This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| $ toil-cwl-runner --preserve-environment PATH --singularity ./example.cwl ./example-job.cwl | |
| /usr/people/pvh/miniconda3/envs/toil/lib/python2.7/site-packages/cwltool/__init__.py:17: CWLToolDeprecationWarning: | |
| DEPRECATION: Python 2.7 will reach the end of its life on January 1st, 2020. | |
| Please upgrade your Python as the Python 2.7 version of cwltool won't be | |
| maintained after that date. | |
| """, category=CWLToolDeprecationWarning) | |
| INFO:cwltool:Resolved './example.cwl' to 'file:///usr/people/pvh/toil/example.cwl' | |
| WARNING:toil.batchSystems.singleMachine:Limiting maxCores to CPU count of system (24). | |
| WARNING:toil.batchSystems.singleMachine:Limiting maxMemory to physically available memory (33714651136). |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ##fileformat=VCFv4.2 | |
| ##FILTER=<ID=PASS,Description="All filters passed"> | |
| ##fileDate=20191113 | |
| ##source=freeBayes v1.3.1-dirty | |
| ##reference=reference/ref.fa | |
| ##contig=<ID=Chromosome,length=4411532> | |
| ##phasing=none | |
| ##commandline="freebayes -p 2 -P 0 -C 10 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 10 -F 0.05 -f reference/ref.fa snps.bam --region Chromosome:0-4411532" | |
| ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus"> | |
| ##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype."> |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| ##fileformat=VCFv4.2 | |
| ##FILTER=<ID=PASS,Description="All filters passed"> | |
| ##fileDate=20191113 | |
| ##source=freeBayes v1.3.1-dirty | |
| ##reference=reference/ref.fa | |
| ##contig=<ID=Chromosome,length=4411532> | |
| ##phasing=none | |
| ##commandline="freebayes -p 2 -P 0 -C 10 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 10 -F 0.05 -f reference/ref.fa snps.bam --region Chromosome:0-4411532" | |
| ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus"> | |
| ##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype."> |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| DEBUG conda.gateways.logging:set_verbosity(231): verbosity set to 2 | |
| DEBUG conda.core.solve:solve_final_state(222): solving prefix /home/pvh/anaconda3/envs/rgi | |
| specs_to_remove: frozenset() | |
| specs_to_add: frozenset({MatchSpec("rgi")}) | |
| prune: <auxlib._Null object at 0x7f64fad13ac8> | |
| Collecting package metadata (current_repodata.json): ...working... DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
| DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
| DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
| DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
| DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| DEBUG conda.gateways.logging:set_verbosity(231): verbosity set to 2 | |
| DEBUG conda.core.solve:solve_final_state(222): solving prefix /home/pvh/anaconda3/envs/rgi | |
| specs_to_remove: frozenset() | |
| specs_to_add: frozenset({MatchSpec("rgi=5.1.0")}) | |
| prune: <auxlib._Null object at 0x7f2630af0a20> | |
| Collecting package metadata (current_repodata.json): ...working... DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
| DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
| DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
| DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
| DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| (MTB_anc:0.0000404279,(ERR552627:0.0000095331,((ERR552650:0.0000037342,((((((((((((((ERR552714:0.0000016579,(ERR552408:0.0000008225,ERR552184:0.0000007560)93:0.000000231)90:0.000000696,(((ERR553080:0.0000045365,((ERR552633:0.0000026571,(ERR552243:0.0000018134,ERR553326:0.0000013601)100:0.000001425)95:0.000000683,ERR551209:0.0000031228)98:0.000000753)96:0.000001007,ERR552360:0.0000014937)84:0.000000755,ERR552967:0.0000011968)97:0.000001811)80:0.000000301,ERR552867:0.0000028514)85:0.000000749,ERR552368:0.0000020435)92:0.000000933,(((((((ERR551425:0.0000015400,(((ERR553305:0.0000015318,((ERR550804:0.0000020422,ERR552380:0.0000002294)86:0.000000694,ERR551517:0.0000015567)69:0.000000289)87:0.000000458,ERR551049:0.0000013181)91:0.000000926,ERR553279:0.0000002522)80:0.000000440)75:0.000000492,(((((ERR553288:0.0000011334,ERR551021:0.0000009067)98:0.000000774,((((((((((ERR552854:0.0000005301,ERR550691:0.0000019543)98:0.000000680,ERR552629:0.0000017437)100:0.000001673,(ERR553115:0.0000011389,(ERR551913:0.0000004540,E |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >MTB_anc foo | |
| CCCCGGGAGCCCGGTAGGCCGTCGGATGCGTCCCGCCCGGCGCGCCGTCCGCCACTCGGT | |
| CGCACGCCCGGCCGGCCCCTAATGTTCGGCCACACCGAGCGGGCGAGAGGGGTGACTCGG | |
| AGTCCCGGAGGCCGCCCCGGCCGAGTGCGTCGCCCACGCCGCGGCTTCCATGTGACATGC | |
| TGGCCGAGCAGACAGAAGACGGGACGATCGCCCTCACGCGCGGGGGACCCGTGTGCAGGT | |
| CCGGGGCCCGCAAGGCGACATGCCAACGGGCTTACACCCAATCTCCGCTGCTGTCCGCCA | |
| ACACACGGTATTCCCCGGCGCGCCAGCCACGGGCTCTGGAGAACACCCATGACGGGGCGC | |
| CCCGGCGCCCCCCCACGGAGAGGTACCGCCGCGGGAGCTCAGGGGGGCAGTTCTGGCCCT | |
| ACGGAGGGCGGCTGTAGCCCGCCCTCTGCCCGAGCGGAGTCTCGGGGGCGGCGGGGACCT | |
| CCGGATGCGTCTCTGAGGAGGTCTCGCGCCGCGTAGTTTGGTCTCAGCGCGACTGCGCCC |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/usr/bin/env cwl-runner | |
| cwlVersion: v1.0 | |
| class: CommandLineTool | |
| id: kraken2 | |
| baseCommand: | |
| - kraken2 | |
| inputs: | |
| database: | |
| type: | |
| - Directory |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| library(tidyverse) | |
| surveys <- read_csv("data_raw/portal_data_joined.csv") | |
| str(surveys) | |
| select(surveys, plot_id, species_id, weight) | |
| select(surveys, -record_id, -species_id) | |
| filter(surveys, year == 1995) | |
| surveys2 <- filter(surveys, weight < 5) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| download.file(url = "https://ndownloader.figshare.com/files/2292169", | |
| destfile = "data_raw/portal_data_joined.csv") | |
| getwd() # show where I am | |
| surveys <- read.csv("data_raw/portal_data_joined.csv") | |
| head(surveys) | |
| View(surveys) | |
| weight_g <- c(10, 50, 30) |