This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| __default__: | |
| nCPUs : 1 | |
| memory : 10000 | |
| name : "mykrobe.{rule}.{wildcards}" | |
| output : "logs/cluster_{rule}.{wildcards}.o" | |
| error : "logs/cluster_{rule}.{wildcards}.e" | |
| map_minimap2: | |
| nCPUs : 16 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| class: CommandLineTool | |
| cwlVersion: v1.0 | |
| $namespaces: | |
| s: 'http://schema.org/' | |
| baseCommand: | |
| - porechop | |
| inputs: | |
| output_format: | |
| type: | |
| - 'null' |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| study_accession sample_accession secondary_sample_accession experiment_accession run_accession tax_id scientific_name instrument_model library_layout fastq_ftp fastq_galaxy submitted_ftp submitted_galaxy sra_ftp sra_galaxy cram_index_ftp cram_index_galaxy | |
| PRJEB22237 SAMEA104221057 ERS1880075 ERX2157080 ERR2099775 1773 Mycobacterium tuberculosis Illumina MiSeq PAIRED ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_1.fastq.gz;ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_2.fastq.gz ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_1.fastq.gz;ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_2.fastq.gz ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_1.filtered.fastq.gz;ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_2.filtered.fastq.gz ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_1.filtered.fastq.gz;ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_2.filtered.fastq.gz ftp.sra.ebi.ac.uk/vol1/err/ERR209/005/ERR2099775 ft |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| vl = QgsVectorLayer("Point?crs=epsg:4326&field=id:integer&field=name:string(20)&index=yes", "temporary_points", "memory") | |
| pr = vl.dataProvider() | |
| pr.addAttributes([QgsField("name", QVariant.String), QgsField("age", QVariant.Int), QgsField("size", QVariant.Double)]) | |
| vl.updateFields() | |
| fet = QgsFeature() | |
| fet.setGeometry(QgsGeometry.fromPointXY(QgsPointXY(10,10))) | |
| fet.setAttributes(["Johny", 2, 0.3]) | |
| pr.addFeatures([fet]) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| {"failed": true, "dataset_id": 68, "type": "dataset", "ext": "data", "stderr": "Failed to find file_path %s.bkp in {u'%s.idx': {u'name': u'hard_masked_seabass_genome.seq', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_xU_6zT', u'purge_source': True, u'type': u'file', u'to_posix_lines': True}, u'%s.seq': {u'name': u'hard_masked_seabass_genome.bkn', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_qpUHCf', u'purge_source': True, u'type': u'file', u'to_posix_lines': True}, u'%s.bkn': {u'name': u'hard_masked_seabass_genome.bkp', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_p1w3_I', u'purge_s |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| cd client && yarn run build | |
| yarn run v1.15.2 | |
| $ NODE_ENV=development gulp staging && concurrently -r "yarn run webpack" "yarn run gulp clean && yarn run gulp" && yarn run save-build-hash | |
| [15:27:36] Using gulpfile /tools/software/galaxy/galaxy1/client/gulpfile.js | |
| [15:27:36] Starting 'stage-libs'... | |
| [15:27:36] Starting 'fonts'... | |
| [15:27:36] Finished 'fonts' after 511 ms | |
| $ gulp clean | |
| $ webpack -d | |
| [15:28:09] Using gulpfile /tools/software/galaxy/galaxy1/client/gulpfile.js |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| No numpy version specified in conda_build_config.yaml. Falling back to default numpy value of 1.11 | |
| WARNING:conda_build.metadata:No numpy version specified in conda_build_config.yaml. Falling back to default numpy value of 1.11 | |
| Adding in variants from internal_defaults | |
| INFO:conda_build.variants:Adding in variants from internal_defaults | |
| Attempting to finalize metadata for dtoolcore | |
| INFO:conda_build.metadata:Attempting to finalize metadata for dtoolcore | |
| Traceback (most recent call last): | |
| File "/usr/people/pvh/miniconda3/lib/python3.6/site-packages/urllib3/contrib/pyopenssl.py", line 280, in recv_into | |
| return self.connection.recv_into(*args, **kwargs) | |
| File "/usr/people/pvh/miniconda3/lib/python3.6/site-packages/OpenSSL/SSL.py", line 1814, in recv_into |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| dna = 'ctgtaacttagttggctctttcgtagcccattgtcgggctagctatttcactcccgcgggggtctccgcgtggatggt' | |
| codon1 = dna[0:3] | |
| codon2 = dna[3:6] | |
| codon3 = dna[6:9] | |
| codon4 = dna[12:15] | |
| codon5 = dna[15:18] | |
| print(codon1) | |
| print(codon2) | |
| print(codon3) | |
| print(codon4) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| pattern_buffer[pattern_counter] = c; | |
| output_buffer.write(&pattern_buffer[0..pattern_counter+1]).expect("failed to write pattern buffer to output file"); | |
| state = 4; | |
| pattern_counter = 0; |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Mycobacterium avium subsp. paratuberculosis K-10 GCF_000007865.1 | |
| Mycobacterium avium 104 GCF_000014985.1 | |
| Mycobacterium avium subsp. paratuberculosis MAP4 GCF_000390085.1 | |
| Mycobacterium avium subsp. avium 2285 (R) GCF_000758285.1 | |
| Mycobacterium avium subsp. avium GCF_000770235.1 | |
| Mycobacterium avium subsp. hominissuis TH135 GCF_000829075.1 | |
| Mycobacterium avium subsp. avium 2285 (S) GCF_000831285.1 | |
| Mycobacterium avium subsp. paratuberculosis GCF_000835225.1 | |
| Mycobacterium avium subsp. paratuberculosis GCF_000835265.1 | |
| Mycobacterium avium subsp. paratuberculosis GCF_001653355.1 |