeria monocytogenes}}
Revealed by Comparative Genomics and {DNA} Arrays},
journal = {Infection and Immunity},
year = {2004},
volume = {72},
pages = {1072--1083},
number = {2},
month = feb,
note = {{PMID:} 14742555 {PMCID:} 321639},
abstract = {\emph{{Listeria monocytogenes}} is a food-borne bacterial pathogen that causes
a wide spectrum of diseases, such as meningitis, septicemia, abortion,
and gastroenteritis, in humans and animals. Among the 13 \emph{{L. monocytogenes}}
serovars described, invasive disease is mostly associated with serovar
4b strains. To investigate the genetic diversity of \emph{{L. monocytogenes}}
strains with different virulence potentials, we partially sequenced
an epidemic serovar 4b strain and compared it with the complete sequence
of the nonepidemic \emph{{L. monocytogenes}} {EGDe} serovar 1/2a strain. We
identified an unexpected genetic divergence between the two strains,
as about 8\% of the sequences were serovar 4b specific. These sequences
included seven genes coding for surface proteins, two of which belong
to the internalin family, and three genes coding for transcriptional
regulators, all of which might be important in different steps of
the infectious process. Based on the sequence information, we then
characterized the gene content of 113 \emph{{Listeria}} strains by using a
newly designed \emph{{Listeria}} array containing the “flexible� part
of the sequenced \emph{{Listeria}} genomes. Hybridization results showed that
all of the previously identified virulence factors of \emph{{L. monocytogenes}}
were present in the 93 \emph{{L. monocytogenes}} strains tested. However,
distinct patterns of the presence or absence of other genes were
identified among the different \emph{{L. monocytogenes}} serovars and \emph{{Listeria}}
species. These results allow new insights into the evolution of \emph{{L.
monocytogenes,}} suggesting that early divergence of the ancestral
\emph{{L. monocytogenes}} serovar 1/2c strains from the serovar 1/2b strains
led to two major phylogenetic lineages, one of them including the
serogroup 4 strains, which branched off the serovar 1/2b ancestral
lineage, leading (mostly by gene loss) to the species \emph{{Listeria}} innocua.
The identification of 30 \emph{{L. monocytogenes}}-specific and several serovar-specific
marker genes, such as three \emph{{L. monocytogenes}} serovar 4b-specific
surface protein-coding genes, should prove powerful for the rapid
tracing of listeriosis outbreaks, but it also represents a fundamental
basis for the functional study of virulence differences between \emph{{L.
monocytogenes}} strains.},
doi = {10.1128/IAI.72.2.1072-1083.2004},
issn = {0019-9567}
}
@ARTICLE{dramsi_fbpa_2004,
author = {Dramsi, S. and Bourdichon, F. and Cabanes, D. and Lecuit, M. and
Fsihi, H. and Cossart, P.},
title = {{FbpA}, a novel multifunctional \emph{{Listeria monocytogenes}} virulence
factor},
journal = {Molecular Microbiology},
year = {2004},
volume = {53},
pages = {639--649},
number = {2},
month = jun,
doi = {10.1111/j.1365-2958.2004.04138.x},
issn = {{0950382X}},
url = {http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2958.2004.04138.x/full}
}
@ARTICLE{ducey_single-nucleotide-polymorphism-based_2007,
author = {Ducey, Thomas F and Page, Brent and Usgaard, Thomas and Borucki,
Monica K and Pupedis, Kitty and Ward, Todd J},
title = {A single-nucleotide-polymorphism-based multilocus genotyping assay
for subtyping lineage I isolates of \emph{{Listeria monocytogenes}}},
journal = {Applied and Environmental Microbiology},
year = {2007},
volume = {73},
pages = {133--147},
number = {1},
month = jan,
note = {{PMID:} 17085705},
abstract = {\emph{{Listeria monocytogenes}} is a facultative intracellular pathogen responsible
for food-borne disease with high mortality rates in humans and is
the leading microbiological cause of food recalls. Lineage I isolates
of \emph{{L. monocytogenes}} are a particular public health concern because
they are responsible for most sporadic cases of listeriosis and the
vast majority of epidemic outbreaks. Rapid, reproducible, and sensitive
methods for differentiating pathogens below the species level are
required for effective pathogen control programs, and the {CDC} {PulseNet}
Task Force has called for the development and validation of {DNA}
sequence-based methods for subtyping food-borne pathogens. Therefore,
we developed a multilocus genotyping {(MLGT)} assay for \emph{{L. monocytogenes}}
lineage I isolates based on nucleotide variation identified by sequencing
23,251 bp of {DNA} from 22 genes distributed across seven genomic
regions in 65 \emph{{L. monocytogenes}} isolates. This single-well assay of
60 allele-specific probes captured 100\% of the haplotype information
contained in approximately 1.5 Mb of comparative {DNA} sequence and
was used to reproducibly type a total of 241 lineage I isolates.
The {MLGT} assay provided high discriminatory power {(Simpson's}
index value, 0.91), uniquely identified isolates from the eight listeriosis
outbreaks examined, and differentiated serotypes 1/2b and 4b as well
as epidemic clone I {(ECI)}, {ECIa}, and {ECII.} In addition, the
assay included probes for a previously characterized truncation mutation
in {inlA}, providing for the identification of a specific virulence-attenuated
subtype. These results demonstrate that {MLGT} represents a significant
new tool for use in pathogen surveillance, outbreak detection, risk
assessment, population analyses, and epidemiological investigations.
{DNA} sequences were deposited in the {GenBank} database under accession
numbers {DQ} 812146 to {DQ} 812517, {DQ} 843664 to {DQ} 844598, and
{AY} 512391 to {AY} 512502.},
doi = {10.1128/AEM.01453-06},
issn = {0099-2240},
keywords = {Bacterial Proteins, Bacterial Typing Techniques, {DNA}, Bacterial,
Flow Cytometry, Foodborne Diseases, Genotype, Humans, \emph{{Listeria}} Infections,
\emph{{Listeria monocytogenes}}, Molecular Sequence Data, Polymorphism, Single
Nucleotide, Reproducibility of Results, Sequence Analysis, {DNA}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/17085705}
}
@ARTICLE{duong_comparative_2009,
author = {Duong, Tri and Konkel, Michael E},
title = {Comparative studies of \emph{{Campylobacter jejuni}} genomic diversity reveal
the importance of core and dispensable genes in the biology of this
enigmatic food-borne pathogen},
journal = {Current Opinion in Biotechnology},
year = {2009},
volume = {20},
pages = {158--165},
number = {2},
month = apr,
note = {{PMID:} 19346123},
abstract = {{MLST}, {DNA} microarrays, and genome sequencing has allowed for a
greater understanding of the metabolic capacity and epidemiology
of \emph{{Campylobacter jejuni}}. While strain-specific genes may provide
an isolate a selective advantage in environments and contribute to
the organism's pathogenicity, recent work indicates that \emph{{C. jejuni}}
pathogenicity is dictated by variations in the nucleotide sequence
of core genes. Challenges facing \emph{{C. jejuni}} researchers include determining
(a) the degree to which genomic diversity enables this bacterium
to persist in particular environments; (b) if \emph{{C. jejuni}} virulence
and disease severity can be predicted on the basis of genotype; (c)
the set of core and variable genes whose products contribute to virulence;
and (d) the genes in which nucleotide changes can affect a strain's
pathogenicity.},
doi = {10.1016/j.copbio.2009.03.004},
issn = {1879-0429},
keywords = {\emph{{Campylobacter jejuni}}, Food Microbiology, Genetic Variation, Genome,
Bacterial, Virulence},
url = {http://www.ncbi.nlm.nih.gov/pubmed/19346123}
}
@ARTICLE{edgar_muscle:_2004,
author = {Edgar, Robert C.},
title = {{MUSCLE:} multiple sequence alignment with high accuracy and high
throughput},
journal = {Nucleic Acids Research},
year = {2004},
volume = {32},
pages = {1792 --1797},
number = {5},
month = mar,
abstract = {We describe {MUSCLE}, a new computer program for creating multiple
alignments of protein sequences. Elements of the algorithm include
fast distance estimation using kmer counting, progressive alignment
using a new profile function we call the log�expectation score,
and refinement using tree�dependent restricted partitioning. The
speed and accuracy of {MUSCLE} are compared with {T�Coffee}, {MAFFT}
and {CLUSTALW} on four test sets of reference alignments: {BAliBASE},
{SABmark}, {SMART} and a new benchmark, {PREFAB.} {MUSCLE} achieves
the highest, or joint highest, rank in accuracy on each of these
sets. Without refinement, {MUSCLE} achieves average accuracy statistically
indistinguishable from {T�Coffee} and {MAFFT}, and is the fastest
of the tested methods for large numbers of sequences, aligning 5000
sequences of average length 350 in 7 min on a current desktop computer.
The {MUSCLE} program, source code and {PREFAB} test data are freely
available at http://www.drive5. com/muscle.},
doi = {10.1093/nar/gkh340},
keywords = {Algorithms, Amino Acid Motifs, Amino Acid Sequence, Internet, Molecular
Sequence Data, Reproducibility of Results, Sequence Alignment, Sequence
Analysis, Protein, Software, Time Factors},
lccn = {2682},
shorttitle = {{MUSCLE}},
url = {http://nar.oxfordjournals.org/content/32/5/1792.abstract}
}
@ARTICLE{fouts_major_2005,
author = {Fouts, Derrick E and Mongodin, Emmanuel F and Mandrell, Robert E
and Miller, William G and Rasko, David A and Ravel, Jacques and Brinkac,
Lauren M and {DeBoy}, Robert T and Parker, Craig T and Daugherty,
Sean C and Dodson, Robert J and Durkin, A Scott and Madupu, Ramana
and Sullivan, Steven A and Shetty, Jyoti U and Ayodeji, Mobolanle
A and Shvartsbeyn, Alla and Schatz, Michael C and Badger, Jonathan
H and Fraser, Claire M and Nelson, Karen E},
title = {Major structural differences and novel potential virulence mechanisms
from the genomes of multiple \emph{{Campylobacter}} species},
journal = {{PLoS} Biology},
year = {2005},
volume = {3},
pages = {e15},
number = {1},
month = jan,
note = {{PMID:} 15660156},
abstract = {Sequencing and comparative genome analysis of four strains of \emph{{Campylobacter}}
including C. lari {RM2100}, C. upsaliensis {RM3195}, and \emph{{C. coli}}
{RM2228} has revealed major structural differences that are associated
with the insertion of phage- and plasmid-like genomic islands, as
well as major variations in the lipooligosaccharide complex. Poly
G tracts are longer, are greater in number, and show greater variability
in C. upsaliensis than in the other species. Many genes involved
in host colonization, including {racR/S}, {cadF}, cdt, {ciaB}, and
flagellin genes, are conserved across the species, but variations
that appear to be species specific are evident for a lipooligosaccharide
locus, a capsular (extracellular) polysaccharide locus, and a novel
Campylobacter putative {licABCD} virulence locus. The strains also
vary in their metabolic profiles, as well as their resistance profiles
to a range of antibiotics. It is evident that the newly identified
hypothetical and conserved hypothetical proteins, as well as uncharacterized
two-component regulatory systems and membrane proteins, may hold
additional significant information on the major differences in virulence
among the species, as well as the specificity of the strains for
particular hosts.},
doi = {10.1371/journal.pbio.0030015},
issn = {1545-7885},
keywords = {Animals, Bacterial Proteins, Bird Diseases, Birds, \emph{{Campylobacter,}}
Cattle, Cattle Diseases, Genome, Bacterial, Likelihood Functions,
Molecular Sequence Data, Phylogeny, Sequence Alignment, Sequence
Homology, Amino Acid, Swine, Swine Diseases, Virulence},
url = {http://www.ncbi.nlm.nih.gov/pubmed/15660156}
}
@ARTICLE{freitag_listeria_2009,
author = {Freitag, Nancy E. and Port, Gary C. and Miner, Maurine D.},
title = {\emph{{Listeria monocytogenes}} -- from saprophyte to intracellular pathogen},
journal = {Nature Reviews Microbiology},
year = {2009},
volume = {7},
pages = {623--628},
number = {9},
month = sep,
abstract = {\emph{{Listeria monocytogenes}} is a bacterium that lives in the soil as a
saprophyte but is capable of making the transition into a pathogen
following its ingestion by susceptible humans or animals. Recent
studies suggest that \emph{{L. monocytogenes}} mediates its saprophyte-to-cytosolic-parasite
transition through the careful modulation of the activity of a virulence
regulatory protein known as {PrfA}, using a range of environmental
cues that include available carbon sources. In this Progress article
we describe the regulation of {PrfA} and its role in the \emph{{L. monocytogenes}}
transition from the saprophytic stage to the virulent intracellular
stage.},
copyright = {© 2009 Nature Publishing Group},
doi = {10.1038/nrmicro2171},
issn = {1740-1526},
url = {http://www.nature.com/nrmicro/journal/v7/n9/abs/nrmicro2171.html}
}
@ARTICLE{gotz_high-throughput_2008,
author = {G\"{o}tz, Stefan and Garc\'{i}a-G\'{o}mez, Juan Miguel and Terol, Javier and
Williams, Tim D and Nagaraj, Shivashankar H and Nueda, Mar\'{i}a Jos\'{e}
and Robles, Montserrat and Tal\'{o}n, Manuel and Dopazo, Joaqu\'{i}n and
Conesa, Ana},
title = {High-throughput functional annotation and data mining with the {Blast2GO}
suite},
journal = {Nucleic Acids Research},
year = {2008},
volume = {36},
pages = {3420--3435},
number = {10},
month = jun,
note = {{PMID:} 18445632},
abstract = {Functional genomics technologies have been widely adopted in the biological
research of both model and non-model species. An efficient functional
annotation of {DNA} or protein sequences is a major requirement for
the successful application of these approaches as functional information
on gene products is often the key to the interpretation of experimental
results. Therefore, there is an increasing need for bioinformatics
resources which are able to cope with large amount of sequence data,
produce valuable annotation results and are easily accessible to
laboratories where functional genomics projects are being undertaken.
We present the {Blast2GO} suite as an integrated and biologist-oriented
solution for the high-throughput and automatic functional annotation
of {DNA} or protein sequences based on the Gene Ontology vocabulary.
The most outstanding {Blast2GO} features are: (i) the combination
of various annotation strategies and tools controlling type and intensity
of annotation, (ii) the numerous graphical features such as the interactive
{GO-graph} visualization for gene-set function profiling or descriptive
charts, (iii) the general sequence management features and (iv) high-throughput
capabilities. We used the {Blast2GO} framework to carry out a detailed
analysis of annotation behaviour through homology transfer and its
impact in functional genomics research. Our aim is to offer biologists
useful information to take into account when addressing the task
of functionally characterizing their sequence data.},
doi = {10.1093/nar/gkn176},
issn = {1362-4962},
keywords = {Animals, Computational Biology, Computer Graphics, Databases, Genetic,
Expressed Sequence Tags, Genes, Genomics, Sequence Analysis, {DNA},
Sequence Analysis, Protein, Software, Vocabulary, Controlled},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18445632}
}
@ARTICLE{gentleman_bioconductor:_2004,
author = {Gentleman, Robert C and Carey, Vincent J and Bates, Douglas M and
Bolstad, Ben and Dettling, Marcel and Dudoit, Sandrine and Ellis,
Byron and Gautier, Laurent and Ge, Yongchao and Gentry, Jeff and
Hornik, Kurt and Hothorn, Torsten and Huber, Wolfgang and Iacus,
Stefano and Irizarry, Rafael and Leisch, Friedrich and Li, Cheng
and Maechler, Martin and Rossini, Anthony J and Sawitzki, Gunther
and Smith, Colin and Smyth, Gordon and Tierney, Luke and Yang, Jean
Y H and Zhang, Jianhua},
title = {Bioconductor: open software development for computational biology
and bioinformatics},
journal = {Genome Biology},
year = {2004},
volume = {5},
pages = {R80},
number = {10},
note = {{PMID:} 15461798},
abstract = {The Bioconductor project is an initiative for the collaborative creation
of extensible software for computational biology and bioinformatics.
The goals of the project include: fostering collaborative development
and widespread use of innovative software, reducing barriers to entry
into interdisciplinary scientific research, and promoting the achievement
of remote reproducibility of research results. We describe details
of our aims and methods, identify current challenges, compare Bioconductor
to other open bioinformatics projects, and provide working examples.},
doi = {10.1186/gb-2004-5-10-r80},
issn = {1465-6914},
keywords = {Computational Biology, Internet, Reproducibility of Results, Software},
shorttitle = {Bioconductor},
url = {http://www.ncbi.nlm.nih.gov/pubmed/15461798}
}
@ARTICLE{gerner-smidt_pulsenet_2006,
author = {Gerner-Smidt, P. and Hise, K. and Kincaid, J. and Hunter, S. and
Rolando, S. and Hyytia-Trees, E. and Ribot, {E.M.} and Swaminathan,
B. and {{Pulsenet} Taskforce}},
title = {{PulseNet} {USA:} A Five-Year Update},
journal = {Foodborne Pathogens and Disease},
year = {2006},
volume = {3},
pages = {9--19},
number = {1},
month = mar,
doi = {10.1089/fpd.2006.3.9},
issn = {1535-3141},
keywords = {Bacterial Typing Techniques, Bioterrorism, \emph{{Campylobacter,}} Databases,
Factual, Disease Outbreaks, {DNA}, Bacterial, Electrophoresis, Gel,
Pulsed-Field, \emph{{Escherichia coli}} {O157}, Food Microbiology, Humans, \emph{{Listeria}}
monocytogenes, Population Surveillance, Public Health, Salmonella
enterica, Shigella, United States},
shorttitle = {{PulseNet} {USA}},
url = {http://www.liebertonline.com/doi/abs/10.1089/fpd.2006.3.9}
}
@ARTICLE{glaser_comparative_2001,
author = {Glaser, P. and Frangeul, L. and Buchrieser, C. and Rusniok, C. and
Amend, A. and Baquero, F. and Berche, P. and Bloecker, H. and Brandt,
P. and Chakraborty, T. and Charbit, A. and Chetouani, F. and Couve,
E. and de Daruvar, A. and Dehoux, P. and Domann, E. and Dominguez-Bernal,
G. and Duchaud, E. and Durant, L. and Dussurget, O. and Entian, K.-D.
and Fsihi, H. and Portillo, F. Garcia-Del and Garrido, P. and Gautier,
L. and Goebel, W. and Gomez-Lopez, N. and Hain, T. and Hauf, J. and
Jackson, D. and Jones, L.-M. and Kaerst, U. and Kreft, J. and Kuhn,
M. and Kunst, F. and Kurapkat, G. and Madueno, E. and Maitournam,
A. and Vicente, J. Mata and Ng, E. and Nedjari, H. and Nordsiek,
G. and Novella, S. and de Pablos, B. and Perez-Diaz, J.-C. and Purcell,
R. and Remmel, B. and Rose, M. and Schlueter, T. and Simoes, N. and
Tierrez, A. and Vazquez-Boland, J.-A. and Voss, H. and Wehland, J.
and Cossart, P.},
title = {Comparative Genomics of \emph{{Listeria}} Species},
journal = {Science},
year = {2001},
volume = {294},
pages = {849--852},
number = {5543},
month = oct,
doi = {10.1126/science.1063447},
url = {http://www.sciencemag.org/cgi/content/abstract/294/5543/849}
}
@ARTICLE{gundogdu_re-annotation_2007,
author = {Gundogdu, Ozan and Bentley, Stephen D and Holden, Matt T and Parkhill,
Julian and Dorrell, Nick and Wren, Brendan W},
title = {Re-annotation and re-analysis of the \emph{{Campylobacter jejuni}} {NCTC11168}
genome sequence},
journal = {{BMC} Genomics},
year = {2007},
volume = {8},
pages = {162},
note = {{PMID:} 17565669},
abstract = {{{\textless}AbstractText} {Label="BACKGROUND"} {NlmCategory="BACKGROUND"{\textgreater}Campylobacter}
jejuni is the leading bacterial cause of human gastroenteritis in
the developed world. To improve our understanding of this important
human pathogen, the \emph{{C. jejuni}} {NCTC11168} genome was sequenced and
published in 2000. The original annotation was a milestone in \emph{{Campylobacter}}
research, but is outdated. We now describe the complete re-annotation
and re-analysis of the \emph{{C. jejuni}} {NCTC11168} genome using current
database information, novel tools and annotation techniques not used
during the original {annotation.{\textless}/AbstractText{\textgreater}}
{{\textless}AbstractText} {Label="RESULTS"} {NlmCategory="RESULTS"{\textgreater}Re-annotation}
was carried out using sequence database searches such as {FASTA},
along with programs such as {TMHMM} for additional support. The re-annotation
also utilises sequence data from additional \emph{{Campylobacter}} strains
and species not available during the original annotation. Re-annotation
was accompanied by a full literature search that was incorporated
into the updated {EMBL} file {[EMBL:} {AL111168].} The \emph{{C. jejuni}}
{NCTC11168} re-annotation reduced the total number of coding sequences
from 1654 to 1643, of which 90.0\% have additional information regarding
the identification of new motifs and/or relevant literature. Re-annotation
has led to 18.2\% of coding sequence product functions being {revised.{\textless}/AbstractText{\textgreater}}
{{\textless}AbstractText} {Label="CONCLUSIONS"} {NlmCategory="CONCLUSIONS"{\textgreater}Major}
updates were made to genes involved in the biosynthesis of important
surface structures such as lipooligosaccharide, capsule and both
O- and N-linked glycosylation. This re-annotation will be a key resource
for \emph{{Campylobacter}} research and will also provide a prototype for
the re-annotation and re-interpretation of other bacterial {genomes.{\textless}/AbstractText{\textgreater}}},
doi = {10.1186/1471-2164-8-162},
issn = {1471-2164},
keywords = {\emph{{Campylobacter jejuni}}, Genes, Bacterial, Genome, Bacterial, Open Reading
Frames, Pseudogenes, Reproducibility of Results, Sequence Analysis,
{DNA}},
lccn = {0000},
url = {http://www.ncbi.nlm.nih.gov/pubmed/17565669}
}
@ARTICLE{hain_comparative_2012,
author = {Hain, Torsten and Ghai, Rohit and Billion, Andre and Kuenne, Carsten
Tobias and Steinweg, Christiane and Izar, Benjamin and Mohamed, Walid
and Mraheil, Mobarak and Domann, Eugen and Schaffrath, Silke and
K\"{a}rst, Uwe and Goesmann, Alexander and Oehm, Sebastian and Pühler,
Alfred and Merkl, Rainer and Vorwerk, Sonja and Glaser, Philippe
and Garrido, Patricia and Rusniok, Christophe and Buchrieser, Carmen
and Goebel, Werner and Chakraborty, Trinad},
title = {Comparative genomics and transcriptomics of lineages I, {II}, and
{III} strains of \emph{{Listeria monocytogenes}}},
journal = {{BMC} Genomics},
year = {2012},
volume = {13},
pages = {144},
number = {1},
month = apr,
abstract = {\emph{{Listeria monocytogenes}} is a food-borne pathogen that causes infections
with a high-mortality rate and has served as an invaluable model
for intracellular parasitism. Here, we report complete genome sequences
for two \emph{{L. monocytogenes}} strains belonging to serotype 4a {(L99)}
and 4b {(CLIP80459)}, and transcriptomes of representative strains
from lineages I, {II}, and {III}, thereby permitting in-depth comparison
of genome- and transcriptome -based data from three lineages of \emph{{L.
monocytogenes.}} Lineage {III}, represented by the 4a L99 genome is
known to contain strains less virulent for humans.},
copyright = {http://creativecommons.org/licenses/by/2.0/},
doi = {10.1186/1471-2164-13-144},
issn = {1471-2164},
url = {http://www.biomedcentral.com/1471-2164/13/144/abstract}
}
@ARTICLE{hain_comparative_2006,
author = {Hain, Torsten and Steinweg, Christiane and Chakraborty, Trinad},
title = {Comparative and functional genomics of \emph{{Listeria}} spp},
journal = {Journal of Biotechnology},
year = {2006},
volume = {126},
pages = {37--51},
number = {1},
month = oct,
note = {{PMID:} 16757050},
abstract = {The genus \emph{{Listeria}} comprises a group of non-sporulating, Gram-positive,
soil bacteria belonging to the low {G+C} group of microorganisms.
The genus consists of only six species, \emph{{L. monocytogenes}}, L. ivanovii,
L. seeligeri, L. innocua, L. welshimeri, and L. {grayi.L.} monocytogenes
and L. ivanovii are the only known pathogens of this group. Comparative
whole-genome sequencing of representative strains comprising the
entire genus is currently being performed and nearing completion.
In the genus \emph{{Listeria}}, genome reduction has led to the generation
of non-pathogenic species from pathogenic progenitor strains. Indeed,
many of the regions absent in the non-pathogenic species represent
commonly deleted genes. Speciation and diversity of strains has been
achieved by horizontal gene transfer of {DNA} encoding novel genes
probably required for niche specific survival. The sequencing of
several listerial genomes has also been accompanied by studies using
global strategies involving whole-genome transcriptional profiling
and proteomics to examine the adaptative changes of \emph{{L. monocytogenes}}
to growth in different environments and to catalogue the genes mediating
these responses. We review this data and present information on the
expression profile of \emph{{L. monocytogenes}} {EGD-e} inside the vacuolar
and the cytosolic environments of the host cell using whole-genome
microarray analysis. Of the 484 genes regulated during intracellular
growth 41 genes are species-specific, being absent from the genome
of the non-pathogenic L. innocua {CLIP} 11262 strain. There were
25 genes that are strain-specific i.e. absent from the genome of
the \emph{{L. monocytogenes}} F2365 serotype 4b strain suggesting heterogeneity
in the gene pool required for intracellular survival of \emph{{L. monocytogenes}}
in host cells.},
doi = {10.1016/j.jbiotec.2006.03.047},
issn = {0168-1656},
keywords = {Chromosomes, Bacterial, Gene Expression Profiling, Genomic Library,
Listeria, Oligonucleotide Array Sequence Analysis, Phylogeny, Proteomics,
Virulence},
lccn = {0029},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16757050}
}
@ARTICLE{harmsen_role_2010,
author = {Harmsen, Morten and Lappann, Martin and Knøchel, Susanne and Molin,
Søren},
title = {Role of Extracellular {DNA} during Biofilm Formation by \emph{{Listeria
monocytogenes}}},
journal = {Applied and Environmental Microbiology},
year = {2010},
volume = {76},
pages = {2271--2279},
number = {7},
month = apr,
abstract = {\emph{{Listeria monocytogenes}} is a food-borne pathogen that is capable of
living in harsh environments. It is believed to do this by forming
biofilms, which are surface-associated multicellular structures encased
in a self-produced matrix. In this paper we show that in \emph{{L. monocytogenes}}
extracellular {DNA} {(eDNA)} may be the only central component of
the biofilm matrix and that it is necessary for both initial attachment
and early biofilm formation for 41 \emph{{L. monocytogenes}} strains that
were tested. {DNase} I treatment resulted in dispersal of biofilms,
not only in microtiter tray assays but also in flow cell biofilm
assays. However, it was also demonstrated that in a culture without
{eDNA}, neither \emph{{Listeria}} genomic {DNA} nor salmon sperm {DNA} by
itself could restore the capacity to adhere. A search for additional
necessary components revealed that peptidoglycan {(PG)}, specifically
N-acetylglucosamine {(NAG)}, interacted with the {DNA} in a manner
which restored adhesion. If a short {DNA} fragment (less than approximately
500 bp long) was added to an {eDNA-free} culture prior to addition
of genomic or salmon sperm {DNA}, adhesion was prevented, indicating
that high-molecular-weight {DNA} is required for adhesion and that
the number of attachment sites on the cell surface can be saturated.},
doi = {10.1128/AEM.02361-09},
issn = {0099-2240, 1098-5336},
url = {http://aem.asm.org/content/76/7/2271}
}
@ARTICLE{hayashi_complete_2001,
author = {Hayashi, Tetsuya and Makino, Kozo and Ohnishi, Makoto and Kurokawa,
Ken and Ishii, Kazuo and Yokoyama, Katsushi and Han, Chang-Gyun and
Ohtsubo, Eiichi and Nakayama, Keisuke and Murata, Takahiro and Tanaka,
Masashi and Tobe, Toru and Iida, Tetsuya and Takami, Hideto and Honda,
Takeshi and Sasakawa, Chihiro and Ogasawara, Naotake and Yasunaga,
Teruo and Kuhara, Satoru and Shiba, Tadayoshi and Hattori, Masahira
and Shinagawa, Hideo},
title = {Complete Genome Sequence of Enterohemorrhagic \emph{{Eschelichia coli}} {{O157}:H7}
and Genomic Comparison with a Laboratory Strain {K-12}},
journal = {{DNA} Research},
year = {2001},
volume = {8},
pages = {11 --22},
number = {1},
month = jan,
abstract = {\emph{{Escherichia coli}} {{O157}:H7} is a major food-borne infectious pathogen
that causes diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome.
Here we report the complete chromosome sequence of an {{O157}:H7} strain
isolated from the Sakai outbreak, and the results of genomic comparison
with a benign laboratory strain, K-12 {MG1655.} The chromosome is
5.5 Mb in size, 859 Kb larger than that of K-12. We identified a
4.1-Mb sequence highly conserved between the two strains, which may
represent the fundamental backbone of the \emph{{E. coli}} chromosome. The
remaining 1.4-Mb sequence comprises of {{O157}:H7-specific} sequences,
most of which are horizontally transferred foreign {DNAs.} The predominant
roles of bacteriophages in the emergence of {{O157}:H7} is evident
by the presence of 24 prophages and prophage-like elements that occupy
more than half of the {{O157}:H7-specific} sequences. The {{O157}:H7}
chromosome encodes 1632 proteins and 20 {tRNAs} that are not present
in K-12. Among these, at least 131 proteins are assumed to have virulence-related
functions. Genome-wide codon usage analysis suggested that the {{O157}:H7-specific}
{tRNAs} are involved in the efficient expression of the strain-specific
genes. A complete set of the genes specific to {{O157}:H7} presented
here sheds new insight into the pathogenicity and the physiology
of {{O157}:H7}, and will open a way to fully understand the molecular
mechanisms underlying the {{O157}:H7} infection.},
doi = {10.1093/dnares/8.1.11},
shorttitle = {Complete Genome Sequence of Enterohemorrhagic \emph{{Eschelichia coli}} {O157}},
url = {http://dnaresearch.oxfordjournals.org/content/8/1/11.abstract}
}
@ARTICLE{hoelzer_listeria_2012,
author = {Hoelzer, Karin and Pouillot, R\'{e}gis and Dennis, Sherri},
title = {\emph{{Listeria monocytogenes}} Growth Dynamics on Produce: A Review of the
Available Data for Predictive Modeling},
journal = {Foodborne Pathogens and Disease},
year = {2012},
pages = {120521111006006},
month = may,
doi = {10.1089/fpd.2011.1087},
issn = {1535-3141, 1556-7125},
shorttitle = {\emph{{Listeria monocytogenes}} Growth Dynamics on Produce},
url = {http://online.liebertpub.com/doi/abs/10.1089/fpd.2011.1087}
}
@ARTICLE{huson_application_2006,
author = {Huson, Daniel H and Bryant, David},
title = {Application of phylogenetic networks in evolutionary studies},
journal = {Molecular Biology and Evolution},
year = {2006},
volume = {23},
pages = {254--267},
number = {2},
month = feb,
note = {{PMID:} 16221896},
abstract = {The evolutionary history of a set of taxa is usually represented by
a phylogenetic tree, and this model has greatly facilitated the discussion
and testing of hypotheses. However, it is well known that more complex
evolutionary scenarios are poorly described by such models. Further,
even when evolution proceeds in a tree-like manner, analysis of the
data may not be best served by using methods that enforce a tree
structure but rather by a richer visualization of the data to evaluate
its properties, at least as an essential first step. Thus, phylogenetic
networks should be employed when reticulate events such as hybridization,
horizontal gene transfer, recombination, or gene duplication and
loss are believed to be involved, and, even in the absence of such
events, phylogenetic networks have a useful role to play. This article
reviews the terminology used for phylogenetic networks and covers
both split networks and reticulate networks, how they are defined,
and how they can be interpreted. Additionally, the article outlines
the beginnings of a comprehensive statistical framework for applying
split network methods. We show how split networks can represent confidence
sets of trees and introduce a conservative statistical test for whether
the conflicting signal in a network is treelike. Finally, this article
describes a new program, {SplitsTree4}, an interactive and comprehensive
tool for inferring different types of phylogenetic networks from
sequences, distances, and trees.},
doi = {10.1093/molbev/msj030},
issn = {0737-4038},
keywords = {Animals, Evolution, Molecular, Models, Genetic, Phylogeny},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16221896}
}
@ARTICLE{israel_helicobacter_2001,
author = {Israel, Dawn A. and Salama, Nina and Arnold, Carrie N. and Moss,
Steven F. and Ando, Takafumi and Wirth, Hans-Peter and Tham, Kyi
T. and Camorlinga, Margorita and Blaser, Martin J. and Falkow, Stanley
and Peek, Richard M.},
title = {\emph{{Helicobacter pylori}} strain-specific differences in genetic content,
identified by microarray, influence host inflammatory responses},
journal = {Journal of Clinical Investigation},
year = {2001},
volume = {107},
pages = {611--620},
number = {5},
month = mar,
doi = {10.1172/JCI11450},
issn = {0021-9738},
url = {http://www.jci.org/articles/view/11450/version/1}
}
@ARTICLE{kathariou_listeria_2002,
author = {Kathariou, Sophia},
title = {\emph{{Listeria monocytogenes}} virulence and pathogenicity, a food safety
perspective},
journal = {Journal of Food Protection},
year = {2002},
volume = {65},
pages = {1811--1829},
number = {11},
month = nov,
note = {{PMID:} 12430709},
abstract = {Several virulence factors of \emph{{Listeria monocytogenes}} have been identified
and extensively characterized at the molecular and cell biologic
levels, including the hemolysin (listeriolysin O), two distinct phospholipases,
a protein {(ActA)}, several internalins, and others. Their study
has yielded an impressive amount of information on the mechanisms
employed by this facultative intracellular pathogen to interact with
mammalian host cells, escape the host cell's killing mechanisms,
and spread from one infected cell to others. In addition, several
molecular subtyping tools have been developed to facilitate the detection
of different strain types and lineages of the pathogen, including
those implicated in common-source outbreaks of the disease. Despite
these spectacular gains in knowledge, the virulence of \emph{{L. monocytogenes}}
as a foodborne pathogen remains poorly understood. The available
pathogenesis and subtyping data generally fail to provide adequate
insight about the virulence of field isolates and the likelihood
that a given strain will cause illness. Possible mechanisms for the
apparent prevalence of three serotypes (1/2a, 1/2b, and 4b) in human
foodborne illness remain unidentified. The propensity of certain
strain lineages (epidemic clones) to be implicated in common-source
outbreaks and the prevalence of serotype 4b among epidemic-associated
stains also remain poorly understood. This review first discusses
current progress in understanding the general features of virulence
and pathogenesis of \emph{{L. monocytogenes}}. Emphasis is then placed on
areas of special relevance to the organism's involvement in human
foodborne illness, including (i) the relative prevalence of different
serotypes and serotype-specific features and genetic markers; (ii)
the ability of the organism to respond to environmental stresses
of relevance to the food industry (cold, salt, iron depletion, and
acid); (iii) the specific features of the major known epidemic-associated
lineages; and (iv) the possible reservoirs of the organism in animals
and the environment and the pronounced impact of environmental contamination
in the food processing facilities. Finally, a discussion is provided
on the perceived areas of special need for future research of relevance
to food safety, including (i) theoretical modeling studies of niche
complexity and contamination in the food processing facilities; (ii)
strain databases for comprehensive molecular typing; and (iii) contributions
from genomic and proteomic tools, including {DNA} microarrays for
genotyping and expression signatures. Virulence-related genomic and
proteomic signatures are expected to emerge from analysis of the
genomes at the global level, with the support of adequate epidemiologic
data and access to relevant strains.},
issn = {0362-{028X}},
keywords = {Consumer Product Safety, Disease Outbreaks, Foodborne Diseases, Genes,
Bacterial, Hemolysin Proteins, Humans, \emph{{Listeria monocytogenes}}, Prevalence,
Serotyping, Virulence},
lccn = {0213},
url = {http://www.ncbi.nlm.nih.gov/pubmed/12430709}
}
@ARTICLE{laing_rapid_2008,
author = {Laing, Chad and Pegg, Crystal and Yawney, Davis and Ziebell, Kim
and Steele, Marina and Johnson, Roger and Thomas, James E. and Taboada,
Eduardo N. and Zhang, Yongxiang and Gannon, Victor P. J.},
title = {Rapid Determination of \emph{{Escherichia coli}} {{O157}:H7} Lineage Types and
Molecular Subtypes by Using Comparative Genomic Fingerprinting},
journal = {Appl. Environ. Microbiol.},
year = {2008},
volume = {74},
pages = {6606--6615},
number = {21},
month = nov,
abstract = {In this study, variably absent or present {(VAP)} regions discovered
through comparative genomics experiments were targeted for the development
of a rapid, {PCR-based} method to subtype and fingerprint Escherichia
coli {{O157}:H7.} Forty-four {VAP} loci were analyzed for discriminatory
power among 79 \emph{{E. coli}} {{O157}:H7} strains of 13 phage types {(PT).}
Twenty-three loci were found to maximize resolution among strains,
generating 54 separate fingerprints, each of which contained strains
of unique {PT.} Strains from the three previously identified major
\emph{{E. coli}} {{O157}:H7} lineages, {LSPA6-LI}, {LSPA6-LI/II}, and {LSPA6-LII},
formed distinct branches on a dendrogram obtained by hierarchical
clustering of comparative genomic fingerprinting {(CGF)} data. By
contrast, pulsed-field gel electrophoresis {(PFGE)} typing generated
52 {XbaI} digestion profiles that were not unique to {PT} and did
not cluster according to {{O157}:H7} lineage. Our analysis identified
a subpopulation comprised of 25 strains from a closed herd of cattle,
all of which were of {PT87} and formed a cluster distinct from all
other \emph{{E. coli}} {{O157}:H7} strains examined. {CGF} found five related
but unique fingerprints among the highly clonal herd strains, with
two dominant subtypes characterized by a shift from the presence
of locus fprn33 to its absence. {CGF} had equal resolution to {PFGE}
typing but with greater specificity, generating fingerprints that
were unique among phenotypically related \emph{{E. coli}} {{O157}:H7} lineages
and {PT.} As a comparative genomics typing method that is amenable
for use in high-throughput platforms, {CGF} may be a valuable tool
in outbreak investigations and strain characterization.},
doi = {10.1128/AEM.00985-08},
lccn = {0010},
shorttitle = {Rapid Determination of \emph{{Escherichia coli}} {O157}},
url = {http://aem.asm.org/cgi/content/abstract/74/21/6606}
}
@ARTICLE{leimeister-wachter_identification_1990,
author = {Leimeister-W\"{a}chter, M and Haffner, C and Domann, E and Goebel, W
and Chakraborty, T},
title = {Identification of a gene that positively regulates expression of
listeriolysin, the major virulence factor of listeria monocytogenes},
journal = {Proceedings of the National Academy of Sciences of the United States
of America},
year = {1990},
volume = {87},
pages = {8336 --8340},
number = {21},
month = nov,
abstract = {We have isolated, by molecular cloning and genetic complementation
of a listeriolysin-negative mutant, a gene required for the expression
of this virulence factor in \emph{{Listeria monocytogenes}}. The mutant strain
{SLCC53}, which was nonhemolytic and avirulent, harbored a deletion
of 450 base pairs located approximately 1500 base pairs upstream
of the listeriolysin gene. No transcripts corresponding to the listeriolysin
gene were detected in the mutant. {DNA} sequencing of this region
from the hemolytic strain {EGD} revealed that the region deleted
in the mutant would abrogate expression of a 27-{kDa} polypeptide.
Introduction of a recombinant plasmid expressing this 27-{kDa} polypeptide
restored hemolytic activity to the mutant and increased the hemolytic
activity of the wild-type \emph{{L. monocytogenes}} strain {EGD.} We have
designated the gene encoding the 27-{kDa} polypeptide {prfA}, for
positive regulatory factor of listeriolysin {(lisA)} expression.
The {prfA} gene regulates transcription of the {lisA} gene positively.},
url = {http://www.pnas.org/content/87/21/8336.abstract}
}
@ARTICLE{leopold_precise_2009,
author = {Leopold, Shana R. and Magrini, Vincent and Holt, Nicholas J. and
Shaikh, Nurmohammad and Mardis, Elaine R. and Cagno, Joseph and Ogura,
Yoshitoshi and Iguchi, Atsushi and Hayashi, Tetsuya and Mellmann,
Alexander and Karch, Helge and Besser, Thomas E. and Sawyer, Stanley
A. and Whittam, Thomas S. and Tarr, Phillip I.},
title = {A precise reconstruction of the emergence and constrained radiations
of \emph{{Escherichia coli}} {O157} portrayed by backbone concatenomic analysis},
journal = {Proceedings of the National Academy of Sciences},
year = {2009},
volume = {106},
pages = {8713 --8718},
number = {21},
month = may,
abstract = {Single nucleotide polymorphisms {(SNPs)} in stable genome regions
provide durable measurements of species evolution. We systematically
identified each {SNP} in concatenations of all backbone {ORFs} in
7 newly or previously sequenced evolutionarily instructive pathogenic
\emph{{Escherichia coli}} {{O157}:H7}, {{O157}:H−}, and {O55:H7.} The 1,113
synonymous {SNPs} demonstrate emergence of the largest cluster of
this pathogen only in the last millennium. Unexpectedly, shared {SNPs}
within circumscribed clusters of organisms suggest severely restricted
survival and limited effective population sizes of pathogenic {{O157}:H7},
tenuous survival of these organisms in nature, source-sink evolutionary
dynamics, or, possibly, a limited number of mutations that confer
selective advantage. A single large segment spanning the rfb-gnd
gene cluster is the only backbone region convincingly acquired by
recombination as {O157} emerged from O55. This concatenomic analysis
also supports using {SNPs} to differentiate closely related pathogens
for infection control and forensic purposes. However, constrained
radiations raise the possibility of making false associations between
isolates.},
doi = {10.1073/pnas.0812949106},
lccn = {0009},
url = {http://www.pnas.org/content/106/21/8713.abstract}
}
@ARTICLE{lindstedt_multiple-locus_2008,
author = {Lindstedt, Bjørn-Arne and Tham, Wilhelm and Danielsson-Tham, Marie-Louise
and Vardund, Traute and Helmersson, Seved and Kapperud, Georg},
title = {Multiple-locus variable-number tandem-repeats analysis of \emph{{Listeria
monocytogenes}} using multicolour capillary electrophoresis and comparison
with pulsed-field gel electrophoresis typing},
journal = {Journal of Microbiological Methods},
year = {2008},
volume = {72},
pages = {141--148},
number = {2},
month = feb,
note = {{PMID:} 18096258},
abstract = {The multiple-locus variable-number tandem-repeats analysis {(MLVA)}
method for genotyping has proven to be a fast and reliable typing
tool in several bacterial species. {MLVA} is in our laboratory the
routine typing method for Salmonella enterica subsp. enterica serovar
Typhimurium and \emph{{Escherichia coli}} {O157}. The gram-positive bacteria
\emph{{Listeria monocytogenes}}, while not isolated as frequent as S. Typhimurium
and \emph{{E. coli}}, causes severe illness with an overall mortality rate
of 30\%. Thus, it is important that any outbreak of this pathogen
is detected early and a fast trace to the source can be performed.
In view of this, we have used the information provided by two fully
sequenced \emph{{L. monocytogenes}} strains to develop a {MLVA} assay coupled
with high-resolution capillary electrophoresis and compared it to
pulsed-field gel electrophoresis {(PFGE)} in two sets of isolates,
one Norwegian (79 isolates) and one Swedish (61 isolates) set. The
{MLVA} assay could resolve all of the \emph{{L. monocytogenes}} serotypes
tested, and was slightly more discriminatory than {PFGE} for the
Norwegian isolates (28 {MLVA} profiles and 24 {PFGE} profiles) and
opposite for the Swedish isolates (42 {MLVA} profiles and 43 {PFGE}
profiles).},
doi = {10.1016/j.mimet.2007.11.012},
issn = {0167-7012},
keywords = {Bacterial Typing Techniques, {DNA}, Bacterial, Electrophoresis, Capillary,
Electrophoresis, Gel, Pulsed-Field, Humans, \emph{{Listeria monocytogenes}},
Minisatellite Repeats, Molecular Sequence Data, Norway, Polymerase
Chain Reaction, Sweden},
lccn = {0004},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18096258}
}
@ARTICLE{liu_listeria_2006,
author = {Liu, Dongyou and Lawrence, Mark L. and Wiedmann, Martin and Gorski,
Lisa and Mandrell, Robert E. and Ainsworth, A. Jerald and Austin,
Frank W.},
title = {\emph{{Listeria monocytogenes}} Subgroups {IIIA}, {IIIB}, and {IIIC} Delineate
Genetically Distinct Populations with Varied Pathogenic Potential},
journal = {Journal of Clinical Microbiology},
year = {2006},
volume = {44},
pages = {4229--4233},
number = {11},
month = nov,
note = {{PMID:} 17005751 {PMCID:} 1698330},
abstract = {\emph{{Listeria monocytogenes}} lineage {III} strains belonging to subgroups
{IIIA} (n = 8), {IIIB} (n = 5), and {IIIC} (n = 6) were examined
along with other known serotype strains (n = 11) by {PCR} and Southern
hybridization using several recently described species-, virulence-,
and serotype-specific primers and probes. The virulence of seven
representative lineage {III} strains was then evaluated in mice via
the intraperitoneal route. The results suggest that subgroup {IIIA}
consists of typical rhamnose-positive avirulent serotype 4a and virulent
serotype 4c strains, subgroup {IIIC} consists of atypical rhamnose-negative
virulent serotype 4c strains, and subgroup {IIIB} consists of atypical
rhamnose-negative virulent non-serotype 4a and non-serotype 4c strains,
some of which may be related to serotype 7. It is possible that subgroup
{IIIB} (including serotype 7) may represent a novel subspecies within
\emph{{L. monocytogenes}.}},
doi = {10.1128/JCM.01032-06},
issn = {0095-1137},
lccn = {0018}
}
@ARTICLE{lukjancenko_comparison_2010,
author = {Lukjancenko, Oksana and Wassenaar, Trudy M and Ussery, David W},
title = {Comparison of 61 Sequenced \emph{{Escherichia coli}} Genomes},
journal = {Microbial Ecology},
year = {2010},
month = jul,
note = {{PMID:} 20623278},
abstract = {\emph{{Escherichia coli}} is an important component of the biosphere and is
an ideal model for studies of processes involved in bacterial genome
evolution. Sixty-one publically available \emph{{E. coli}} and Shigella spp.
sequenced genomes are compared, using basic methods to produce phylogenetic
and proteomics trees, and to identify the pan- and core genomes of
this set of sequenced strains. A hierarchical clustering of variable
genes allowed clear separation of the strains into clusters, including
known pathotypes; clinically relevant serotypes can also be resolved
in this way. In contrast, when in silico {MLST} was performed, many
of the various strains appear jumbled and less well resolved. The
predicted pan-genome comprises 15,741 gene families, and only 993
(6\%) of the families are represented in every genome, comprising
the core genome. The variable or 'accessory' genes thus make up more
than 90\% of the pan-genome and about 80\% of a typical genome; some
of these variable genes tend to be co-localized on genomic islands.
The diversity within the species \emph{{E. coli}}, and the overlap in gene
content between this and related species, suggests a continuum rather
than sharp species borders in this group of Enterobacteriaceae.},
doi = {10.1007/s00248-010-9717-3},
issn = {1432-{184X}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/20623278}
}
@ARTICLE{lungu_growth_2009,
author = {Lungu, B. and Ricke, {S.C.} and Johnson, {M.G.}},
title = {Growth, survival, proliferation and pathogenesis of \emph{{Listeria monocytogenes}}
under low oxygen or anaerobic conditions: A review},
journal = {Anaerobe},
year = {2009},
volume = {15},
pages = {7--17},
number = {1--2},
month = feb,
abstract = {\emph{{Listeria monocytogenes}} is a Gram positive facultative anaerobe that
causes listeriosis, a disease that mainly affects the immune-compromised,
the elderly, infants and pregnant women. In the susceptible immune
challenged population, listeriosis is very severe and has a fatality
rate of up to 30\%. Control of \emph{{L. monocytogenes}} is difficult due
to its: 1) widespread presence in the environment, 2) intrinsic physiological
resistance, 3) ability to adapt to external stresses and 4) ability
to grow at a wide range of temperatures. \emph{{L. monocytogenes}} encounters
anaerobic conditions in the external environment as well as during
pathogenesis. Although \emph{{L. monocytogenes}} is a facultative anaerobe,
the differential effects of O2 and oxidation--reduction potential
on the multiplication of \emph{{L. monocytogenes}} have not been established.
In addition, most laboratory studies to determine the growth, survival
and persistence of this pathogen in foods as well as in the environment
have emphasized the response of this pathogen under aerobic conditions.
Consequently, this has led to a limited understanding of the metabolic
and physiological responses of \emph{{L. monocytogenes}} in low oxygen environments.
Therefore, the objective of our review was to highlight the progress
that has been made in \emph{{L. monocytogenes}} research with emphasis on
the role of low oxygen and/or anaerobiosis in the growth, survival
and proliferation of this pathogen in the environment as well as
during pathogenesis.},
doi = {10.1016/j.anaerobe.2008.08.001},
issn = {1075-9964},
keywords = {Anaerobic, Growth, \emph{{L. monocytogenes}}, Pathogenesis, Survival},
shorttitle = {Growth, survival, proliferation and pathogenesis of \emph{{Listeria monocytogenes}}
under low oxygen or anaerobic conditions},
url = {http://www.sciencedirect.com/science/article/pii/S107599640800098X}
}
@ARTICLE{mardis_impact_2008,
author = {Mardis, Elaine R.},
title = {The impact of next-generation sequencing technology on genetics},
journal = {Trends in Genetics},
year = {2008},
volume = {24},
pages = {133--141},
number = {3},
month = mar,
abstract = {If one accepts that the fundamental pursuit of genetics is to determine
the genotypes that explain phenotypes, the meteoric increase of {DNA}
sequence information applied toward that pursuit has nowhere to go
but up. The recent introduction of instruments capable of producing
millions of {DNA} sequence reads in a single run is rapidly changing
the landscape of genetics, providing the ability to answer questions
with heretofore unimaginable speed. These technologies will provide
an inexpensive, genome-wide sequence readout as an endpoint to applications
ranging from chromatin immunoprecipitation, mutation mapping and
polymorphism discovery to noncoding {RNA} discovery. Here I survey
next-generation sequencing technologies and consider how they can
provide a more complete picture of how the genome shapes the organism.},
annote = {cost with next-generation sequencing to sequence human genome is
\$700000},
doi = {10.1016/j.tig.2007.12.007},
issn = {0168-9525},
url = {http://www.sciencedirect.com/science/article/B6TCY-4RTCPK7-2/2/eeab9ba2236d4783467cd05d61b1fa9d}
}
@ARTICLE{margulies_genome_2005,
author = {Margulies, Marcel and Egholm, Michael and Altman, William E. and
Attiya, Said and Bader, Joel S. and Bemben, Lisa A. and Berka, Jan
and Braverman, Michael S. and Chen, Yi-Ju and Chen, Zhoutao and Dewell,
Scott B. and Du, Lei and Fierro, Joseph M. and Gomes, Xavier V. and
Godwin, Brian C. and He, Wen and Helgesen, Scott and Ho, Chun He
and Irzyk, Gerard P. and Jando, Szilveszter C. and Alenquer, Maria
L. I. and Jarvie, Thomas P. and Jirage, Kshama B. and Kim, Jong-Bum
and Knight, James R. and Lanza, Janna R. and Leamon, John H. and
Lefkowitz, Steven M. and Lei, Ming and Li, Jing and Lohman, Kenton
L. and Lu, Hong and Makhijani, Vinod B. and {McDade}, Keith E. and
{McKenna}, Michael P. and Myers, Eugene W. and Nickerson, Elizabeth
and Nobile, John R. and Plant, Ramona and Puc, Bernard P. and Ronan,
Michael T. and Roth, George T. and Sarkis, Gary J. and Simons, Jan
Fredrik and Simpson, John W. and Srinivasan, Maithreyan and Tartaro,
Karrie R. and Tomasz, Alexander and Vogt, Kari A. and Volkmer, Greg
A. and Wang, Shally H. and Wang, Yong and Weiner, Michael P. and
Yu, Pengguang and Begley, Richard F. and Rothberg, Jonathan M.},
title = {Genome sequencing in microfabricated high-density picolitre reactors},
journal = {Nature},
year = {2005},
volume = {437},
pages = {376--380},
number = {7057},
annote = {454 pyrosequencing paper},
doi = {10.1038/nature03959},
issn = {0028-0836},
url = {http://dx.doi.org/10.1038/nature03959}
}
@ARTICLE{markowitz_img:_2011,
author = {Markowitz, V. M. and Chen, I.-M. A. and Palaniappan, K. and Chu,
K. and Szeto, E. and Grechkin, Y. and Ratner, A. and Jacob, B. and
Huang, J. and Williams, P. and Huntemann, M. and Anderson, I. and
Mavromatis, K. and Ivanova, N. N. and Kyrpides, N. C.},
title = {{IMG:} the integrated microbial genomes database and comparative
analysis system},
journal = {Nucleic Acids Research},
year = {2011},
volume = {40},
pages = {D115--D122},
number = {D1},
month = dec,
doi = {10.1093/nar/gkr1044},
issn = {0305-1048, 1362-4962},
shorttitle = {{IMG}},
url = {http://nar.oxfordjournals.org/content/40/D1/D115.short}
}
@ARTICLE{mcmullen_genome_2012,
author = {{McMullen}, P David and Gillaspy, Allison F and Gipson, Jenny and
Bobo, Linda D and Skiest, Daniel J and Freitag, Nancy E},
title = {Genome sequence of \emph{{Listeria monocytogenes}} {07PF0776}, a cardiotropic
serovar 4b strain},
journal = {Journal of Bacteriology},
year = {2012},
volume = {194},
pages = {3552},
number = {13},
month = jul,
note = {{PMID:} 22689239},
abstract = {\emph{{Listeria monocytogenes}} is a food-borne bacterial pathogen commonly
associated with serious invasive infections of the central nervous
system or of the developing fetus. We present the genome sequence
of \emph{{Listeria monocytogenes}} {07PF0776}, a serovar 4b isolate from a
human myocardial abscess that exhibits enhanced invasion of cardiac
tissue.},
doi = {10.1128/JB.00616-12},
issn = {1098-5530},
keywords = {Abscess, Genome, Bacterial, Heart, Humans, \emph{{Listeria monocytogenes}},
Listeriosis, Molecular Sequence Data, Sequence Analysis, {DNA}, Serotyping},
url = {http://www.ncbi.nlm.nih.gov/pubmed/22689239}
}
@ARTICLE{mcpherson_next-generation_2009,
author = {{McPherson}, John D},
title = {Next-generation gap},
journal = {Nature Methods},
year = {2009},
volume = {6},
pages = {S2--5},
number = {11 Suppl},
month = nov,
note = {{PMID:} 19844227},
abstract = {There is a growing gap between the generation of massively parallel
sequencing output and the ability to process and analyze the resulting
data. New users are left to navigate a bewildering maze of base calling,
alignment, assembly and analysis tools with often incomplete documentation
and no idea how to compare and validate their outputs. Bridging this
gap is essential, or the coveted \$1,000 genome will come with a
\$20,000 analysis price tag.},
doi = {10.1038/nmeth.f.268},
issn = {1548-7105},
keywords = {Base Sequence, Genetic Variation, Genome, Humans, Sequence Alignment,
Sequence Analysis, {DNA}, Software},
url = {http://www.ncbi.nlm.nih.gov/pubmed/19844227}
}
@ARTICLE{mead_food-related_1999,
author = {Mead, P S and Slutsker, L and Dietz, V and {McCaig}, L F and Bresee,
J S and Shapiro, C and Griffin, P M and Tauxe, R V},
title = {Food-related illness and death in the United States},
journal = {Emerging Infectious Diseases},
year = {1999},
volume = {5},
pages = {607--625},
number = {5},
month = oct,
note = {{PMID:} 10511517},
abstract = {To better quantify the impact of foodborne diseases on health in the
United States, we compiled and analyzed information from multiple
surveillance systems and other sources. We estimate that foodborne
diseases cause approximately 76 million illnesses, 325,000 hospitalizations,
and 5,000 deaths in the United States each year. Known pathogens
account for an estimated 14 million illnesses, 60, 000 hospitalizations,
and 1,800 deaths. Three pathogens, Salmonella, \emph{{Listeria}}, and Toxoplasma,
are responsible for 1,500 deaths each year, more than 75\% of those
caused by known pathogens, while unknown agents account for the remaining
62 million illnesses, 265,000 hospitalizations, and 3,200 deaths.
Overall, foodborne diseases appear to cause more illnesses but fewer
deaths than previously estimated.},
issn = {1080-6040},
keywords = {Acute Disease, Animals, Foodborne Diseases, Gastroenteritis, Hospitalization,
Humans, \emph{{Listeria}}, Population Surveillance, Salmonella, Toxoplasma},
lccn = {3785},
url = {http://www.ncbi.nlm.nih.gov/pubmed/10511517}
}
@ARTICLE{medini_microbial_2005,
author = {Medini, Duccio and Donati, Claudio and Tettelin, Herv\'{e} and Masignani,
Vega and Rappuoli, Rino},
title = {The microbial pan-genome},
journal = {Current Opinion in Genetics \& Development},
year = {2005},
volume = {15},
pages = {589--594},
number = {6},
month = dec,
note = {{PMID:} 16185861},
abstract = {A decade after the beginning of the genomic era, the question of how
genomics can describe a bacterial species has not been fully addressed.
Experimental data have shown that in some species new genes are discovered
even after sequencing the genomes of several strains. Mathematical
modeling predicts that new genes will be discovered even after sequencing
hundreds of genomes per species. Therefore, a bacterial species can
be described by its pan-genome, which is composed of a "core genome"
containing genes present in all strains, and a "dispensable genome"
containing genes present in two or more strains and genes unique
to single strains. Given that the number of unique genes is vast,
the pan-genome of a bacterial species might be orders of magnitude
larger than any single genome.},
doi = {10.1016/j.gde.2005.09.006},
issn = {0959-{437X}},
keywords = {Animals, Bacteria, Bacterial Physiological Phenomena, Evolution, Molecular,
Genome, Bacterial, Genomics, Humans},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16185861}
}
@ARTICLE{meinersmann_multilocus_2004,
author = {Meinersmann, Richard J. and Phillips, Robert W. and Wiedmann, Martin
and Berrang, Mark E.},
title = {Multilocus Sequence Typing of \emph{{Listeria monocytogenes}} by Use of Hypervariable
Genes Reveals Clonal and Recombination Histories of Three Lineages},
journal = {Applied and Environmental Microbiology},
year = {2004},
volume = {70},
pages = {2193--2203},
number = {4},
month = apr,
note = {{PMID:} 15066813 {PMCID:} 383165},
abstract = {In an attempt to develop a method to discriminate among isolates of
\emph{{Listeria monocytogenes}}, the sequences of all of the annotated genes
from the fully sequenced strain \emph{{L. monocytogenes}} {EGD-e} (serotype
1/2a) were compared by {BLASTn} to a file of the unfinished genomic
sequence of \emph{{L. monocytogenes}} {ATCC} 19115 (serotype 4b). Approximately
7\% of the matching genes demonstrated 90\% or lower identity between
the two strains, and the lowest observed identity was 80\%. Nine
genes {(hisJ}, {cbiE}, {truB}, {ribC}, {comEA}, {purM}, {aroE}, {hisC},
and {addB)} in the 80 to 90\% identity group and two genes {(gyrB}
and {rnhB)} with approximately 97\% identity were selected for multilocus
sequence analysis in two sets of \emph{{L. monocytogenes}} isolates (a 15-strain
diversity set and a set of 19 isolates from a single food-processing
plant). Based on concatenated sequences, a total of 33 allotypes
were differentiated among the 34 isolates tested. Population genetics
analyses revealed three lineages of \emph{{L. monocytogenes}} that differed
in their history of apparent recombination. Lineage I appeared to
be completely clonal, whereas representatives of the other lineages
demonstrated evidence of horizontal gene transfer and recombination.
Although most of the gene sequences for lineage {II} strains were
distinct from those of lineage I, a few strains with the majority
of genes characteristic of lineage {II} had some that were characteristic
of lineage I. Genes from lineage {III} organisms were mostly similar
to lineage I genes, with instances of genes appearing to be mosaics
with lineage {II} genes. Even though lineage I and lineage {II} generally
demonstrated very distinct sequences, the sequences for the 11 selected
genes demonstrated little discriminatory power within each lineage.
In the \emph{{L. monocytogenes}} isolate set obtained from one food-processing
plant, lineage I and lineage {II} were found to be almost equally
prevalent. While it appears that different lineages of \emph{{L. monocytogenes}}
can share habitats, they appear to differ in their histories of horizontal
gene transfer.},
doi = {10.1128/AEM.70.4.2193-2203.2004},
issn = {0099-2240},
lccn = {0046}
}
@ARTICLE{merchant-patel_characterisation_2008,
author = {Merchant-Patel, Shreema and Blackall, Patrick J and Templeton, Jillian
and Price, Erin P and Miflin, Jeanette K and Huygens, Flavia and
Giffard, Philip M},
title = {Characterisation of chicken \emph{{Campylobacter jejuni}} isolates using resolution
optimised single nucleotide polymorphisms and binary gene markers},
journal = {International Journal of Food Microbiology},
year = {2008},
volume = {128},
pages = {304--308},
number = {2},
month = dec,
note = {{PMID:} 18835503},
abstract = {The principal objective of this study was to determine if \emph{{Campylobacter}}
jejuni genotyping methods based upon resolution optimised sets of
single nucleotide polymorphisms {(SNPs)} and binary genetic markers
were capable of identifying epidemiologically linked clusters of
chicken-derived isolates. Eighty-eight \emph{{C. jejuni}} isolates of known
{flaA} {RFLP} type were included in the study. They encompassed three
groups of ten isolates that were obtained at the same time and place
and possessed the same {flaA} type. These were regarded as being
epidemiologically linked. Twenty-six unlinked \emph{{C. jejuni}} {flaA} type
I isolates were included to test the ability of {SNP} and binary
typing to resolve isolates that were not resolved by {flaA} {RFLP.}
The remaining isolates were of different {flaA} types. All isolates
were typed by real-time {PCR} interrogation of the resolution optimised
sets of {SNPs} and binary markers. According to each typing method,
the three epidemiologically linked clusters were three different
clones that were well resolved from the other isolates. The 26 unlinked
\emph{{C. jejuni}} {flaA} type I isolates were resolved into 14 {SNP-binary}
types, indicating that {flaA} typing can be unreliable for revealing
epidemiological linkage. Comparison of the data with data from a
fully typed set of isolates associated with human infection revealed
that abundant lineages in the chicken isolates that were also found
in the human isolates belonged to clonal complex {(CC)} -21 and {CC-353},
with the usually rare C-353 member {ST-524} being especially abundant
in the chicken collection. The chicken isolates selected to be diverse
according to {flaA} were also diverse according to {SNP} and binary
typing. It was observed that {CC-48} was absent in the chicken isolates,
despite being very common in Australian human infection isolates,
indicating that this may be a major cause of human disease that is
not chicken associated.},
doi = {10.1016/j.ijfoodmicro.2008.09.002},
issn = {0168-1605},
keywords = {Animals, Bacterial Typing Techniques, Base Sequence, \emph{{Campylobacter}}
Infections, \emph{{Campylobacter jejuni}}, Chickens, Cluster Analysis, {DNA}
Primers, Flagellin, Genes, Bacterial, Genetic Markers, Genotype,
Humans, Polymorphism, Single Nucleotide, Sequence Analysis, {DNA},
Species Specificity},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18835503}
}
@ARTICLE{milillo_contributions_2009,
author = {Milillo, Sara R. and Badamo, Jasmine M. and Wiedmann, Martin},
title = {Contributions to selected phenotypic characteristics of large species-
and lineage-specific genomic regions in \emph{{Listeria monocytogenes}}},
journal = {Food Microbiology},
year = {2009},
volume = {26},
pages = {212--223},
number = {2},
month = apr,
abstract = {We hypothesized that genomic regions specific to \emph{{Listeria monocytogenes}}
or selected \emph{{L. monocytogenes}} strains may contribute to virulence
and phenotypic differences among the strains. A whole genome alignment
of two completed \emph{{L. monocytogenes}} genomes and the one completed \emph{{Listeria}}
innocua genome initially identified 28 genomic regions of difference
{(RD)} {\textgreater} 4 kb that were found in one or both \emph{{L. monocytogenes}}
genomes, but absent from the non-pathogenic L. innocua. In silico
analyses using an additional 18 draft \emph{{L. monocytogenes}} genomes showed
that (i) 15 {RDs} were found in all or most \emph{{L. monocytogenes}} genomes;
(ii) three {RDs} were found in all or most lineage I genomes, but
absent from lineage {II} genomes; and (iii) four {RDs} were found
in all lineage {II} genomes, but no lineage I genomes. Null mutants
in two \emph{{L. monocytogenes}}-specific {RDs} {(RD16} and {RD30;} found
in most \emph{{L. monocytogenes}}) and the lineage {II-specific} {RD25} showed
no evidence for impaired invasion or intracellular growth in selected
tissue culture cells. Although, in {pH} 5.5 minimal media, the {[Delta]RD30}
null mutant showed reduced ability to compete with its parent strain,
indicating that {RD30} may have a role in \emph{{L. monocytogenes}} growth
under limited nutrient conditions at acidic {pH.}},
doi = {10.1016/j.fm.2008.08.010},
issn = {0740-0020},
keywords = {Genome, Lineage, \emph{{Listeria}}},
url = {http://www.sciencedirect.com/science/article/B6WFP-4TJ1HJY-1/2/37295ef8aa35fa6db54168a2a3b3157d}
}
@ARTICLE{miya_development_2008,
author = {Miya, Satoko and Kimura, Bon and Sato, Miki and Takahashi, Hajime
and Ishikawa, Tatsuya and Suda, Takayuki and Takakura, Chikako and
Fujii, Tateo and Wiedmann, Martin},
title = {Development of a multilocus variable-number of tandem repeat typing
method for \emph{{Listeria monocytogenes}} serotype 4b strains},
journal = {International Journal of Food Microbiology},
year = {2008},
volume = {124},
pages = {239--249},
number = {3},
month = jun,
note = {{PMID:} 18457891},
abstract = {\emph{{Listeria monocytogenes}} serotype 4b strains have been identified as
the causative agent in many human listeriosis epidemics as well as
in a considerable number of sporadic cases. Due to the genetic homogeneity
of serotype 4b isolates, development of rapid subtyping methods with
high discriminatory power for serotype 4b isolates is required to
allow for improved outbreak detection and source tracking. In this
study, multilocus variable-number tandem repeat analysis {(MLVA)}
was developed and used to characterize 60 serotype 4b isolates from
various sources. All isolates were also characterized by automated
{EcoRI} ribotyping, single enzyme pulsed-field gel electrophoresis
{(PFGE)} with {ApaI}, and a multilocus sequence typing {(MLST)} scheme
targeting six virulence and virulence-associated genes. Discriminatory
power of {MLVA} (as determined by Simpson Index of Discrimination)
was higher than the discriminatory power of any of the other three
methods. {MLVA} markers targeted were found to be stable and did
not change when three isolates were passaged daily for 70 days. Cluster
analyses of {MLVA}, {PFGE} and {MLST} consistently grouped the same
isolates into three major clusters, each of which includes one of
the three major \emph{{L. monocytogenes}} epidemic clones (i.e., {ECI}, {ECIa}
and {ECII).} We conclude that the {MLVA} method described here (i)
provides for more discriminatory subtyping of \emph{{L. monocytogenes}} serotype
4b strains than the other three methods, (ii) identifies three major
groups within the serotype 4b, which are consistent with the groups
identified by other subtyping methods, and (iii) is easy to interpret.
Use of {MLVA} may thus be recommended for subtyping of serotype 4b
isolates, including as a secondary more discriminatory subtyping
method that could be used after initial isolate characterization
by {PFGE} or ribotyping.},
doi = {10.1016/j.ijfoodmicro.2008.03.023},
issn = {0168-1605},
keywords = {Bacterial Proteins, Bacterial Typing Techniques, Cluster Analysis,
Electrophoresis, Gel, Pulsed-Field, Food Microbiology, Foodborne
Diseases, Humans, \emph{{Listeria monocytogenes}}, Listeriosis, Molecular
Sequence Data, Phylogeny, Ribotyping, Sequence Analysis, {DNA}, Serotyping,
Tandem Repeat Sequences, Virulence},
lccn = {0005},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18457891}
}
@ARTICLE{monot_comparative_2009,
author = {Monot, Marc and Honor\'{e}, Nadine and Garnier, Thierry and Zidane,
Nora and Sherafi, Diana and Paniz-Mondolfi, Alberto and Matsuoka,
Masanori and Taylor, G Michael and Donoghue, Helen D and Bouwman,
Abi and Mays, Simon and Watson, Claire and Lockwood, Diana and Khamesipour,
Ali and Khamispour, Ali and Dowlati, Yahya and Jianping, Shen and
Rea, Thomas H and Vera-Cabrera, Lucio and Stefani, Mariane M and
Banu, Sayera and Macdonald, Murdo and Sapkota, Bishwa Raj and Spencer,
John S and Thomas, J\'{e}rôme and Harshman, Keith and Singh, Pushpendra
and Busso, Philippe and Gattiker, Alexandre and Rougemont, Jacques
and Brennan, Patrick J and Cole, Stewart T},
title = {Comparative genomic and phylogeographic analysis of \emph{{Mycobacterium
leprae}}},
journal = {Nature Genetics},
year = {2009},
volume = {41},
pages = {1282--1289},
number = {12},
month = dec,
note = {{PMID:} 19881526},
abstract = {Reductive evolution and massive pseudogene formation have shaped the
3.31-Mb genome of Mycobacterium leprae, an unculturable obligate
pathogen that causes leprosy in humans. The complete genome sequence
of M. leprae strain Br4923 from Brazil was obtained by conventional
methods (6x coverage), and Illumina resequencing technology was used
to obtain the sequences of strains Thai53 (38x coverage) and {NHDP63}
(46x coverage) from Thailand and the United States, respectively.
Whole-genome comparisons with the previously sequenced {TN} strain
from India revealed that the four strains share 99.995\% sequence
identity and differ only in 215 polymorphic sites, mainly {SNPs},
and by 5 pseudogenes. Sixteen interrelated {SNP} subtypes were defined
by genotyping both extant and extinct strains of M. leprae from around
the world. The 16 {SNP} subtypes showed a strong geographical association
that reflects the migration patterns of early humans and trade routes,
with the Silk Road linking Europe to China having contributed to
the spread of leprosy.},
doi = {10.1038/ng.477},
issn = {1546-1718},
keywords = {Genes, Bacterial, Genome, Bacterial, Geography, Humans, Leprosy, Mycobacterium
leprae, Phylogeny, Polymorphism, Single Nucleotide, Recombination,
Genetic},
url = {http://www.ncbi.nlm.nih.gov/pubmed/19881526}
}
@ARTICLE{morozova_applications_2008,
author = {Morozova, Olena and Marra, Marco A.},
title = {Applications of next-generation sequencing technologies in functional
genomics},
journal = {Genomics},
year = {2008},
volume = {92},
pages = {255--264},
number = {5},
month = nov,
doi = {10.1016/j.ygeno.2008.07.001},
issn = {0888-7543},
keywords = {{454/Roche}, {ABI/SOLiD}, Deep sequencing, Epigenome, Functional genomics,
{Illumina/Solexa}, Next-generation sequencing technology, Sequencing
by ligation, Sequencing by synthesis, Transcriptome},
url = {http://www.sciencedirect.com/science/article/B6WG1-4T91MW8-1/2/3da4e4d6151bab73b58a9b3f6c00a4ca}
}
@ARTICLE{murphy_development_2007,
author = {Murphy, Mary and Corcoran, Deborah and Buckley, James F and {O'Mahony},
Micheál and Whyte, Paul and Fanning, S\'{e}amus},
title = {Development and application of Multiple-Locus Variable number of
tandem repeat Analysis {(MLVA)} to subtype a collection of \emph{{Listeria
monocytogenes}}},
journal = {International Journal of Food Microbiology},
year = {2007},
volume = {115},
pages = {187--194},
number = {2},
month = apr,
note = {{PMID:} 17174430},
abstract = {In this study we report the development and application of a Multiple-Locus
Variable number of tandem repeat Analysis {(MLVA)} strategy for subtyping
\emph{{Listeria monocytogenes}}. Genome profiles of a collection of forty-five
food-borne \emph{{L. monocytogenes}} isolates were compared using {MLVA.}
These isolates were obtained as part of an active surveillance programme
of foods in the south-east region of Ireland. {MLVA} successfully
discriminated amongst the isolates. The method was easy to perform,
relatively fast and could be deployed in any molecular laboratory
with basic laboratory equipment. This approach is a valuable tool,
which has the capability to provide comparable results when compared
with other more established typing methods, including pulsed-field
gel electrophoresis {(PFGE).}},
doi = {10.1016/j.ijfoodmicro.2006.10.022},
issn = {0168-1605},
keywords = {Bacterial Typing Techniques, Base Sequence, Cluster Analysis, Disease
Outbreaks, {DNA}, Bacterial, Electrophoresis, Gel, Pulsed-Field,
Food Microbiology, Humans, \emph{{Listeria monocytogenes}}, Minisatellite
Repeats, Sequence Homology, Nucleic Acid},
lccn = {0009},
url = {http://www.ncbi.nlm.nih.gov/pubmed/17174430}
}
@ARTICLE{muzzi_pan-genome:_2007,
author = {Muzzi, Alessandro and Masignani, Vega and Rappuoli, Rino},
title = {The pan-genome: towards a knowledge-based discovery of novel targets
for vaccines and antibacterials},
journal = {Drug Discovery Today},
year = {2007},
volume = {12},
pages = {429--439},
number = {11-12},
month = jun,
abstract = {During the past decade, sequencing of the entire genome of pathogenic
bacteria has become a widely used practice in microbiology research.
More recently, sequence data from multiple isolates of a single pathogen
have provided new insights into the microevolution of a species as
well as helping researchers to decipher its virulence mechanisms.
The comparison of multiple strains of a single species has resulted
in the definition of the species pan-genome, as a measure of the
total gene repertoire that can pertain to a given microorganism.
This concept can be exploited not only to study the diversity of
a species, but also, as we discuss here, to provide the opportunity
to use a knowledge-based approach for the development of novel vaccine
candidates and new-generation targets for antimicrobials.},
doi = {10.1016/j.drudis.2007.04.008},
issn = {1359-6446},
shorttitle = {The pan-genome},
url = {http://www.sciencedirect.com/science/article/B6T64-4NNPCRR-1/2/6acae7cc0d624bdeb372b1ef43ed2d08}
}
@MISC{kendra_nightingale_listeria_2010,
author = {Kendra Nightingale},
title = {\emph{{Listeria monocytogenes}}: Knowledge Gained Through {DNA} Sequence-Based
Subtyping, Implications, and Future Considerations},
howpublished = {http://www.atypon-{link.com/AOAC/doi/abs/10.5555/jaoi.93.4.12}},
month = jun,
year = {2010},
note = {Abstract The purpose of subtyping is to differentiate bacterial isolates
beyond the classification of species or subspecies. Subtyping methods
can be grouped into two broad categories based on the cellular components
targeted: (1) phenotypic subtyping methods that differentiate isolates
by the enzymes, proteins, or other metabolites expressed by the cell,
and (2) molecular subtyping methods that discriminate isolates based
on interrogation of nucleic acid sequences. The two major types of
molecular subtyping methods include band-based methods based on fragment
pattern data or {DNA} fingerprints, and methods that generate {DNA}
sequence data. Molecular subtyping methods have shown that \emph{{Listeria}}
monocytogenes isolates can be classified into four genetic lineages
or divisions. Although band-based molecular subtyping methods continue
to serve as the gold standard for routine molecular subtyping of
most clinically important foodborne pathogens, including \emph{{L. monocytogenes}},
the explosion of recently completed and on...},
copyright = {c {AOAC} International},
shorttitle = {\emph{{Listeria monocytogenes}}},
type = {research-article},
url = {http://www.atypon-link.com/AOAC/doi/abs/10.5555/jaoi.93.4.12}
}
@ARTICLE{nightingale_listeria_2010,
author = {Nightingale, Kendra},
title = {\emph{{Listeria monocytogenes}}: knowledge gained through {DNA} sequence-based
subtyping, implications, and future considerations},
journal = {Journal of {AOAC} International},
year = {2010},
volume = {93},
pages = {1275--1286},
number = {4},
month = aug,
note = {{PMID:} 20922962},
abstract = {The purpose of subtyping is to differentiate bacterial isolates beyond
the classification of species or subspecies. Subtyping methods can
be grouped into two broad categories based on the cellular components
targeted: (1) phenotypic subtyping methods that differentiate isolates
by the enzymes, proteins, or other metabolites expressed by the cell,
and (2) molecular subtyping methods that discriminate isolates based
on interrogation of nucleic acid sequences. The two major types of
molecular subtyping methods include band-based methods based on fragment
pattern data or {DNA} fingerprints, and methods that generate {DNA}
sequence data. Molecular subtyping methods have shown that \emph{{Listeria}}
monocytogenes isolates can be classified into four genetic lineages
or divisions. Although band-based molecular subtyping methods continue
to serve as the gold standard for routine molecular subtyping of
most clinically important foodborne pathogens, including \emph{{L. monocytogenes}},
the explosion of recently completed and ongoing {DNA} sequencing
projects, and thus available {DNA} sequence data, have stimulated
efforts to develop highly discriminatory and high-throughput {DNA}
sequence-based subtyping methods for \emph{{L. monocytogenes}}. \emph{{L. monocytogenes}}
represents one of the most highly sequenced human pathogens; more
than 20 genome sequences are currently available for this organism.
This review provides an overview of the concepts behind subtyping
and discusses the application of molecular subtyping methods, with
an emphasis on {DNA} sequence-based subtyping methods to characterize
\emph{{L. monocytogenes}.}},
issn = {1060-3271},
keywords = {Bacterial Typing Techniques, {DNA}, Bacterial, \emph{{Listeria monocytogenes}},
Minisatellite Repeats, Polymorphism, Single Nucleotide, Sequence
Analysis, {DNA}},
shorttitle = {\emph{{Listeria monocytogenes}}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/20922962}
}
@ARTICLE{nightingale_inla_2008,
author = {Nightingale, K K and Ivy, R A and Ho, A J and Fortes, E D and Njaa,
B L and Peters, R M and Wiedmann, M},
title = {{inlA} premature stop codons are common among \emph{{Listeria monocytogenes}}
isolates from foods and yield virulence-attenuated strains that confer
protection against fully virulent strains},
journal = {Applied and Environmental Microbiology},
year = {2008},
volume = {74},
pages = {6570--6583},
number = {21},
month = nov,
note = {{PMID:} 18791029},
abstract = {Previous studies showed that a considerable proportion of \emph{{Listeria}}
monocytogenes isolates obtained from foods carry a premature stop
codon {(PMSC)} mutation in {inlA} that leads to production of a truncated
and secreted {InlA.} To further elucidate the role these mutations
play in virulence of \emph{{L. monocytogenes}}, we created isogenic mutants,
including (i) natural isolates where an {inlA} {PMSC} was reverted
to a wild-type {inlA} allele (without a {PMSC)} and (ii) natural
isolates where a {PMSC} mutation was introduced into a wild-type
{inlA} allele; isogenic mutant sets were constructed to represent
two distinct {inlA} {PMSC} mutations. Phenotypical and transcriptional
analysis data showed that {inlA} {PMSC} mutations do not have a polar
effect on the downstream {inlB.} Isogenic and natural strains carrying
an {inlA} {PMSC} showed significantly reduced invasion efficiencies
in Caco-2 and {HepG2} cell lines as well as reduced virulence in
oral guinea pig infections. Guinea pigs were also orally infected
with a natural strain carrying the most common {inlA} {PMSC} mutation
(vaccinated group), followed by challenge with a fully virulent \emph{{L.
monocytogenes}} strain 15 days postvaccination to probe potentially
immunizing effects of exposure to \emph{{L. monocytogenes}} with {inlA} {PMSC}
mutations. Vaccinated guinea pigs showed reduced bacterial loads
in internal organs and improved weight gain postchallenge, indicating
reduced severity of infections in guinea pigs exposed to natural
strains with {inlA} {PMSC} mutations. Our data support that (i) {inlA}
{PMSC} mutations are causally associated with attenuated virulence
in mammalian hosts and (ii) naturally occurring virulence-attenuated
\emph{{L. monocytogenes}} strains commonly found in food confer protective
immunity.},
doi = {10.1128/AEM.00997-08},
issn = {1098-5336},
keywords = {Animal Structures, Bacterial Proteins, Body Weight, Cell Line, Codon,
Nonsense, Colony Count, Microbial, Food Microbiology, Guinea Pigs,
Listeria Infections, \emph{{Listeria monocytogenes}}, Virulence},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18791029}
}
@ARTICLE{nightingale_evolution_2005,
author = {Nightingale, K. K. and Windham, K. and Wiedmann, M.},
title = {Evolution and Molecular Phylogeny of \emph{{Listeria monocytogenes}} Isolated
from Human and Animal Listeriosis Cases and Foods},
journal = {Journal of Bacteriology},
year = {2005},
volume = {187},
pages = {5537--5551},
number = {16},
month = aug,
note = {{PMID:} 16077098 {PMCID:} 1196091},
abstract = {To probe the evolution and phylogeny of \emph{{Listeria monocytogenes}} from
defined host species and environments, \emph{{L. monocytogenes}} isolates
from human (n = 60) and animal (n = 30) listeriosis cases and food
samples (n = 30) were randomly selected from a larger collection
of isolates (n = 354) obtained in New York State between 1999 and
2001. Partial sequencing of four housekeeping genes (gap, prs, {purM},
and {ribC)}, one stress response gene {(sigB)}, and two virulence
genes {(actA} and {inlA)} revealed between 11 (gap) and 33 {(inlA)}
allelic types as well as 52 sequence types (unique combination of
allelic types). {actA}, {ribC}, and {purM} demonstrated the highest
levels of nucleotide diversity (Ï€ {\textgreater} 0.05). {actA} and
{inlA} as well as prs and the hypervariable housekeeping genes {ribC}
and {purM} showed evidence of horizontal gene transfer and recombination.
{actA} and {inlA} also showed evidence of positive selection at specific
amino acid sites. Maximum likelihood phylogenies for all seven genes
confirmed that \emph{{L. monocytogenes}} contains two deeply separated evolutionary
lineages. Lineage I was found to be highly clonal, while lineage
{II} showed greater diversity and evidence of horizontal gene transfer.
Allelic types were exclusive to lineages, except for a single gap
allele, and nucleotide distance within lineages was much lower than
that between lineages, suggesting that genetic exchange between lineages
is rare. Our data show that (i) \emph{{L. monocytogenes}} is a highly diverse
species with at least two distinct phylogenetic lineages differing
in their evolutionary history and population structure and (ii) horizontal
gene transfer as well as positive selection contributed to the evolution
of \emph{{L. monocytogenes}.}},
doi = {10.1128/JB.187.16.5537-5551.2005},
issn = {0021-9193},
lccn = {0068}
}
@ARTICLE{olsen_multistate_2005,
author = {Olsen, Sonja J. and Patrick, Mary and Hunter, Susan B. and Reddy,
Vasudha and Kornstein, Laura and {MacKenzie}, William R. and Lane,
Kimberly and Bidol, Sally and Stoltman, Gillian A. and Frye, Douglas
M. and Lee, Irene and Hurd, Sharon and Jones, Timothy F. and {LaPorte},
Tracy N. and Dewitt, Wallis and Graves, Lewis and Wiedmann, Martin
and Schoonmaker-Bopp, Dianna J. and Huang, Ada J. and Vincent, Curt
and Bugenhagen, Al and Corby, Joe and Carloni, Edmund R. and Holcomb,
Mara E. and Woron, Raymond F. and Zansky, Shelley M. and Dowdle,
Gerrie and Smith, Forrest and Ahrabi-Fard, Susann and Ong, Anna Rae
and Tucker, Nicole and Hynes, Noreen A. and Mead, Paul},
title = {Multistate Outbreak of \emph{{Listeria monocytogenes}} Infection Linked to
Delicatessen Turkey Meat},
journal = {Clinical Infectious Diseases},
year = {2005},
volume = {40},
pages = {962 --967},
number = {7},
month = apr,
abstract = {Background. Despite a decreasing incidence of listeriosis in the United
States, molecular subtyping has increased the number of recognized
outbreaks. In September 2000, the New York City Department of Health
identified a cluster of infections caused by \emph{{Listeria monocytogenes}}
isolates with identical molecular subtypes by pulsed-field gel electrophoresis
{(PFGE)} and {ribotyping.Methods.} To determine the magnitude of
the outbreak and identify risk factors for infection, we notified
state health departments and conducted a case-control study. A case
was defined as a patient or mother-infant pair infected with \emph{{Listeria}}
monocytogenes whose isolate yielded the outbreak {PFGE} pattern.
Controls were patients infected with \emph{{Listeria monocytogenes}} whose
isolate yielded a different {PFGE} pattern. Patients were asked about
food and drink consumed during the 30 days before the onset of {illness.Results.}
Between May and December 2000, there were 30 clinical isolates of
\emph{{Listeria monocytogenes}} with identical {PFGE} patterns identified
in 11 {US} states. Cases of infection caused by these isolates were
associated with 4 deaths and 3 miscarriages. A case-control study
implicated sliced processed turkey from a delicatessen {(Mantel-Haenszel}
odds ratio, 8.0; 95\% confidence interval, 1.2--43.3). A traceback
investigation identified a single processing plant as the likely
source of the outbreak, and the company voluntarily recalled 16 million
pounds of processed meat. The same plant had been identified in a
Listeria contamination event that had occurred more than a decade
{previously.Conclusions.} Prevention of persistent \emph{{L. monocytogenes}}
contamination in food processing plants presents a critical challenge
to food safety professionals.},
doi = {10.1086/428575},
lccn = {0066},
url = {http://cid.oxfordjournals.org/content/40/7/962.abstract}
}
@ARTICLE{orsi_listeria_2011,
author = {Orsi, Renato H. and Bakker, Henk C. den and Wiedmann, Martin},
title = {\emph{{Listeria monocytogenes}} lineages: Genomics, evolution, ecology, and
phenotypic characteristics},
journal = {International Journal of Medical Microbiology},
year = {2011},
volume = {301},
pages = {79--96},
number = {2},
month = feb,
abstract = {\emph{{Listeria monocytogenes}} consists of at least 4 evolutionary lineages
{(I}, {II}, {III}, and {IV)} with different but overlapping ecological
niches. Most \emph{{L. monocytogenes}} isolates seem to belong to lineages
I and {II}, which harbor the serotypes more commonly associated with
human clinical cases, including serotype 1/2a (lineage {II)} and
serotypes 1/2b and 4b (lineage I). Lineage {II} strains are common
in foods, seem to be widespread in the natural and farm environments,
and are also commonly isolated from animal listeriosis cases and
sporadic human clinical cases. Most human listeriosis outbreaks are
associated with lineage I isolates though. In addition, a number
of studies indicate that, in many countries, lineage I strains are
overrepresented among human isolates, as compared to lineage {II}
strains. Lineage {III} and {IV} strains on the other hand are rare
and predominantly isolated from animal sources. The apparent differences
in the distribution of strains representing the \emph{{L. monocytogenes}}
lineages has lead to a number of studies aimed at identifying phenotypic
differences among the different lineages. Interestingly, lineage
{II} isolates seem to carry more plasmids than lineage I isolates
and these plasmids often confer resistance to toxic metals and possibly
other compounds that may be found in the environment. Moreover, lineage
{II} isolates seem to be more resistant to bacteriocins than lineage
I isolates, which probably confers an advantage in environments where
bacteriocin-producing organisms are abundant. A large number of lineage
{II} isolates and strains have been shown to be virulence-attenuated
due to premature stop codon mutations in {inlA} and mutations in
{prfA.} A subset of lineage I isolates carry a listeriolysin S hemolysin,
which is not present in isolates belonging to lineages {II}, {III},
or {IV.} While lineage {II} isolates also show higher recombination
rates than lineage I isolates, possibly facilitating adaptation of
lineage {II} strains to diverse environments, lineage I isolates
are clonal and show a low prevalence of plasmids and {IS} elements,
suggesting that lineage I isolates may have mechanisms that limit
the acquisition of foreign {DNA} by horizontal gene transfer. Diversifying
selection has also been shown to have played an important role during
evolution of the \emph{{L. monocytogenes}} lineages and during divergence
of \emph{{L. monocytogenes}} from the non-pathogenic species L. innocua. Overall
evidence thus suggests that the 4 \emph{{L. monocytogenes}} lineages identified
so far represent distinct ecologic, genetic, and phenotypic characteristics,
which appear to affect their ability to be transmitted through foods
and to cause human disease. Further insights into the ecology, evolution,
and characteristics of these lineages will thus not only provide
an improved understanding of the evolution of this foodborne pathogen,
but may also facilitate improved control of foodborne listeriosis.},
doi = {10.1016/j.ijmm.2010.05.002},
issn = {1438-4221},
keywords = {Ecology, Epidemiology, Evolution, Genomics, \emph{{Listeria monocytogenes}}},
shorttitle = {\emph{{Listeria monocytogenes}} lineages},
url = {http://www.sciencedirect.com/science/article/B7GW0-50S8C4X-1/2/40b2c2937226bd0ccbc0ac24a42a00ec}
}
@ARTICLE{orsi_lineage_2008,
author = {Orsi, Renato H. and Maron, Steven B. and Nightingale, Kendra K. and
Jerome, Morganne and Tabor, Helen and Wiedmann, Martin},
title = {Lineage specific recombination and positive selection in coding and
intragenic regions contributed to evolution of the main \emph{{Listeria
monocytogenes}} virulence gene cluster},
journal = {Infection, genetics and evolution : journal of molecular epidemiology
and evolutionary genetics in infectious diseases},
year = {2008},
volume = {8},
pages = {566--576},
number = {5},
month = sep,
note = {{PMID:} 18499533 {PMCID:} 2584615},
abstract = {The major virulence cluster of \emph{{Listeria monocytogenes}} harbors six
virulence genes that encode proteins critical for the intracellular
life cycle of this human and animal pathogen. In this study, we determined
the sequence (8,709 nt) of the virulence gene cluster (including
the six main virulence genes) in 40 \emph{{L. monocytogenes}} isolates from
different source populations (human clinical cases, animal clinical
cases, foods, and natural environments). An alignment of the full
length cluster as well as individual gene alignments and alignments
of intragenic regions were used for phylogenetic, recombination,
and positive selection analyses. Initial phylogenetic analyses showed
that the sequences represented two main clusters, consistent with
previously defined \emph{{L. monocytogenes}} phylogenetic lineages. The 40
sequences represented 25 distinct allelic types and the overall alignment
included 592 polymorphic sites. Overall, our data show that (i) virulence
genes in the main \emph{{L. monocytogenes}} virulence gene cluster include
highly conserved genes (i.e., hly, {prfA)} as well as diverse genes
that appear to have evolved by positiveselection (mpl, {actA}, {plcA)},
(ii) recombination has played an important role in the evolution
of the virulence gene cluster, but is limited to lineage {II} isolates,
and (iii) the promoter region driving the transcription of virulence
genes transcribed early in intracellular infection (i.e., hly, {plcA)}
has evolved by positive selection. The genes and intragenic regions
in the \emph{{L. monocytogenes}} virulence gene cluster thus have evolved
independently, despite their close physical linkage, likely reflecting
distinct selective pressures associated with expression and function
of the proteins encoded in this region.},
doi = {10.1016/j.meegid.2008.04.006},
issn = {1567-1348},
lccn = {0005}
}
@ARTICLE{orsi_genome-wide_2008,
author = {Orsi, Renato H and Sun, Qi and Wiedmann, Martin},
title = {Genome-wide analyses reveal lineage specific contributions of positive
selection and recombination to the evolution of \emph{{Listeria monocytogenes}}},
journal = {{BMC} Evolutionary Biology},
year = {2008},
volume = {8},
pages = {233--233},
note = {{PMID:} 18700032 {PMCID:} 2532693},
doi = {10.1186/1471-2148-8-233},
lccn = {0017}
}
@ARTICLE{parisi_amplified_2010,
author = {Parisi, Antonio and Latorre, Laura and Normanno, Giovanni and Miccolupo,
Angela and Fraccalvieri, Rosa and Lorusso, Vanessa and Santagada,
Gianfranco},
title = {Amplified Fragment Length Polymorphism and Multi-Locus Sequence Typing
for high-resolution genotyping of \emph{{Listeria monocytogenes}} from foods
and the environment},
journal = {Food Microbiology},
year = {2010},
volume = {27},
pages = {101--108},
number = {1},
month = feb,
abstract = {Standardized tools for typing \emph{{Listeria monocytogenes}} isolates are
required in epidemiological surveys investigating food-borne disease
outbreaks and in the food-processing environment to identify the
sources of contamination and routes by which the organisms are spread.
In this survey Amplified Fragment Length Polymorphism {(AFLP)} and
Multi-Locus Sequence Typing {(MLST)} have been used to study 103
L. monocytogenes isolates from food and environmental sources. A
total of 62 {AFLP} types and 66 {MLST} Sequence Types were identified.
{AFLP} and {MLST} produced similar results in terms of discriminating
power. The Discrimination Index calculated for the two techniques
was 0.976 for {AFLP} and 0.972 for {MLST.} These values were appreciably
higher compared to serotyping (0.739). A good congruence was observed
between {AFLP} and {MLST.} The present study demonstrated that {AFLP}
and {MLST} subtyping are suitable tools for studying the epidemiology
of \emph{{L. monocytogenes}}. The great advantage of {MLST} over {AFLP} and
other molecular typing methods based on fragment fingerprinting lies
in the unambiguity of sequence data while {AFLP} is less costly and
highly processive. In conclusion the two methods can be perfectly
integrated for high-resolution genotyping of \emph{{L. monocytogenes}.}},
doi = {10.1016/j.fm.2009.09.001},
issn = {0740-0020},
keywords = {Amplified Fragment Length Polymorphism, {DNA} Fingerprinting, \emph{{Listeria}}
monocytogenes, Molecular Typing, Multi-Locus Sequence Typing},
url = {http://www.sciencedirect.com/science/article/pii/S0740002009001993}
}
@ARTICLE{pop_bioinformatics_2008,
author = {Pop, Mihai and Salzberg, Steven L},
title = {Bioinformatics challenges of new sequencing technology},
journal = {Trends in Genetics: {TIG}},
year = {2008},
volume = {24},
pages = {142--149},
number = {3},
month = mar,
note = {{PMID:} 18262676},
abstract = {New {DNA} sequencing technologies can sequence up to one billion bases
in a single day at low cost, putting large-scale sequencing within
the reach of many scientists. Many researchers are forging ahead
with projects to sequence a range of species using the new technologies.
However, these new technologies produce read lengths as short as
35-40 nucleotides, posing challenges for genome assembly and annotation.
Here we review the challenges and describe some of the bioinformatics
systems that are being proposed to solve them. We specifically address
issues arising from using these technologies in assembly projects,
both de novo and for resequencing purposes, as well as efforts to
improve genome annotation in the fragmented assemblies produced by
short read lengths.},
doi = {10.1016/j.tig.2007.12.006},
issn = {0168-9525},
keywords = {Animals, Computational Biology, Genome, Humans, Sequence Analysis,
{DNA}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18262676}
}
@ARTICLE{rasmussen_listeria_1995,
author = {Rasmussen, O F and Skouboe, P and Dons, L and Rossen, L and Olsen,
J E},
title = {\emph{{Listeria monocytogenes}} exists in at least three evolutionary lines:
evidence from flagellin, invasive associated protein and listeriolysin
{O} genes},
journal = {Microbiology},
year = {1995},
volume = {141},
number = {9},
pages = {2053--2061},
month = sep,
note = {{PMID:} 7496516},
abstract = {Regions of the genes encoding flagellin {(flaA)}, the invasive associated
protein (iap), listeriolysin O (hly) and {23S} {rRNA} were sequenced
for a range of \emph{{Listeria monocytogenes}} isolates of different origin
and serotypes. Several nucleotide sequence variations were found
in the {flaA}, iap and hly genes. No differences were found for the
{rRNA} genes, but our approach does not exclude the existence of
differences between single copies of these genes. Based on the sequence
differences, the \emph{{L. monocytogenes}} strains can be divided into three
distinct sequence types. Further, the presence of only a small number
of sequence differences within each group indicates a strong degree
of conservation within the groups. There was a complete correspondence
among the groups of strains formed according to the analysis of the
{flaA}, iap and hly genes, and the grouping correlates with serotype,
pulsed field gel electrophoretic and multilocus enzyme electrophoretic
data. Analysis of the region encoding the threonine-asparagine repeat
units in the iap gene revealed some striking features. Sequence type
1 strains were found to have 16-17 repeats, sequence type 2 strains
had 16-20 repeats whereas the two sequence type 3 strains analysed
had only 11 repeats. Furthermore, within a 19 bp segment there was
a 37\% difference between the sequences of type 1 and 2 strains and
that segment was absent in type 3 strains. Within the threonine-asparagine
repeat region the nucleotide differences gave rise to four amino
acid changes; however, all were changes among the three amino acids
present in the repeat structure indicating a strong selective pressure
on the composition of this region.},
issn = {1350-0872},
keywords = {Animals, Bacterial Proteins, Bacterial Toxins, Bacterial Typing Techniques,
Base Sequence, Evolution, Molecular, Flagellin, Genes, Bacterial,
Heat-Shock Proteins, Hemolysin Proteins, Humans, \emph{{Listeria monocytogenes}},
Molecular Sequence Data, Repetitive Sequences, Nucleic Acid, {RNA},
Bacterial, {RNA}, Ribosomal, {23S}, Sequence Alignment, Sequence
Homology, Nucleic Acid, Species Specificity},
lccn = {0106},
shorttitle = {\emph{{Listeria monocytogenes}} exists in at least three evolutionary lines},
url = {http://www.ncbi.nlm.nih.gov/pubmed/7496516}
}
@ARTICLE{rhoades_prevalence_2009,
author = {Rhoades, {J.R.} and Duffy, G. and Koutsoumanis, K.},
title = {Prevalence and concentration of verocytotoxigenic \emph{{Escherichia coli}},
\emph{{Salmonella enterica}} and \emph{{Listeria monocytogenes}} in the beef production
chain: A review},
journal = {Food Microbiology},
year = {2009},
volume = {26},
pages = {357--376},
number = {4},
month = jun,
abstract = {This review examines the prevalence of three important pathogens,
verocytotoxigenic \emph{{Escherichia coli}} {(VTEC)}, Salmonella enterica
and \emph{{Listeria monocytogenes}}, in cattle and beef from the farm to the
final, ready-to-eat product. Factors affecting prevalence of pathogens
in the beef chain, such as the season and cattle rearing method,
are examined. Data from many key surveys are summarized in table
form.
The observed prevalence of pathogens in cattle and beef varies considerably
from survey to survey. An indication of relative prevalence of pathogens
at different stages can be obtained by calculating average prevalences
observed over multiple surveys, weighted by sample number. Based
on the data presented in the tables in this review, for \emph{{E. coli}} {O157}
at selected processing stages the mean prevalences (and range of
means from individual surveys) are faeces 6.2\% (0.0--57\%), hides
44\% (7.3--76\%), chilled carcasses 0.3\% (0.0--0.5\%), and raw
beef products 1.2\% (0.0--17\%). For Salmonella the mean prevalence
data are faeces 2.9\% (0.0--5.5\%), hides 60\% (15--71\%), chilled
carcasses 1.3\% (0.2--6.0\%), and raw beef products 3.8\% (0.0--7.5\%).
For \emph{{L. monocytogenes}} the mean prevalence data are faeces 19\% (4.8--29\%),
hides 12\% (10--13\%), and raw beef products 10\% (1.6--24\%).
Seasonal variation was evident in many surveys, faecal prevalences
of E. coli {O157} and Salmonella generally being higher in the warmer
months. The influence of animal type, animal age, feed and housing
on pathogen carriage has also been examined. The significance of
non-{O157} serotypes of {VTEC} and their detection and classification
are discussed.},
doi = {10.1016/j.fm.2008.10.012},
issn = {0740-0020},
keywords = {Beef production chain, \emph{{Listeria monocytogenes}}, Review, Salmonella
enterica, Verocytotoxigenic \emph{{Escherichia coli}}},
shorttitle = {Prevalence and concentration of verocytotoxigenic \emph{{Escherichia coli}},
Salmonella enterica and \emph{{Listeria monocytogenes}} in the beef production
chain},
url = {http://www.sciencedirect.com/science/article/pii/S0740002008002165}
}
@ARTICLE{roberts_genetic_2006,
author = {Roberts, Angela and Nightingale, Kendra and Jeffers, Greg and Fortes,
Esther and Kongo, Jose Marcelino and Wiedmann, Martin},
title = {Genetic and phenotypic characterization of \emph{{Listeria monocytogenes}}
lineage {III}},
journal = {Microbiology},
year = {2006},
volume = {152},
pages = {685--693},
number = {3},
month = mar,
abstract = {\emph{{Listeria monocytogenes}} has been previously grouped into three evolutionary
groups, termed lineages I, {II} and {III.} While lineages I and {II}
are commonly isolated from various sources, lineage {III} isolates
are rare and have several atypical and unique phenotypic characteristics.
Relative to their prevalence in other sources, lineage {III} strains
are overrepresented among isolates from food-production animals,
and underrepresented among isolates from human clinical cases and
foods. This work describes an extensive genotypic and phenotypic
characterization of 46 lineage {III} isolates. Phylogenetic analyses
of partial {sigB} and {actA} sequences showed that lineage {III}
represents three distinct subgroups, which were termed {IIIA}, {IIIB}
and {IIIC.} Each of these lineage {III} subgroups is characterized
by differentiating genotypic and phenotypic characteristics. Unlike
typical \emph{{L. monocytogenes}}, all subgroup {IIIB} and {IIIC} isolates
lack the ability to ferment rhamnose. While all {IIIC} and most {IIIB}
isolates carry the putative virulence gene {lmaA}, the majority of
subgroup {IIIA} isolates lack this gene. All three lineage {III}
subgroups contain isolates from human clinical cases as well as isolates
that are cytopathogenic in a cell culture plaque assay, indicating
that lineage {III} isolates have the potential to cause human disease.
The identification of specific genotypic and phenotypic characteristics
among the three lineage {III} subgroups suggests that these subgroups
may occupy different ecological niches and, therefore, may be transmitted
by different pathways.},
doi = {10.1099/mic.0.28503-0},
lccn = {0034},
url = {http://mic.sgmjournals.org/cgi/content/abstract/152/3/685}
}
@PHDTHESIS{ross_development_2010,
author = {Ross, Susan},
title = {Development of comparative genomic fingerprinting for molecular epidemiological
studies of \emph{{Campylobacter jejuni}}},
school = {University of Lethbridge, Dept. of Biological Sciences},
year = {2010},
type = {Thesis},
note = {xii, 184 leaves : ill. ; 29 cm},
abstract = {This thesis reports the development of Comparative Genomic Fingerprinting
{(CGF)}, a rapid genotyping method for \emph{{Campylobacter jejuni}} that
assesses the conservation status of 20 genes previously described
as having high intraspecies variability based on comparative genomics
studies. This novel method for genotyping \emph{{C. jejuni}}, {CGF} was validated
two-fold. First, by comparison to {flaA} restriction fragment length
polymorphism analysis, and second a subset of isolates was validated
using two higher resolution {CGF} assays assessing 35 and 119 genes.
{CGF} was then tested in a molecular epidemiological study of C.
jejuni isolated from environmental, animal and human clinical samples
from southern Alberta. Reservoirs of infection, subtypes associated
with higher incidence of human infection, and the persistence of
prevalent subtypes in animal/environmental reservoirs were identified.
This thesis demonstrates that {CGF} analysis is robust and can be
used to rapidly assess genetic similarity of \emph{{C. jejuni}} isolates and
to detect epidemiologically relevant clonal groups.},
keywords = {Academic, \emph{{Campylobacter}} infections -- Research -- Alberta, \emph{{Campylobacter}}
jejuni -- Research -- Alberta, Dissertations, Molecular Epidemiology,
Southern},
url = {http://www.uleth.ca/dspace/handle/10133/2485}
}
@ARTICLE{sanger_dna_1977,
author = {Sanger, F. and Nicklen, S. and Coulson, A. R.},
title = {{DNA} sequencing with chain-terminating inhibitors},
journal = {Proceedings of the National Academy of Sciences of the United States
of America},
year = {1977},
volume = {74},
pages = {5463 --5467},
number = {12},
month = dec,
abstract = {A new method for determining nucleotide sequences in {DNA} is described.
It is similar to the “plus and minus� method {[Sanger}, F. \&
Coulson, A. R. (1975) J. Mol. Biol. 94, 441-448] but makes use of
the 2′,3′-dideoxy and arabinonucleoside analogues of the normal
deoxynucleoside triphosphates, which act as specific chain-terminating
inhibitors of {DNA} polymerase. The technique has been applied to
the {DNA} of bacteriophage {ϕX174} and is more rapid and more accurate
than either the plus or the minus method.},
url = {http://www.pnas.org/content/74/12/5463.abstract}
}
@ARTICLE{schmid_evolutionary_2005,
author = {Schmid, Michael W and Ng, Eva Y W and Lampidis, Robert and Emmerth,
Melanie and Walcher, Marion and Kreft, J\"{u}rgen and Goebel, Werner
and Wagner, Michael and Schleifer, Karl-Heinz},
title = {Evolutionary history of the genus \emph{{Listeria}} and its virulence genes},
journal = {Systematic and Applied Microbiology},
year = {2005},
volume = {28},
pages = {1--18},
number = {1},
month = jan,
note = {{PMID:} 15709360},
abstract = {The genus \emph{{Listeria}} contains the two pathogenic species \emph{{Listeria monocytogenes}}
and \emph{{Listeria}} ivanovii and the four apparently apathogenic species
Listeria innocua, \emph{{Listeria}} seeligeri, \emph{{Listeria}} welshimeri, and \emph{{Listeria}}
grayi. Pathogenicity of the former two species is enabled by an approximately
9 kb virulence gene cluster which is also present in a modified form
in L. seeligeri. For all \emph{{Listeria}} species, the sequence of the virulence
gene cluster locus and its flanking regions was either determined
in this study or assembled from public databases. Furthermore, some
virulence-associated internalin loci were compared among the six
species. Phylogenetic analyses were performed on a data set containing
the sequences of prs, ldh, {vclA}, and {vclB} (all directly flanking
the virulence gene cluster), as well as the iap gene and the {16S}
and {23S-rRNA} coding genes which are located at different sites
in the listerial chromosomes. L. grayi represents the deepest branch
within the genus. The remaining five species form two groupings which
have a high bootstrap support and which are consistently found by
using different treeing methods. One lineage represents \emph{{L. monocytogenes}}
and L. innocua, while the other contains L. welshimeri, L. ivanovii
and L. seeligeri, with L. welshimeri forming the deepest branch.
Based on this perception, we tried to reconstruct the evolution of
the virulence gene cluster. Since no traces of lateral gene transfer
events could be detected the most parsimonious scenario is that the
virulence gene cluster was present in the common ancestor of \emph{{L. monocytogenes}},
L. innocua, L. ivanovii, L. seeligeri and L. welshimeri and that
the pathogenic capability has been lost in two separate events represented
by L. innocua and L. welshimeri. This hypothesis is also supported
by the location of the putative deletion breakpoints of the virulence
gene cluster within L. innocua and L. welshimeri.},
issn = {0723-2020},
keywords = {Bacterial Proteins, {DNA}, Bacterial, {DNA}, Ribosomal, Evolution,
Molecular, Gene Deletion, Genes, Bacterial, Genes, {rRNA}, Lipoproteins,
Listeria, Molecular Sequence Data, Multigene Family, Phylogeny, {RNA},
Ribosomal, {16S}, {RNA}, Ribosomal, {23S}, Sequence Analysis, {DNA},
Virulence, Virulence Factors},
lccn = {0034},
url = {http://www.ncbi.nlm.nih.gov/pubmed/15709360}
}
@ARTICLE{shendure_next-generation_2008,
author = {Shendure, Jay and Ji, Hanlee},
title = {Next-generation {DNA} sequencing},
journal = {Nat Biotech},
year = {2008},
volume = {26},
pages = {1135--1145},
number = {10},
month = oct,
doi = {10.1038/nbt1486},
issn = {1087-0156},
url = {http://dx.doi.org/10.1038/nbt1486}
}
@ARTICLE{shendure_accurate_2005,
author = {Shendure, Jay and Porreca, Gregory J and Reppas, Nikos B and Lin,
Xiaoxia and {McCutcheon}, John P and Rosenbaum, Abraham M and Wang,
Michael D and Zhang, Kun and Mitra, Robi D and Church, George M},
title = {Accurate multiplex polony sequencing of an evolved bacterial genome},
journal = {Science {(New} York, {N.Y.)}},
year = {2005},
volume = {309},
pages = {1728--1732},
number = {5741},
month = sep,
note = {{PMID:} 16081699},
abstract = {We describe a {DNA} sequencing technology in which a commonly available,
inexpensive epifluorescence microscope is converted to rapid nonelectrophoretic
{DNA} sequencing automation. We apply this technology to resequence
an evolved strain of \emph{{Escherichia coli}} at less than one error per
million consensus bases. A cell-free, mate-paired library provided
single {DNA} molecules that were amplified in parallel to 1-micrometer
beads by emulsion polymerase chain reaction. Millions of beads were
immobilized in a polyacrylamide gel and subjected to automated cycles
of sequencing by ligation and four-color imaging. Cost per base was
roughly one-ninth as much as that of conventional sequencing. Our
protocols were implemented with off-the-shelf instrumentation and
reagents.},
annote = {{ABI} {SOLiD} paper},
doi = {10.1126/science.1117389},
issn = {1095-9203},
keywords = {Acrylic Resins, Algorithms, Automation, Costs and Cost Analysis, {DNA}
Ligases, {DNA} Primers, {DNA}, Bacterial, \emph{{Escherichia coli}}, Evolution,
Molecular, Fluorescent Dyes, Gels, Gene Library, Genome, Bacterial,
Microscopy, Fluorescence, Microspheres, Mutation, Nucleic Acid Hybridization,
Point Mutation, Polymerase Chain Reaction, Sequence Analysis, {DNA}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16081699}
}
@ARTICLE{snipen_microbial_2009,
author = {Snipen, Lars and Almøy, Trygve and Ussery, David W},
title = {Microbial comparative pan-genomics using binomial mixture models},
journal = {{BMC} Genomics},
year = {2009},
volume = {10},
pages = {385},
note = {{PMID:} 19691844},
abstract = {{BACKGROUND:} The size of the core- and pan-genome of bacterial species
is a topic of increasing interest due to the growing number of sequenced
prokaryote genomes, many from the same species. Attempts to estimate
these quantities have been made, using regression methods or mixture
models. We extend the latter approach by using statistical ideas
developed for capture-recapture problems in ecology and epidemiology.
{RESULTS:} We estimate core- and pan-genome sizes for 16 different
bacterial species. The results reveal a complex dependency structure
for most species, manifested as heterogeneous detection probabilities.
Estimated pan-genome sizes range from small (around 2600 gene families)
in Buchnera aphidicola to large (around 43000 gene families) in Escherichia
coli. Results for \emph{{Echerichia coli}} show that as more data become available,
a larger diversity is estimated, indicating an extensive pool of
rarely occurring genes in the population. {CONCLUSION:} Analyzing
pan-genomics data with binomial mixture models is a way to handle
dependencies between genomes, which we find is always present. A
bottleneck in the estimation procedure is the annotation of rarely
occurring genes.},
doi = {10.1186/1471-2164-10-385},
issn = {1471-2164},
keywords = {Algorithms, Bacteria, Buchnera, Comparative Genomic Hybridization,
\emph{{Escherichia coli}}, Genome, Bacterial, Genomics, Models, Statistical,
Multigene Family, Sequence Analysis, {DNA}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/19691844}
}
@ARTICLE{sperry_multiple-locus_2008,
author = {Sperry, Katharine E Volpe and Kathariou, Sophia and Edwards, Justin
S and Wolf, Leslie A},
title = {Multiple-locus variable-number tandem-repeat analysis as a tool for
subtyping \emph{{Listeria monocytogenes}} strains},
journal = {Journal of Clinical Microbiology},
year = {2008},
volume = {46},
pages = {1435--1450},
number = {4},
month = apr,
note = {{PMID:} 18256218},
abstract = {\emph{{Listeria monocytogenes}}, like many other food-borne bacteria, has certain
strains that are commonly linked to outbreaks. Due to the relatively
low numbers of affected individuals, outbreaks of \emph{{L. monocytogenes}}
can be difficult to detect. The current technique of molecular subtyping
in {PulseNet} laboratories to identify genetically similar strains
is pulsed-field gel electrophoresis {(PFGE).} While {PFGE} is state-of-the-art,
interlaboratory comparisons are difficult because the results are
highly susceptible to discrepancies due to even minor variations
in experimental conditions and the subjectivity of band marking.
This research was aimed at the development of a multiple-locus variable-number
tandem-repeat analysis {(MLVA)} that can be implemented in {PulseNet}
laboratories to replace or complement existing protocols. {MLVA}
has proven to be a rapid and highly discriminatory tool for subtyping
many bacteria. In this study, a novel {MLVA} method for \emph{{L. monocytogenes}}
strains was developed utilizing eight loci multiplexed into two {PCRs.}
The {PCR} products were separated by capillary gel electrophoresis
for high throughput and accurate sizing, and the fragment sizes were
analyzed and clustered based on the number of repeats. When tested
against a panel of 193 epidemiologically linked and nonlinked isolates,
this {MLVA} for \emph{{L. monocytogenes}} strains demonstrates strong epidemiological
concordance. Since {MLVA} is a high-throughput screening method that
is fairly inexpensive, easy to perform, rapid, and reliable, it is
well suited to interlaboratory comparisons during epidemiological
investigations of food-borne illness.},
doi = {10.1128/JCM.02207-07},
issn = {1098-{660X}},
keywords = {Animals, Bacterial Typing Techniques, Base Sequence, Cluster Analysis,
Electrophoresis, Capillary, Electrophoresis, Gel, Pulsed-Field, Environmental
Microbiology, Food Microbiology, Humans, \emph{{Listeria monocytogenes}},
Listeriosis, Minisatellite Repeats, Molecular Sequence Data, Polymerase
Chain Reaction},
lccn = {0008},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18256218}
}
@ARTICLE{stajich_bioperl_2002,
author = {Stajich, Jason E. and Block, David and Boulez, Kris and Brenner,
Steven E. and Chervitz, Stephen A. and Dagdigian, Chris and Fuellen,
Georg and Gilbert, James {G.R.} and Korf, Ian and Lapp, Hilmar and
Lehv\"{a}slaiho, Heikki and Matsalla, Chad and Mungall, Chris J. and
Osborne, Brian I. and Pocock, Matthew R. and Schattner, Peter and
Senger, Martin and Stein, Lincoln D. and Stupka, Elia and Wilkinson,
Mark D. and Birney, Ewan},
title = {The {BioPerl} Toolkit: {Perl} Modules for the Life Sciences},
journal = {Genome Research},
year = {2002},
volume = {12},
pages = {1611 --1618},
number = {10},
month = oct,
abstract = {The Bioperl project is an international open-source collaboration
of biologists, bioinformaticians, and computer scientists that has
evolved over the past 7 yr into the most comprehensive library of
Perl modules available for managing and manipulating life-science
information. Bioperl provides an easy-to-use, stable, and consistent
programming interface for bioinformatics application programmers.
The Bioperl modules have been successfully and repeatedly used to
reduce otherwise complex tasks to only a few lines of code. The Bioperl
object model has been proven to be flexible enough to support enterprise-level
applications such as {EnsEMBL}, while maintaining an easy learning
curve for novice Perl programmers. Bioperl is capable of executing
analyses and processing results from programs such as {BLAST}, {ClustalW},
or the {EMBOSS} suite. Interoperation with modules written in Python
and Java is supported through the evolving {BioCORBA} bridge. Bioperl
provides access to data stores such as {GenBank} and {SwissProt}
via a flexible series of sequence input/output modules, and to the
emerging common sequence data storage format of the Open Bioinformatics
Database Access project. This study describes the overall architecture
of the toolkit, the problem domains that it addresses, and gives
specific examples of how the toolkit can be used to solve common
life-sciences problems. We conclude with a discussion of how the
open-source nature of the project has contributed to the development
{effort.[Supplemental} material is available online at www.genome.org.
Bioperl is available as open-source software free of charge and is
licensed under the Perl Artistic License {(http://www.perl.com/pub/a/language/misc/Artistic.html).}
It is available for download at http://www.bioperl.org. Support inquiries
should be addressed to bioperl-l@bioperl.org.]},
doi = {10.1101/gr.361602},
shorttitle = {The Bioperl Toolkit},
url = {http://genome.cshlp.org/content/12/10/1611.abstract}
}
@ARTICLE{van_stelten_revelation_2010,
author = {Van Stelten, A. and Simpson, J. M. and Ward, T. J. and Nightingale,
K. K.},
title = {Revelation by Single-Nucleotide Polymorphism Genotyping That Mutations
Leading to a Premature Stop Codon in {inlA} Are Common among \emph{{Listeria
monocytogenes}} Isolates from Ready-To-Eat Foods but Not Human Listeriosis
Cases},
journal = {Applied and Environmental Microbiology},
year = {2010},
volume = {76},
pages = {2783--2790},
number = {9},
month = may,
abstract = {\emph{{Listeria monocytogenes}} utilizes internalin A {(InlA;} encoded by {inlA)}
to cross the intestinal barrier to establish a systemic infection.
Multiple naturally occurring mutations leading to a premature stop
codon {(PMSC)} in {inlA} have been reported worldwide, and these
mutations are causally associated with attenuated virulence. Five
{inlA} {PMSC} mutations recently discovered among isolates from France
and the United States were included as additional markers in our
previously described {inlA} single-nucleotide polymorphism {(SNP)}
genotyping assay. This assay was used to screen {\textgreater}1,000
\emph{{L. monocytogenes}} isolates from ready-to-eat {(RTE)} foods (n = 502)
and human listeriosis cases (n = 507) for 18 {inlA} {PMSC} mutations.
A significantly {(P} {\textless} 0.0001) greater proportion of {RTE}
food isolates (45.0\%) carried a {PMSC} mutation in {inlA} compared
to human clinical isolates (5.1\%). The proportion of \emph{{L. monocytogenes}}
with or without {PMSC} mutations in {inlA} was similar among isolates
from different {RTE} food categories except for deli meats, which
included a marginally higher proportion {(P} = 0.12) of isolates
carrying a {PMSC} in {inlA.} We also analyzed the distribution of
epidemic clone {(EC)} strains, which have been linked to the majority
of listeriosis outbreaks worldwide and are overrepresented among
sporadic cases in the United States. We observed a significant {(P}
{\textless} 0.05) overrepresentation of {EC} strains in deli and
seafood salads and a significant {(P} {\textless} 0.05) underrepresentation
of {EC} strains in smoked seafood. These results provide important
data to predict the human health risk of exposure to \emph{{L. monocytogenes}}
strains that differ in pathogenic potential through consumption of
contaminated {RTE} foods.},
doi = {10.1128/AEM.02651-09},
issn = {0099-2240, 1098-5336},
url = {http://aem.asm.org/content/76/9/2783}
}
@ARTICLE{swaminathan_epidemiology_2007,
author = {Swaminathan, Bala and Gerner-Smidt, Peter},
title = {The epidemiology of human listeriosis},
journal = {Microbes and Infection},
year = {2007},
volume = {9},
pages = {1236--1243},
number = {10},
month = aug,
abstract = {Listeriosis is a serious invasive disease that primarily afflicts
pregnant women, neonates and immunocompromised adults. The causative
organism, \emph{{Listeria monocytogenes}}, is primarily transmitted to humans
through contaminated foods. Outbreaks of listeriosis have been reported
in North America, Europe and Japan. Soft cheeses made from raw milk
and ready-to-eat meats are high risk foods for susceptible individuals.
Efforts by food processors and food regulatory agencies to aggressively
control \emph{{L. monocytogenes}} in the high risk foods have resulted in
significant decreases in the incidence of sporadic listeriosis.},
doi = {10.1016/j.micinf.2007.05.011},
issn = {1286-4579},
keywords = {Epidemiology, \emph{{Listeria monocytogenes}}, Listeriosis},
lccn = {0122},
url = {http://www.sciencedirect.com/science/article/B6VPN-4NNN0J0-7/2/3dc162f9e384834c47a0998aa083741d}
}
@ARTICLE{taboada_large-scale_2004,
author = {Taboada, Eduardo N and Acedillo, Rey R and Carrillo, Catherine D
and Findlay, Wendy A and Medeiros, Diane T and Mykytczuk, Oksana
L and Roberts, Michael J and Valencia, C Alexander and Farber, Jeffrey
M and Nash, John H E},
title = {Large-scale comparative genomics meta-analysis of \emph{{Campylobacter jejuni}}
isolates reveals low level of genome plasticity},
journal = {Journal of Clinical Microbiology},
year = {2004},
volume = {42},
pages = {4566--4576},
number = {10},
month = oct,
note = {{PMID:} 15472310},
abstract = {We have used comparative genomic hybridization {(CGH)} on a full-genome
\emph{{Campylobacter jejuni}} microarray to examine genome-wide gene conservation
patterns among 51 strains isolated from food and clinical sources.
These data have been integrated with data from three previous C.
jejuni {CGH} studies to perform a meta-analysis that included 97
strains from the four separate data sets. Although many genes were
found to be divergent across multiple strains (n = 350), many genes
(n = 249) were uniquely variable in single strains. Thus, the strains
in each data set comprise strains with a unique genetic diversity
not found in the strains in the other data sets. Despite the large
increase in the collective number of variable \emph{{C. jejuni}} genes (n
= 599) found in the meta-analysis data set, nearly half of these
(n = 276) mapped to previously defined variable loci, and it therefore
appears that large regions of the \emph{{C. jejuni}} genome are genetically
stable. A detailed analysis of the microarray data revealed that
divergent genes could be differentiated on the basis of the amplitudes
of their differential microarray signals. Of 599 variable genes,
122 could be classified as highly divergent on the basis of {CGH}
data. Nearly all highly divergent genes (117 of 122) had divergent
neighbors and showed high levels of intraspecies variability. The
approach outlined here has enabled us to distinguish global trends
of gene conservation in \emph{{C. jejuni}} and has enabled us to define this
group of genes as a robust set of variable markers that can become
the cornerstone of a new generation of genotyping methods that use
genome-wide \emph{{C. jejuni}} gene variability data.},
doi = {10.1128/JCM.42.10.4566-4576.2004},
issn = {0095-1137},
keywords = {Animals, Bacterial Proteins, \emph{{Campylobacter}} Infections, \emph{{Campylobacter}}
jejuni, Cattle, Genome, Bacterial, Genomics, Genotype, Humans, Nucleic
Acid Hybridization, Oligonucleotide Array Sequence Analysis},
lccn = {0071},
url = {http://www.ncbi.nlm.nih.gov/pubmed/15472310}
}
@ARTICLE{taboada_development_2012,
author = {Taboada, Eduardo N and Ross, Susan L and Mutschall, Steven K and
Mackinnon, Joanne M and Roberts, Michael J and Buchanan, Cody J and
Kruczkiewicz, Peter and Jokinen, Cassandra C and Thomas, James E
and Nash, John H E and Gannon, Victor P J and Marshall, Barbara and
Pollari, Frank and Clark, Clifford G},
title = {Development and validation of a comparative genomic fingerprinting
method for high-resolution genotyping of \emph{{Campylobacter jejuni}}},
journal = {Journal of Clinical Microbiology},
year = {2012},
volume = {50},
pages = {788--797},
number = {3},
month = mar,
note = {{PMID:} 22170908},
abstract = {Campylobacter spp. are a leading cause of bacterial gastroenteritis
worldwide. The need for molecular subtyping methods with enhanced
discrimination in the context of surveillance- and outbreak-based
epidemiologic investigations of \emph{{Campylobacter}} spp. is critical to
our understanding of sources and routes of transmission and the development
of mitigation strategies to reduce the incidence of campylobacteriosis.
We describe the development and validation of a rapid and high-resolution
comparative genomic fingerprinting {(CGF)} method for \emph{{C. jejuni}}.
A total of 412 isolates from agricultural, environmental, retail,
and human clinical sources obtained from the Canadian national integrated
enteric pathogen surveillance program {(C-EnterNet)} were analyzed
using a 40-gene assay {(CGF40)} and multilocus sequence typing {(MLST).}
The significantly higher Simpson's index of diversity {(ID)} obtained
with {CGF40} {(ID} = 0.994) suggests that it has a higher discriminatory
power than {MLST} at both the level of clonal complex {(ID} = 0.873)
and sequence type {(ID} = 0.935). High Wallace coefficients obtained
when {CGF40} was used as the primary typing method suggest that {CGF}
and {MLST} are highly concordant, and we show that isolates with
identical {MLST} profiles are comprised of isolates with distinct
but highly similar {CGF} profiles. The high concordance with {MLST}
coupled with the ability to discriminate between closely related
isolates suggests that {CFG40} is useful in differentiating highly
prevalent sequence types, such as {ST21} and {ST45.} {CGF40} is a
high-resolution comparative genomics-based method for \emph{{C. jejuni}} subtyping
with high discriminatory power that is also rapid, low cost, and
easily deployable for routine epidemiologic surveillance and outbreak
investigations.},
doi = {10.1128/JCM.00669-11},
issn = {1098-{660X}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/22170908}
}
@ARTICLE{tettelin_genome_2005,
author = {Tettelin, Herv\'{e} and Masignani, Vega and Cieslewicz, Michael J and
Donati, Claudio and Medini, Duccio and Ward, Naomi L and Angiuoli,
Samuel V and Crabtree, Jonathan and Jones, Amanda L and Durkin, A
Scott and Deboy, Robert T and Davidsen, Tanja M and Mora, Marirosa
and Scarselli, Maria and Margarit y Ros, Immaculada and Peterson,
Jeremy D and Hauser, Christopher R and Sundaram, Jaideep P and Nelson,
William C and Madupu, Ramana and Brinkac, Lauren M and Dodson, Robert
J and Rosovitz, Mary J and Sullivan, Steven A and Daugherty, Sean
C and Haft, Daniel H and Selengut, Jeremy and Gwinn, Michelle L and
Zhou, Liwei and Zafar, Nikhat and Khouri, Hoda and Radune, Diana
and Dimitrov, George and Watkins, Kisha and {O'Connor}, Kevin J B
and Smith, Shannon and Utterback, Teresa R and White, Owen and Rubens,
Craig E and Grandi, Guido and Madoff, Lawrence C and Kasper, Dennis
L and Telford, John L and Wessels, Michael R and Rappuoli, Rino and
Fraser, Claire M},
title = {Genome analysis of multiple pathogenic isolates of \emph{{Streptococcus
agalactiae}}: implications for the microbial ``pan-genome''},
journal = {Proceedings of the National Academy of Sciences of the United States
of America},
year = {2005},
volume = {102},
pages = {13950--13955},
number = {39},
month = sep,
note = {{PMID:} 16172379},
abstract = {The development of efficient and inexpensive genome sequencing methods
has revolutionized the study of human bacterial pathogens and improved
vaccine design. Unfortunately, the sequence of a single genome does
not reflect how genetic variability drives pathogenesis within a
bacterial species and also limits genome-wide screens for vaccine
candidates or for antimicrobial targets. We have generated the genomic
sequence of six strains representing the five major disease-causing
serotypes of \emph{{Streptococcus agalactiae}}, the main cause of neonatal
infection in humans. Analysis of these genomes and those available
in databases showed that the \emph{{S. agalactiae}} species can be described
by a pan-genome consisting of a core genome shared by all isolates,
accounting for approximately 80\% of any single genome, plus a dispensable
genome consisting of partially shared and strain-specific genes.
Mathematical extrapolation of the data suggests that the gene reservoir
available for inclusion in the \emph{{S. agalactiae}} pan-genome is vast and
that unique genes will continue to be identified even after sequencing
hundreds of genomes.},
doi = {10.1073/pnas.0506758102},
issn = {0027-8424},
keywords = {Amino Acid Sequence, Bacterial Capsules, Base Sequence, Gene Expression,
Genes, Bacterial, Genetic Variation, Genome, Bacterial, Molecular
Sequence Data, Phylogeny, Sequence Alignment, Sequence Analysis,
{DNA}, \emph{{Streptococcus agalactiae}}, Virulence},
shorttitle = {Genome analysis of multiple pathogenic isolates of \emph{{Streptococcus agalactiae}}},
url = {http://www.ncbi.nlm.nih.gov/pubmed/16172379}
}
@ARTICLE{tettelin_complete_2002,
author = {Tettelin, Herv\'{e} and Masignani, Vega and Cieslewicz, Michael J. and
Eisen, Jonathan A. and Peterson, Scott and Wessels, Michael R. and
Paulsen, Ian T. and Nelson, Karen E. and Margarit, Immaculada and
Read, Timothy D. and Madoff, Lawrence C. and Wolf, Alex M. and Beanan,
Maureen J. and Brinkac, Lauren M. and Daugherty, Sean C. and {DeBoy},
Robert T. and Durkin, A. Scott and Kolonay, James F. and Madupu,
Ramana and Lewis, Matthew R. and Radune, Diana and Fedorova, Nadezhda
B. and Scanlan, David and Khouri, Hoda and Mulligan, Stephanie and
Carty, Heather A. and Cline, Robin T. and Van Aken, Susan E. and
Gill, John and Scarselli, Maria and Mora, Marirosa and Iacobini,
Emilia T. and Brettoni, Cecilia and Galli, Giuliano and Mariani,
Massimo and Vegni, Filippo and Maione, Domenico and Rinaudo, Daniela
and Rappuoli, Rino and Telford, John L. and Kasper, Dennis L. and
Grandi, Guido and Fraser, Claire M.},
title = {Complete genome sequence and comparative genomic analysis of an emerging
human pathogen, serotype {V} \emph{{Streptococcus agalactiae}}},
journal = {Proceedings of the National Academy of Sciences of the United States
of America},
year = {2002},
volume = {99},
pages = {12391--12396},
number = {19},
month = sep,
note = {{PMID:} 12200547 {PMCID:} 129455},
abstract = {The 2,160,267 bp genome sequence of \emph{{Streptococcus agalactiae}}, the
leading cause of bacterial sepsis, pneumonia, and meningitis in neonates
in the {U.S.} and Europe, is predicted to encode 2,175 genes. Genome
comparisons among \emph{{S. agalactiae}}, Streptococcus pneumoniae, Streptococcus
pyogenes, and the other completely sequenced genomes identified genes
specific to the streptococci and to \emph{{S. agalactiae}}. These in silico
analyses, combined with comparative genome hybridization experiments
between the sequenced serotype V strain 2603 {V/R} and 19 \emph{{S. agalactiae}}
strains from several serotypes using whole-genome microarrays, revealed
the genetic heterogeneity among \emph{{S. agalactiae}} strains, even of the
same serotype, and provided insights into the evolution of virulence
mechanisms.},
doi = {10.1073/pnas.182380799},
issn = {0027-8424},
lccn = {0262}
}
@ARTICLE{tettelin_comparative_2008,
author = {Tettelin, Herv\'{e} and Riley, David and Cattuto, Ciro and Medini, Duccio},
title = {Comparative genomics: the bacterial pan-genome},
journal = {Current Opinion in Microbiology},
year = {2008},
volume = {11},
pages = {472--477},
number = {5},
month = oct,
abstract = {Bacterial genome sequencing has become so easy and accessible that
the genomes of multiple strains of more and more individual species
have been and will be generated. These data sets provide for in depth
analysis of intra-species diversity from various aspects. The pan-genome
analysis, whereby the size of the gene repertoire accessible to any
given species is characterized together with an estimate of the number
of whole genome sequences required for proper analysis, is being
increasingly applied. Different models exist for the analysis and
their accuracy and applicability depend on the case at hand. Here
we discuss current models and suggest a new model of broad applicability,
including examples of its implementation.},
doi = {10.1016/j.mib.2008.09.006},
issn = {1369-5274},
keywords = {Bacteria, Genetic Variation, Genome, Bacterial, Genomics, Synteny},
shorttitle = {Comparative genomics},
url = {http://www.sciencedirect.com/science/article/B6VS2-4TNTM3D-3/2/d5c1be55f96600587fa405fe0168be07}
}
@ARTICLE{van_belkum_guidelines_2007,
author = {Van Belkum, A. and Tassios, P. T. and Dijkshoorn, L. and Haeggman,
S. and Cookson, B. and Fry, N. K. and Fussing, V. and Green, J. and
Feil, E. and Gerner-Smidt, P. and Brisse, S. and Struelens, M. and
Microbiology, for the European Society of Clinical and (esgem), Infectious
Diseases {(ESCMID)} Study Group on Epidemiological Markers},
title = {Guidelines for the validation and application of typing methods for
use in bacterial epidemiology},
journal = {Clinical Microbiology and Infection},
year = {2007},
volume = {13},
pages = {1--46},
abstract = {For bacterial typing to be useful, the development, validation and
appropriate application of typing methods must follow unified criteria.
Over a decade ago, {ESGEM}, the {ESCMID} {(Europen} Society for Clinical
Microbiology and Infectious Diseases) Study Group on Epidemiological
Markers, produced guidelines for optimal use and quality assessment
of the then most frequently used typing procedures. We present here
an update of these guidelines, taking into account the spectacular
increase in the number and quality of typing methods made available
over the past decade. Newer and older, phenotypic and genotypic methods
for typing of all clinically relevant bacterial species are described
according to their principles, advantages and disadvantages. Criteria
for their evaluation and application and the interpretation of their
results are proposed. Finally, the issues of reporting, standardisation,
quality assessment and international networks are discussed. It must
be emphasised that typing results can never stand alone and need
to be interpreted in the context of all available epidemiological,
clinical and demographical data relating to the infectious disease
under investigation. A strategic effort on the part of all workers
in the field is thus mandatory to combat emerging infectious diseases,
as is financial support from national and international granting
bodies and health authorities.},
doi = {10.1111/j.1469-0691.2007.01786.x},
issn = {1469-0691},
url = {http://onlinelibrary.wiley.com/doi/10.1111/j.1469-0691.2007.01786.x/abstract}
}
@ARTICLE{van_stelten_development_2008,
author = {Van Stelten, A and Nightingale, K K},
title = {Development and implementation of a multiplex single-nucleotide polymorphism
genotyping assay for detection of virulence-attenuating mutations
in the \emph{{Listeria monocytogenes}} virulence-associated gene {inlA}},
journal = {Applied and Environmental Microbiology},
year = {2008},
volume = {74},
pages = {7365--7375},
number = {23},
month = dec,
note = {{PMID:} 18836010},
abstract = {The virulence factor internalin A {(InlA)} facilitates the uptake
of \emph{{Listeria monocytogenes}} by epithelial cells that express the human
isoform of E-cadherin. Previous studies identified naturally occurring
premature stop codon {(PMSC)} mutations in {inlA} and demonstrated
that these mutations are responsible for virulence attenuation. We
assembled {\textgreater}1,700 \emph{{L. monocytogenes}} isolates from diverse
sources representing 90 {EcoRI} ribotypes. A subset of this isolate
collection was selected based on ribotype frequency and characterized
by a Caco-2 cell invasion assay. The sequencing of {inlA} genes from
isolates with attenuated invasion capacities revealed three novel
{inlA} {PMSCs} which had not been identified previously among {U.S.}
isolates. Since ribotypes include isolates with and without {inlA}
{PMSCs}, we developed a multiplex single-nucleotide polymorphism
{(SNP)} genotyping assay to detect isolates with virulence-attenuating
{PMSC} mutations in {inlA.} The {SNP} genotyping assay detects all
{inlA} {PMSC} mutations that have been reported worldwide and verified
in this study to date by the extension of unlabeled primers with
fluorescently labeled dideoxynucleoside triphosphates. We implemented
the {SNP} genotyping assay to characterize human clinical and food
isolates representing common ribotypes associated with novel {inlA}
{PMSC} mutations. {PMSCs} in {inlA} were significantly (ribotypes
{DUP-1039C} and {DUP-1045B;} P {\textless} 0.001) or marginally (ribotype
{DUP-1062D;} P = 0.11) more common among food isolates than human
clinical isolates. {SNP} genotyping revealed a fourth novel {PMSC}
mutation among {U.S.} \emph{{L. monocytogenes}} isolates, which was observed
previously among isolates from France and Portugal. This {SNP} genotyping
assay may be implemented by regulatory agencies and the food industry
to differentiate \emph{{L. monocytogenes}} isolates carrying virulence-attenuating
{PMSC} mutations in {inlA} from strains representing the most significant
health risk.},
doi = {10.1128/AEM.01138-08},
issn = {1098-5336},
keywords = {Bacterial Proteins, Caco-2 Cells, {DNA}, Bacterial, Epithelial Cells,
Food Microbiology, France, Genotype, \emph{{Listeria}} Infections, \emph{{Listeria}}
monocytogenes, Molecular Sequence Data, Mutation, Polymorphism, Single
Nucleotide, Portugal, Ribotyping, Sequence Analysis, {DNA}, United
States},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18836010}
}
@ARTICLE{venter_sequence_2001,
author = {Venter, J C and Adams, M D and Myers, E W and Li, P W and Mural,
R J and Sutton, G G and Smith, H O and Yandell, M and Evans, C A
and Holt, R A and Gocayne, J D and Amanatides, P and Ballew, R M
and Huson, D H and Wortman, J R and Zhang, Q and Kodira, C D and
Zheng, X H and Chen, L and Skupski, M and Subramanian, G and Thomas,
P D and Zhang, J and Gabor Miklos, G L and Nelson, C and Broder,
S and Clark, A G and Nadeau, J and {McKusick}, V A and Zinder, N
and Levine, A J and Roberts, R J and Simon, M and Slayman, C and
Hunkapiller, M and Bolanos, R and Delcher, A and Dew, I and Fasulo,
D and Flanigan, M and Florea, L and Halpern, A and Hannenhalli, S
and Kravitz, S and Levy, S and Mobarry, C and Reinert, K and Remington,
K and Abu-Threideh, J and Beasley, E and Biddick, K and Bonazzi,
V and Brandon, R and Cargill, M and Chandramouliswaran, I and Charlab,
R and Chaturvedi, K and Deng, Z and Di Francesco, V and Dunn, P and
Eilbeck, K and Evangelista, C and Gabrielian, A E and Gan, W and
Ge, W and Gong, F and Gu, Z and Guan, P and Heiman, T J and Higgins,
M E and Ji, R R and Ke, Z and Ketchum, K A and Lai, Z and Lei, Y
and Li, Z and Li, J and Liang, Y and Lin, X and Lu, F and Merkulov,
G V and Milshina, N and Moore, H M and Naik, A K and Narayan, V A
and Neelam, B and Nusskern, D and Rusch, D B and Salzberg, S and
Shao, W and Shue, B and Sun, J and Wang, Z and Wang, A and Wang,
X and Wang, J and Wei, M and Wides, R and Xiao, C and Yan, C and
Yao, A and Ye, J and Zhan, M and Zhang, W and Zhang, H and Zhao,
Q and Zheng, L and Zhong, F and Zhong, W and Zhu, S and Zhao, S and
Gilbert, D and Baumhueter, S and Spier, G and Carter, C and Cravchik,
A and Woodage, T and Ali, F and An, H and Awe, A and Baldwin, D and
Baden, H and Barnstead, M and Barrow, I and Beeson, K and Busam,
D and Carver, A and Center, A and Cheng, M L and Curry, L and Danaher,
S and Davenport, L and Desilets, R and Dietz, S and Dodson, K and
Doup, L and Ferriera, S and Garg, N and Gluecksmann, A and Hart,
B and Haynes, J and Haynes, C and Heiner, C and Hladun, S and Hostin,
D and Houck, J and Howland, T and Ibegwam, C and Johnson, J and Kalush,
F and Kline, L and Koduru, S and Love, A and Mann, F and May, D and
{McCawley}, S and {McIntosh}, T and {McMullen}, I and Moy, M and
Moy, L and Murphy, B and Nelson, K and Pfannkoch, C and Pratts, E
and Puri, V and Qureshi, H and Reardon, M and Rodriguez, R and Rogers,
Y H and Romblad, D and Ruhfel, B and Scott, R and Sitter, C and Smallwood,
M and Stewart, E and Strong, R and Suh, E and Thomas, R and Tint,
N N and Tse, S and Vech, C and Wang, G and Wetter, J and Williams,
S and Williams, M and Windsor, S and Winn-Deen, E and Wolfe, K and
Zaveri, J and Zaveri, K and Abril, J F and Guigó, R and Campbell,
M J and Sjolander, K V and Karlak, B and Kejariwal, A and Mi, H and
Lazareva, B and Hatton, T and Narechania, A and Diemer, K and Muruganujan,
A and Guo, N and Sato, S and Bafna, V and Istrail, S and Lippert,
R and Schwartz, R and Walenz, B and Yooseph, S and Allen, D and Basu,
A and Baxendale, J and Blick, L and Caminha, M and Carnes-Stine,
J and Caulk, P and Chiang, Y H and Coyne, M and Dahlke, C and Mays,
A and Dombroski, M and Donnelly, M and Ely, D and Esparham, S and
Fosler, C and Gire, H and Glanowski, S and Glasser, K and Glodek,
A and Gorokhov, M and Graham, K and Gropman, B and Harris, M and
Heil, J and Henderson, S and Hoover, J and Jennings, D and Jordan,
C and Jordan, J and Kasha, J and Kagan, L and Kraft, C and Levitsky,
A and Lewis, M and Liu, X and Lopez, J and Ma, D and Majoros, W and
{McDaniel}, J and Murphy, S and Newman, M and Nguyen, T and Nguyen,
N and Nodell, M and Pan, S and Peck, J and Peterson, M and Rowe,
W and Sanders, R and Scott, J and Simpson, M and Smith, T and Sprague,
A and Stockwell, T and Turner, R and Venter, E and Wang, M and Wen,
M and Wu, D and Wu, M and Xia, A and Zandieh, A and Zhu, X},
title = {The sequence of the human genome},
journal = {Science},
year = {2001},
volume = {291},
pages = {1304--1351},
number = {5507},
month = feb,
note = {{PMID:} 11181995},
abstract = {A 2.91-billion base pair (bp) consensus sequence of the euchromatic
portion of the human genome was generated by the whole-genome shotgun
sequencing method. The 14.8-billion bp {DNA} sequence was generated
over 9 months from 27,271,853 high-quality sequence reads (5.11-fold
coverage of the genome) from both ends of plasmid clones made from
the {DNA} of five individuals. Two assembly strategies-a whole-genome
assembly and a regional chromosome assembly-were used, each combining
sequence data from Celera and the publicly funded genome effort.
The public data were shredded into 550-bp segments to create a 2.9-fold
coverage of those genome regions that had been sequenced, without
including biases inherent in the cloning and assembly procedure used
by the publicly funded group. This brought the effective coverage
in the assemblies to eightfold, reducing the number and size of gaps
in the final assembly over what would be obtained with 5.11-fold
coverage. The two assembly strategies yielded very similar results
that largely agree with independent mapping data. The assemblies
effectively cover the euchromatic regions of the human chromosomes.
More than 90\% of the genome is in scaffold assemblies of 100,000
bp or more, and 25\% of the genome is in scaffolds of 10 million
bp or larger. Analysis of the genome sequence revealed 26,588 protein-encoding
transcripts for which there was strong corroborating evidence and
an additional approximately 12,000 computationally derived genes
with mouse matches or other weak supporting evidence. Although gene-dense
clusters are obvious, almost half the genes are dispersed in low
{G+C} sequence separated by large tracts of apparently noncoding
sequence. Only 1.1\% of the genome is spanned by exons, whereas 24\%
is in introns, with 75\% of the genome being intergenic {DNA.} Duplications
of segmental blocks, ranging in size up to chromosomal lengths, are
abundant throughout the genome and reveal a complex evolutionary
history. Comparative genomic analysis indicates vertebrate expansions
of genes associated with neuronal function, with tissue-specific
developmental regulation, and with the hemostasis and immune systems.
{DNA} sequence comparisons between the consensus sequence and publicly
funded genome data provided locations of 2.1 million single-nucleotide
polymorphisms {(SNPs).} A random pair of human haploid genomes differed
at a rate of 1 bp per 1250 on average, but there was marked heterogeneity
in the level of polymorphism across the genome. Less than 1\% of
all {SNPs} resulted in variation in proteins, but the task of determining
which {SNPs} have functional consequences remains an open challenge.},
annote = {human genome project {HGP} \$3 billion 13 years},
doi = {10.1126/science.1058040},
issn = {0036-8075},
keywords = {Algorithms, Animals, Chromosome Banding, Chromosome Mapping, Chromosomes,
Artificial, Bacterial, Computational Biology, Consensus Sequence,
{CpG} Islands, Databases, Factual, {DNA}, Intergenic, Evolution,
Molecular, Exons, Female, Gene Duplication, Genes, Genetic Variation,
Genome, Human, Human Genome Project, Humans, Introns, Male, Phenotype,
Physical Chromosome Mapping, Polymorphism, Single Nucleotide, Proteins,
Pseudogenes, Repetitive Sequences, Nucleic Acid, Retroelements, Sequence
Analysis, {DNA}, Species Specificity},
url = {http://www.ncbi.nlm.nih.gov/pubmed/11181995}
}
@ARTICLE{volokhov_identification_2002,
author = {Volokhov, Dmitriy and Rasooly, Avraham and Chumakov, Konstantin and
Chizhikov, Vladimir},
title = {Identification of \emph{{Listeria}} species by microarray-based assay},
journal = {Journal of Clinical Microbiology},
year = {2002},
volume = {40},
pages = {4720--4728},
number = {12},
month = dec,
note = {{PMID:} 12454178},
abstract = {We have developed a rapid microarray-based assay for the reliable
detection and discrimination of six species of the \emph{{Listeria}} genus:
\emph{{L. monocytogenes}}, L. ivanovii, L. innocua, L. welshimeri, L. seeligeri,
and L. grayi. The approach used in this study involves one-tube multiplex
{PCR} amplification of six target bacterial virulence factor genes
(iap, hly, {inlB}, {plcA}, {plcB}, and {clpE)}, synthesis of fluorescently
labeled single-stranded {DNA}, and hybridization to the multiple
individual oligonucleotide probes specific for each \emph{{Listeria}} species
and immobilized on a glass surface. Results of the microarray analysis
of 53 reference and clinical isolates of \emph{{Listeria}} spp. demonstrated
that this method allowed unambiguous identification of all six \emph{{Listeria}}
species based on sequence differences in the iap gene. Another virulence
factor gene, hly, was used for detection and genotyping all \emph{{L. monocytogenes}},
all L. ivanovii, and 8 of 11 L. seeligeri isolates. Other members
of the genus \emph{{Listeria}} and three L. seeligeri isolates did not contain
the hly gene. There was complete agreement between the results of
genotyping based on the hly and iap gene sequences. All \emph{{L. monocytogenes}}
isolates were found to be positive for the {inlB}, {plcA}, {plcB},
and {clpE} virulence genes specific only to this species. Our data
on \emph{{Listeria}} species analysis demonstrated that this microarray technique
is a simple, rapid, and robust genotyping method that is also a potentially
valuable tool for identification and characterization of bacterial
pathogens in general.},
issn = {0095-1137},
keywords = {Bacterial Proteins, Bacterial Typing Techniques, {DNA}, Single-Stranded,
Humans, \emph{{Listeria}}, \emph{{Listeria}} Infections, Molecular Sequence Data, Oligonucleotide
Array Sequence Analysis, Oligonucleotide Probes, Polymerase Chain
Reaction, Sequence Analysis, {DNA}, Species Specificity, Virulence
Factors},
url = {http://www.ncbi.nlm.nih.gov/pubmed/12454178}
}
@ARTICLE{wall_detecting_2003,
author = {Wall, D. P. and Fraser, H. B. and Hirsh, A. E.},
title = {Detecting putative orthologs},
journal = {Bioinformatics},
year = {2003},
volume = {19},
pages = {1710 --1711},
number = {13},
abstract = {Summary: We developed an algorithm that improves upon the common procedure
of taking reciprocal best blast hits (rbh) in the identification
of orthologs. The method--reciprocal smallest distance algorithm
(rsd)--relies on global sequence alignment and maximum likelihood
estimation of evolutionary distances to detect orthologs between
two genomes. rsd finds many putative orthologs missed by rbh because
it is less likely than rbh to be misled by the presence of a close
{paralog.Availability:} A Python program and {ReadMe} file are freely
available from: http://charles.stanford.edu/{\textasciitilde}dennis/research.html},
doi = {10.1093/bioinformatics/btg213},
url = {http://bioinformatics.oxfordjournals.org/content/19/13/1710.abstract}
}
@ARTICLE{wallace_method_1983,
author = {Wallace, David L.},
title = {A Method for Comparing Two Hierarchical Clusterings: Comment},
journal = {Journal of the American Statistical Association},
year = {1983},
volume = {78},
pages = {569},
number = {383},
month = sep,
doi = {10.2307/2288118},
issn = {01621459},
shorttitle = {A Method for Comparing Two Hierarchical Clusterings},
url = {http://www.jstor.org/discover/10.2307/2288118?uid=17763&uid=3739448&uid=2&uid=3737720&uid=3&uid=67&uid=17761&uid=62&sid=21101000847013}
}
@ARTICLE{ward_multilocus_2008-1,
author = {Ward, Todd J and Ducey, Thomas F and Usgaard, Thomas and Dunn, Katherine
A and Bielawski, Joseph P},
title = {Multilocus genotyping assays for single nucleotide polymorphism-based
subtyping of \emph{{Listeria monocytogenes}} isolates},
journal = {Applied and Environmental Microbiology},
year = {2008},
volume = {74},
pages = {7629--7642},
number = {24},
month = dec,
note = {{PMID:} 18931295},
abstract = {\emph{{Listeria monocytogenes}} is responsible for serious invasive illness
associated with consumption of contaminated food and places a significant
burden on public health and the agricultural economy. We recently
developed a multilocus genotyping {(MLGT)} assay for high-throughput
subtype determination of \emph{{L. monocytogenes}} lineage I isolates based
on interrogation of single nucleotide polymorphisms {(SNPs)} via
multiplexed primer extension reactions. Here we report the development
and validation of two additional {MLGT} assays that address the need
for comprehensive {DNA} sequence-based subtyping of \emph{{L. monocytogenes}}.
The first of these novel {MLGT} assays targeted variation segregating
within lineage {II}, while the second assay combined probes for lineage
{III} strains with probes for strains representing a recently characterized
fourth evolutionary lineage {(IV)} of \emph{{L. monocytogenes}}. These assays
were based on nucleotide variation identified in {\textgreater}3.8
Mb of comparative {DNA} sequence and consisted of 115 total probes
that differentiated 93\% of the 100 haplotypes defined by the multilocus
sequence data. {MLGT} reproducibly typed the 173 isolates used in
{SNP} discovery, and the 10,448 genotypes derived from {MLGT} analysis
of these isolates were consistent with {DNA} sequence data. Application
of the {MLGT} assays to assess subtype prevalence among isolates
from ready-to-eat foods and food-processing facilities indicated
a low frequency (6.3\%) of epidemic clone subtypes and a substantial
population of isolates ({\textgreater}30\%) harboring mutations in
{inlA} associated with attenuated virulence in cell culture and animal
models. These mutations were restricted to serogroup 1/2 isolates,
which may explain the overrepresentation of serotype 4b isolates
in human listeriosis cases.},
doi = {10.1128/AEM.01127-08},
issn = {1098-5336},
keywords = {Bacterial Proteins, Bacterial Typing Techniques, {DNA}, Bacterial,
Food Microbiology, Genotype, Humans, \emph{{Listeria monocytogenes}}, Molecular
Sequence Data, Polymorphism, Single Nucleotide, Reproducibility of
Results, Sequence Analysis, {DNA}, Virulence Factors},
url = {http://www.ncbi.nlm.nih.gov/pubmed/18931295}
}
@ARTICLE{ward_intraspecific_2004,
author = {Ward, Todd J. and Gorski, Lisa and Borucki, Monica K. and Mandrell,
Robert E. and Hutchins, Jan and Pupedis, Kitty},
title = {Intraspecific Phylogeny and Lineage Group Identification Based on
the {prfA} Virulence Gene Cluster of \emph{{Listeria monocytogenes}}},
journal = {Journal of Bacteriology},
year = {2004},
volume = {186},
pages = {4994--5002},
number = {15},
month = aug,
note = {{PMID:} 15262937 {PMCID:} 451661},
abstract = {\emph{{Listeria monocytogenes}} is a serious food-borne pathogen that can cause
invasive disease in humans and other animals and has been the leading
cause of food recalls due to microbiological concerns in recent years.
In order to test hypotheses regarding \emph{{L. monocytogenes}} lineage composition,
evolution, ecology, and taxonomy, a robust intraspecific phylogeny
was developed based on {prfA} virulence gene cluster sequences from
113 \emph{{L. monocytogenes}} isolates. The results of the multigene phylogenetic
analyses confirm that \emph{{L. monocytogenes}} comprises at least three evolutionary
lineages, demonstrate that lineages most frequently (lineage 1) and
least frequently (lineage 3) associated with human listeriosis are
sister-groups, and reveal for the first time that the human epidemic
associated serotype 4b is prevalent among strains from lineage 1
and lineage 3. In addition, a {PCR-based} test for lineage identification
was developed and used in a survey of food products demonstrating
that the low frequency of association between lineage 3 isolates
and human listeriosis cases likely reflects rarity of exposure and
not reduced virulence for humans as has been previously suggested.
However, prevalence data do suggest lineage 3 isolates may be better
adapted to the animal production environment than the food-processing
environment. Finally, analyses of haplotype diversity indicate that
lineage 1 has experienced a purge of genetic variation that was not
observed in the other lineages, suggesting that the three \emph{{L. monocytogenes}}
lineages may represent distinct species within the framework of the
cohesion species concept.},
doi = {10.1128/JB.186.15.4994-5002.2004},
issn = {0021-9193},
lccn = {0084}
}
@ARTICLE{ward_targeted_2010,
author = {Ward, Todd J. and Usgaard, Thomas and Evans, Peter},
title = {A Targeted Multilocus Genotyping Assay for Lineage, Serogroup, and
Epidemic Clone Typing of \emph{{Listeria monocytogenes}}},
journal = {Applied Environmental Microbiology},
year = {2010},
volume = {76},
pages = {6680--6684},
number = {19},
month = oct,
abstract = {A 30-probe assay was developed for simultaneous classification of
\emph{{Listeria monocytogenes}} isolates by lineage {(I} to {IV)}, major serogroup
(4b, 1/2b, 1/2a, and 1/2c), and epidemic clone {(EC)} type {(ECI},
{ECIa}, {ECII}, and {ECIII).} The assay was designed to facilitate
rapid strain characterization and the integration of subtype data
into risk-based inspection programs.},
doi = {10.1128/AEM.01008-10},
url = {http://aem.asm.org/cgi/content/abstract/76/19/6680}
}
@ARTICLE{wiedmann_ribotypes_1997,
author = {Wiedmann, M and Bruce, J L and Keating, C and Johnson, A E and {McDonough},
P L and Batt, C A},
title = {Ribotypes and virulence gene polymorphisms suggest three distinct
\emph{{Listeria monocytogenes}} lineages with differences in pathogenic potential.},
journal = {Infection and Immunity},
year = {1997},
volume = {65},
pages = {2707--2716},
number = {7},
month = jul,
note = {{PMID:} 9199440 {PMCID:} 175382},
abstract = {A total of 133 \emph{{Listeria monocytogenes}} isolates were characterized
by ribotyping and allelic analysis of the virulence genes hly, {actA},
and {inlA} to uncover linkages between independent phylogenetic and
specific virulence markers. {PCR-restriction} fragment length polymorphisms
revealed 8 hly, 11 inl4, and 2 {actA} alleles. The combination of
these virulence gene alleles and ribotype patterns separated \emph{{L. monocytogenes}}
into three distinct lineages. While distinct hly and {inlA} alleles
were generally found to cluster into these three lineages, {actA}
alleles segregated independently. These three phylogenetic lineages
were confirmed when 22 partial {actA} {DNA} sequences were analyzed.
The clinical history of the \emph{{L. monocytogenes}} strains showed evidence
for differences in pathogenic potential among the three lineages.
Lineage I contains all strains isolated during epidemic outbreaks
of listeriosis, while no human isolates were found in lineage {III.}
Animal isolates were found in all three lineages. We found evidence
that isolates from lineages I and {III} have a higher plaquing efficiency
than lineage {II} strains in a cell culture assay. Strains from lineage
{III} also seem to form larger plaques than strains from lineage
{II.} A distinctive ribotype fragment and unique {16S} {rRNA} gene
sequences furthermore suggest that lineage {III} might represent
a \emph{{L. monocytogenes}} subspecies. None of the 20 human isolates available
but 11\% of our animal isolates were grouped in this lineage, indicating
that strains in this lineage might have reduced virulence for humans.},
issn = {0019-9567},
lccn = {0259}
}
@ARTICLE{xu_comparative_2010,
author = {Xu, Zhuofei and Chen, Xiabing and Li, Lu and Li, Tingting and Wang,
Shengyue and Chen, Huanchun and Zhou, Rui},
title = {Comparative genomic characterization of \emph{{Actinobacillus pleuropneumoniae}}},
journal = {Journal of Bacteriology},
year = {2010},
month = aug,
note = {{PMID:} 20802045},
abstract = {The Gram-negative bacterium \emph{Actinobacillus pleuropneumoniae} is the
etiologic agent of porcine contagious pleuropneumoniae, a lethal
respiratory infectious disease causing great economic losses in the
swine industry worldwide. In order to better interpret the genetic
background of serotypic diversity, nine genomes of \emph{A. pleuropneumoniae}
reference strains of serovars 1, 2, 4, 6, 9, 10, 11, 12 and 13 were
sequenced using rapid high-throughput approach. Based on twelve genomes
of corresponding serovar reference strains including three publicly
available complete genomes (serovars 3, 5b and 7) of this bacterium,
we performed a comprehensive analysis of comparative genomics and
first reported a global genomic characterization for this pathogen.
Clustering of 26,012 predicted protein-coding genes showed that the
pan genome of \emph{A. pleuropneumoniae} consists of 3,303 gene clusters,
which contain 1,709 core genome genes, 822 distributed genes and
772 strain-specific genes. The genome components involved in the
biogenesis of capsular polysaccharide and lipopolysaccharide O-antigen
relative to serovar diversity were compared and their genetic diversity
was depicted. Our findings shed more light on genomic features associated
with serovar diversity of \emph{A. pleuropneumoniae}, and provide broader
insight into both pathogenesis research and clinical/epidemiological
application against the severe disease caused by this swine pathogen.},
doi = {10.1128/JB.00535-10},
issn = {1098-5530},
url = {http://www.ncbi.nlm.nih.gov/pubmed/20802045}
}
%MLVST
@ARTICLE{zhang_multi-virulence-locus_2004,
author = {Zhang, Wei and Jayarao, Bhushan M. and Knabel, Stephen J.},
title = {Multi-Virulence-Locus Sequence Typing of \emph{{Listeria monocytogenes}}},
journal = {Applied and Environmental Microbiology},
year = {2004},
volume = {70},
pages = {913--920},
number = {2},
month = feb,
note = {{PMID:} 14766571 {PMCID:} 348834},
abstract = {A multi-virulence-locus sequence typing {(MVLST)} scheme was developed
for subtyping \emph{{Listeria monocytogenes}}, and the results obtained using
this scheme were compared to those of pulsed-field gel electrophoresis
{(PFGE)} and the published results of other typing methods, including
ribotyping {(RT)} and multilocus sequence typing {(MLST).} A set
of 28 strains (eight different serotypes and three known genetic
lineages) of \emph{{L. monocytogenes}} was selected from a strain collection
(n {\textgreater} 1,000 strains) to represent the genetic diversity
of this species. Internal fragments (ca. 418 to 469 bp) of three
virulence genes {(prfA}, {inlB}, and {inlC)} and three virulence-associated
genes (dal, {lisR}, and {clpP)} were sequenced and analyzed. Multiple
{DNA} sequence alignment identified 10 {(prfA)}, 19 {(inlB)}, 13
(dal), 10 {(lisR)}, 17 {(inlC)}, and 16 {(clpP)} allelic types and
a total of 28 unique sequence types. Comparison of {MVLST} with automated
{EcoRI-RT} and {PFGE} with {ApaI} enzymatic digestion showed that
{MVLST} was able to differentiate strains that were indistinguishable
by {RT} (13 ribotypes; discrimination index = 0.921) or {PFGE} (22
profiles; discrimination index = 0.970). Comparison of {MVLST} with
housekeeping-gene-based {MLST} analysis showed that {MVLST} provided
higher discriminatory power for serotype 1/2a and 4b strains than
{MLST.} Cluster analysis based on the intragenic sequences of the
selected virulence genes indicated a strain phylogeny closely related
to serotypes and genetic lineages. In conclusion, {MVLST} may improve
the discriminatory power of {MLST} and provide a convenient tool
for studying the local epidemiology of \emph{{L. monocytogenes}.}},
doi = {10.1128/AEM.70.2.913-920.2004},
issn = {0099-2240},
lccn = {0055}
}
%MLVST
@article{chen_multi-virulence-locus_2007,
title = {Multi-virulence-locus sequence typing identifies single nucleotide polymorphisms which differentiate epidemic clones and outbreak strains of \emph{{Listeria monocytogenes}}},
volume = {45},
issn = {0095-1137},
url = {http://www.ncbi.nlm.nih.gov/pubmed/17215339},
doi = {10.1128/JCM.01575-06},
abstract = {A recently developed multi-virulence-locus sequence typing {(MVLST)} method showed improved discriminatory power for subtyping genetically diverse Listeria monocytogenes isolates and identified epidemic clone {II} isolates associated with two recent {U.S.} multistate listeriosis outbreaks. To evaluate the ability of {MVLST} to distinguish other epidemic clones and outbreak strains of L. monocytogenes, 58 outbreak-related isolates from 14 outbreaks and 49 unrelated isolates were analyzed. Results showed that {MVLST} provided very high discriminatory power (0.99), epidemiological concordance (1.0), stability, and typeability. {MVLST} accurately identified three previously known epidemic clones (epidemic clones I, {II}, and {III)} and redefined another epidemic clone (epidemic clone {IV)} in serotype 4b of L. monocytogenes. A set of 28 single nucleotide polymorphisms {(SNPs)} differentiated all epidemiologically unrelated isolates. A subset of 16 {SNPs} differentiated all epidemic clones and outbreak strains. Phylogenetic analysis showed congruence between {MVLST} clusters, serotypes, and previously defined genetic lineages of L. monocytogenes. {SNPs} in virulence genes appear to be excellent molecular markers for the epidemiological investigation of epidemics and outbreaks caused by L. monocytogenes.},
number = {3},
urldate = {2012-09-17},
journal = {Journal of Clinical Microbiology},
author = {Chen, Yi and Zhang, Wei and Knabel, Stephen J},
month = mar,
year = {2007},
note = {{PMID:} 17215339},
keywords = {Animals, Bacterial Proteins, Bacterial Typing Techniques, Base Sequence, Cattle, Disease Outbreaks, Humans, Listeria monocytogenes, Listeriosis, Molecular Sequence Data, Phylogeny, Polymorphism, Single Nucleotide, Sequence Analysis, {DNA}, Serotyping, Virulence, Virulence Factors},
pages = {835--846}
}
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment